Environmental Toxicology and Pharmacology 42 (2016) 198–204
Contents lists available at ScienceDirect
Environmental Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/etap
Aluminum trichloride inhibits osteoblastic differentiation through inactivation of Wnt/-catenin signaling pathway in rat osteoblasts Zheng Cao 1 , Yang Fu 1 , Xudong Sun, Qiuyue Zhang, Feibo Xu, Yanfei Li ∗ College of Veterinary Medicine, Northeast Agricultural University, NO. 59 Mucai Street, Xiangfang District, Harbin 150030, China
a r t i c l e
i n f o
Article history: Received 28 August 2015 Received in revised form 25 November 2015 Accepted 30 November 2015 Available online 8 December 2015 Keywords: Aluminum trichloride Osteoblastic differentiation Wnt/-catenin pathway Rat osteoblasts
a b s t r a c t Exposure to aluminum (Al) suppresses bone formation. Osteoblastic differentiation plays a key role in the process of bone formation. However, the effect of Al on osteoblastic differentiation is still controversial, and the mechanism remains unclear. To investigate the effect of Al on osteoblastic differentiation and whether Wnt signaling pathway was involved in it, the primary rat osteoblasts were exposed to 1/40 IC50, 1/20 IC50 and 1/10 IC50 of aluminum trichloride (AlCl3 ) for 24 h, respectively. The activity analysis of alkaline phosphate, qRT-PCR analysis of type I collagen, alkaline phosphate, Wnt3a and Dkk-1, Western blot analysis of p-GSK3, GSK3 and -catenin protein and Immunofluorescence staining for -catenin suggested that AlCl3 inhibited osteoblastic differentiation and Wnt/-catenin pathway. Moreover, we found exogenous Wnt3a application reversed the inhibitory effect of AlCl3 on osteoblastic differentiation, accompanied by activating the Wnt/-catenin pathway. Taken together, these findings suggest that AlCl3 inhibites osteoblastic differentiation through inactivation of Wnt/-catenin pathway in osteoblasts. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Aluminum (Al) is an accumulative toxic metal for human and can enter body via air, water and foods (Willhite et al., 2014). However, Al is used in various fields, such as water purifiers, food additives, pharmaceuticals, and vaccines; it is also present in ambient and occupational airborne particulatesal (Cao et al., 2010; Ohno et al., 2010; Weinbruch et al., 2010; Boullemant, 2011; Dabeka et al., 2011; Skalny et al., 2015). In addition, the growing prevalence of acid rain and bauxite mines exploitation can result in the discharge of larger amounts of Al salts from insoluble minerals, raising the risk of human contact with Al (Smith, 1996; Borgmann et al., 2007). In daily life, the Al of human absorbed from water and food are 0.005 g/kg/day and 0.08–0.5 g/kg/day. But Al absorbed from industrial air and dialysis solution can reach up to 0.6–8 g/kg/day and 9 g/kg/day(Yokel and Mcnamara, 2001). Although, only 0.05–2.2% of daily Al intake is absorbed, its elimination is slow and accumulated in deep compartment (e.g., bone) for years under continuous intake conditions(Priest, 2004; Ohno et al., 2010). Bone is the main target organ of Al accumulation, 58–70% of the total human Al body burden accumulates in bone (Ganrot, 1986;
∗ Corresponding author. Tel.: +86 13936574268; fax: +86 451 55191672. E-mail address: [email protected] (Y. Li). 1 Both authors are contributed equally to this study. http://dx.doi.org/10.1016/j.etap.2015.11.023 1382-6689/© 2015 Elsevier B.V. All rights reserved.
Krewski et al., 2007). Excessive Al accumulation causes toxic effects on bones, thereby induces osteodystrophy, osteomalacia and osteoporosis (Boyce et al., 1992; Jorgetti et al., 1994; Jeffery et al., 1996; Li et al., 2011). In dialyzed patients, as bone Al concentrations increased from 46 ± 7 to 175 ± 22 mg/kg (dry weight), the severity of Al-induced bone disease increased (Hodsman et al., 1982). Al-induced bone disease is characterized by suppressed bone formation (Malluche et al., 1987; Quarles, 1990; Kasai et al., 1991). Osteoblasts (OBs) are main functional cells for bone formation, which can be influenced by proliferation, differentiation, mineralization and apoptosis of OBs (Ducy et al., 2000). Previous studies showed that Al induced osteoblast apoptosis and inhibited proliferation and mineralization of osteoblast (Sedman et al., 1987; Blair et al., 1989; Bellows et al., 1995; Li et al., 2012; Cao et al., 2015). However, the effect of Al on the osteoblastic differentiation is controversial. Some research showed that Al inhibited the osteoblastic differentiation (Lieberherr et al., 1987; Lau et al., 1991), while others presented the opposite results (Karlsson et al., 2003; Song et al., 2013). Thus, it is necessary to clarify the effect of Al on osteoblastic differentiation. The Wnt/-catenin pathway is an important modulator of OBs function and bone formation (Glass and Karsenty, 2007; Deschaseaux et al., 2009; Baron and Kneissel, 2013). This pathway is triggered by binding Wnt glycoprotein family members (such as Wnt-1 and 3) to a co-receptor complex including Frizzled and low density receptor-like proteins 5 and 6 (Mao et al., 2001b). This is followed by phosphorylation (inactivation) of glycogen
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
synthase kinase (GSK3) to stabilize of -catenin. The -catenin then translocates into the nucleus, where it forms a complex with a T-cell factor to induce the transcription of osteoblastic genes (Bennett et al., 2005; Gaur et al., 2005; Sato et al., 2009). Many studies showed that the Wnt/-catenin pathway is involved in the osteoblastic differentiation (Chen et al., 2010; Guo et al., 2011; Park et al., 2011; Tian et al., 2011; López-Herradón et al., 2013; Pan et al., 2014). However, it remains unknown whether Wnt/-catenin pathway is involved in the effect of Al on osteoblastic differentiation. To examine the effect of AlCl3 on osteoblastic differentiation and whether Wnt/-catenin pathway was involved in it, the primary rat OBs were treated with AlCl3 . Then the effects of AlCl3 on the osteoblastic differentiation markers (ALP, CoL-Iand Runx2) and key components of Wnt/-catenin signaling were determined in OBs. We found AlCl3 suppressed osteoblastic differentiation and inactivated the Wnt/-catenin pathway. Moreover, we observed the inhibitory effect of AlCl3 on osteoblastic differentiation and Wnt/catenin pathway were both reversed by exogenous Wnt3a. Our results suggest AlCl3 inhibits osteoblastic differentiation through inactivation of Wnt/-catenin pathway in rat OBs. 2. Materials and methods 2.1. OBs culture and treatment The experimental designs and procedures were approved by the Animal Ethics Committee of the Northeast Agricultural University (Harbin, CHN). The primary OBs were derived from calvarium of 1-day-old Sprague–Dawley rats as previously described (Pan et al., 2014). The rat calvarium was cut into 1–2 mm2 pieces and consecutively digested using trypsin (2.5 g/L; Gibco, USA) for 10 min and collagenase II (1.0 g/L; Gibco, USA) for three sequential digestion periods of 15, 30 and 60 min at 37 ◦ C. The supernatant of 15 min and 30 min digestions were discarded, and cells obtained from the 60 min digestions were in presence of DMEM(Gibco, USA) supplemented with 10% FBS(Gibco, USA), 2 mM-glutamine (Gibco, USA), 1% penicillin/streptomycin (Gibco, USA) in a humidified 5% CO2 incubator at 37 ◦ C. The cells between 2th and 3th passage were harvested after reaching 90% confluence, and then were plated in medium supplemented using 50 g/mL ascorbic acid (Sigma, USA) and 10 mM -glycerophosphate (Sigma,USA) for 12 days, and the medium was changed every 2 days. The treatments of OBs were divided into two parts, one part was treated with 0 (control group, CG), 1/40 IC50 (Low-dose group, LG), 1/20 IC50 (Mid-dose group, MG) and 1/10 IC50 (High-dose group, HG) of AlCl3 (Aladdin, CHN), the other part was treated with AlCl3 (1/10 IC50), AlCl3 (1/10 IC50) +Wnt3a (100 ng/mL; PeproTech, USA) and without AlCl3 and Wnt3a (control group, CG) at 37 ◦ C in 5% CO2 for 24 h, respectively. Our previous work had demonstrated that the IC50 of AlCl3 on OBs was 8.16 mmol/L (Li et al., 2012). The final concentration of Wnt3a was 100 ng/mL, according to the previous research (Guo et al., 2011; Arioka et al., 2014).
199
2.3. qRT-PCR analysis OBs were harvested and rinsed twice using ice-cold PBS. The total RNA was extracted using Trizol Reagent (Invitrogen, USA), and was analyzed using spectrophotometry at 260 and 280 nm (Pharmacia Biotech, UK). Only samples with an optical density ratio at 260/280 nm > 1.8 were used for further analyses. Then each sample was reversely transcribed into cDNA using a reverse transcription kit (Trans Script First-Strand cDNA Synthesis Super Mix, Trans Gen Blotech, CHN). The primers of the genes are shown in Table 1. Gene expressions were examined using SYBR Green/Fluoresce in qPCR Master Mix via 7000 real-time PCR detection system (ABI, USA). 2.4. Western blot analysis The OBs were harvested in cell lysis buffer, and incubated for 15 min at 0 ◦ C. Then they were centrifuged for 5 min at 600 × g at 4 ◦ C, and the supernatant was used to detect the object protein. The protein concentration of the supernatant was determined by BCA assay (Beyotime, CHN). The protein was separated using polyacrylamide gels, electro-transferred onto PVDF membranes, and blocked with 5% non-fat milk in TBST buffer for 2 h. Then the membranes were incubated using anti-GSK3, anti-p-GSK3 and anti--catenin (Santa, USA) at dilutions of 1:400 in 5% non-fat milk overnight at 4 ◦ C, and washed three times using TBST, for 20 min each time. After that, the membranes were incubated using the secondary antibodies at dilutions of 1:4000 for 1 h at room temperature, and then washed three times using TBST. Finally, the object protein was detected using the enhanced chemiluminescent (ECL) reagent (Beyotime, CHN). To assess the presence of comparable amount of proteins in each lane, the membranes were stripped finally to detect the -actin. Quantitative analysis was carried out using Gel-Pro analyzer 4 image analysis system. 2.5. Immunofluorescence localization of ˇ-catenin The OBs growing on coverslips were exposed to AlCl3 for 24 h, and then rinsed using cold PBS twice, flexed using ice-cold methanol and permeabilized using 0.5% Triton X-100 for 15 min. After blocked with 0.5% bovine serum albumin for 1 h at room temperature, OBs were incubated using mouse monoclonal anti-catenin (1:200) overnight at 4 ◦ C followed by FITC-conjugated secondary antibody and DAPI. The fluorescence signal of -catenin was visualized using confocal fluorescence microscopy (Olympus, Japan). 2.6. Statistical analysis Data were presented as mean ± standard deviation (SD). The data were analyzed by one-way analysis of variance followed by Student’s t-test (SPSS 17.0 software; SPSS Inc., Chicago, IL, USA) and drawn histograms by Graphpad Prism 6.0. Values are means ± SD of at least three independent measurements in triplicate. Values of p < 0.05 (*or#) were considered statistically significant and values of p < 0.01 (**or##) were considered highly significant.
2.2. ALP activity 3. Results The intracellular ALP activity was quantitated using commercially available kits (Beyotime, CHN). OBs were rinsed twice using ice-cold PBS, followed by homogenization in alkaline lysis buffer. After centrifugation, the resulting cell homogenate was incubated with p-nitrophenyl phosphate at 37 ◦ C for 30 min. The results were normalized by the total intracellular protein content determined by the bicinchoninic acid (BCA) Protein Assay Kit (Beyotime, CHN) and expressed in nanomoles of produced p-nitrophenol per min per mg of protein (nmol/min/mg protein).
3.1. AlCl3 inhibited osteoblastic differentiation To investigate the effect of AlCl3 on osteoblastic differentiation, ALP activity, the ALP and COL-I mRNA levels were examined using commercially available kits and qRT-PCR. The ALP activity and the mRNA levels of ALP and COL-I were lower in AlCl3 -treated group than those in control group (Fig. 1). These results suggest that AlCl3 inhibits osteoblastic differentiation in OBs.
200
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
Table 1 Primer sequence and amplification length of destination fragment. Gene
Upstream and downstream primer sequence
Primer length (bp)
Product length (bp)
ALP
UP 5 ACCCTGCCTTACCAACTCATT3 LOW5 TCTCCAGCCGTGTCTCCTC3
21 19
233
COL-I
UP 5 AGCAGACGGGAGTTTCACCTC3 LOW 5 TGTCTTCTTGGCCATGCGTC3
21 21
193
Wnt-3a
UP 5 AGAGTCTCGTGGCTGGGTGGAC3 LOW5 GTTGGGCTCGCAGAAGTTAGG3
21 21
108
Dkk-1
UP 5 TTTCCCTAAGTGACCGACAG3 LOW 5 TGGGACCATTCTTCAGCA3
20 18
158
Runx-2
UP 5 GCACTATCCAGCCACCTTCA3 LOW 5 CTTCCATCAGCGTCAACACC3
20 20
321
-actin
UP 5 AGGGAAATCGTGCGTGACAT3 LOW 5 CCTCGGGGCATCGGAA3
20 16
163
translocation into nucleus. These results suggest that AlCl3 inhibits stabilization and nuclear translocation of -catenin protein in OBs. We then focused on Wnt3a and Dkk-1 which are antagonistically upstream regulator of Wnt/-catenin pathway and may be affected by AlCl3 . The mRNA expression of Wnt3a in AlCl3 -treated group was lower than that in control group, and the mRNA expression of Dkk-1, which was a powerful antagonist of Wnt/-catenin signaling, was higher than that in control group (Fig. 3). Collectively, these results suggest that AlCl3 inactivates the Wnt/-catenin pathway. 3.3. AlCl3 suppressed osteoblastic differentiation via Wnt/ˇ-catenin pathway
Fig. 1. AlCl3 suppressed osteoblastic differentiation. The ALP activity and the mRNA levels of ALP and COL-I were examined using commercially available kits and qRTPCR. *p < 0.05 or ** p < 0.01 vs. control value.
The aforementioned results suggested an association among AlCl3 , Wnt/-catenin pathway and osteoblastic differentiation, that is, AlCl3 might suppress osteoblastic differentiation through Wnt/-catenin pathway. To prove it, the OBs were exposed to AlCl3 (1/10 IC50 ) with and without exogenous Wnt3a (100 ng/ml) for 24 h. Our results showed the intracellular ALP activity, mRNA levels of ALP and COL-I in AlCl3 + Wnt3a group were higher than those in AlCl3 group(Fig. 4A). Additionally, ratio of p-GSK3/GSK3 and level of -catenin protein in AlCl3 + Wnt3a group were also higher than those in AlCl3 group (Fig. 4B). These results suggest that the inhibitory effect of AlCl3 on osteoblastic differentiation is reversed by exogenous Wnt3a application, accompanied by activating Wnt/-catenin pathway. We next examined the effect of Al on the mRNA level of Runx2 by qRT-PCR. Runx2 is a target gene of Wnt/-catenin pathway and a master transcription factor in controlling the osteoblast differentiation. The mRNA level of Runx2 in AlCl3 group was lower than that in control group, and in AlCl3 + Wnt3a group was more than that in AlCl3 group (Fig. 4C). These results indicated that AlCl3 decreased Runx2 mRNA expression, and Wnt3a reversed this decrease. Collectively, these results suggest that AlCl3 suppresses osteoblastic differentiation by inactivating the Wnt/-catenin pathway.
3.2. AlCl3 inactivated the Wnt/ˇ-catenin signaling pathway 4. Discussion To investigate the effect of AlCl3 on Wnt/-catenin pathway, the key components of Wnt/-catenin pathway were initially examined using Western blot, including the p-GSK3, GSK-3 and -catenin. The relative intensity of p-GSK3 is normalized by GSK3 protein levels. The ratio of p-GSK3/GSK3 and the levels of -catenin protein were lower in AlCl3 -treated group than those in control group (Fig. 2A). Subsequently, we examined the effect of AlCl3 on the nucleus translocation of -catenin, which is a critical step in controlling the Wnt/-catenin pathway, using immunofluorescence assay. As shown in Fig. 2B, AlCl3 decreased -catenin
In this study, several important observations were obtained. First, we found that AlCl3 decreased ALP activity and mRNA expressions of ALP, COL-I and Runx2. These results indicated that AlCl3 suppressed osteoblastic differentiation. Then, we found that AlCl3 could target key components of the Wnt/-catenin pathway and decrease -catenin stabilization and translocation, which indicated the inhibitory effect of AlCl3 on Wnt/-catenin pathway in OBs. Finally, exogenous Wnt3a application reversed the inhibitory effect of AlCl3 on osteoblastic differentiation, accompanied by
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
201
Fig. 2. AlCl3 reduced relative intensities of p-GSK3ˇ and ˇ-catenin and suppressed ˇ-catenin nuclear translocation. (A) The p-GSK3, GSK3 and -catenin protein expressions were assessed by Western blot (left panel). Relative intensities of p-GSK3 and -catenin, which were normalized with total GSK3 and -actin protein levels, and were indicated at the right panel. * p < 0.05 or ** p < 0.01 vs. control value. (B) The OBs were exposed to AlCl3 for 24 h., followed by the immunofluorescence for -catenin (green) using anti--catenin. The nuclei were stained with DAPI (blue). Arrows indicate nuclear localization. A representative result from the three independent experiments is shown. Scale bar, 50 m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 3. AlCl3 affects Wnt3a and Dkk1 gene expression. The mRNA levels of Wnt3a and Dkk1 was examined using qRT-PCR. ** p < 0.01 vs. control value.
activating the Wnt/-catenin pathway. All above results suggest that AlCl3 inhibites osteoblastic differentiation through inactivation of Wnt/-catenin signaling pathway in OBs. ALP and COL-I are produced by OBs at distinct phases of differentiation and regard as osteoblast differentiation markers (Bancroft
et al., 2002; Shin et al., 2004; Kim et al., 2005). In this study, we found that AlCl3 at concentrations of 0.204 mM, 0.408 mM and 0.816 mM decreased the activity of ALP and the gene expressions of ALP and COL-I. However, other research observed the opposite results. Karlsson et al and Song et al study shown the nano-porous alumina increased ALP activity in human osteosarcoma MG-63 cells and primary human OBs (Karlsson et al., 2003; Song et al., 2013). One possible cause is the species differences. Another possibility is that nano-porous alumina is slightly resolved in the medium of OBs. Only 41 M of Al released from the nano-porous alumina when immersed in medium of OBs for 9 days (Karlsson et al., 2003). Thus, the concentrations of Al3+ in MG-63 cells and human OBs were lower than that in our cultures. Previous studies indicated that the effect of Al3+ on osteoblastic differentiation depended on cell type and concentration of Al. In neonatal mouse OBs, the concentrations within the range of 10−8 to 10−6 M of AlCl3 increased ALP activity and CoL1 synthesis, and concentrations within the range of 10−6 to 10−5 M of AlCl3 decreased them (Lieberherr et al., 1987). In human osteosarcoma TE-85 cells, the aluminum sulfate whose concentration is lower than 50 M increased ALP activity, whose concentrations within the range of 50 to 200 M caused
202
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
Fig. 4. The effect of exogenous Wnt3a on osteoblastic differentiation marks and Wnt/ˇ-catenin pathway in AlCl3 -treated OBs. (A) The ALP activity and the mRNA levels of ALP and COL-I were examined using commercially available kits and qRT-PCR. (B) The p-GSK3, GSK3 and -catenin protein expressions were assessed by Western blotand, and were indicated at the right panel. (C) The gene level of Runx2 was measured by qRT-PCR. ** p < 0.01 vs. control value; ## p < 0.01 vs. AlCl3 value.
toxicity on these cells, and whose concentration is more than 200 M reduced the ALP activity to the undetectable level (Lau et al., 1991). These studies indicated that low concentration of AlCl3 stimulated osteoblastic differentiation and high concentration of AlCl3 suppressed it. Our previous study showed the same concentration of AlCl3 as it in this study induced oxidative injury of rat OBs (Li et al., 2012), which maybe a main reason for the inhibitory effect of AlCl3 on osteoblastic differentiation. Moreover, in dialyzed patients, excessive bone Al accumulation (46 ± 7–175 ± 22 mg/kg) induced low-turnover bone disease, which is characterized by the decrese of osteoblastic acrivity and number (Bushinsky, 1997; Hodsman et al., 1982). It also provides histological evidence for
inhibitory effect of high Al concentration on OBs, which is consistent with our results. Wnt3a is an important member of the Wnt protein family. This protein activates canonical Wnt/-catenin pathway, and its expression is associated with osteoblast differentiation (Bain et al., 2003; Cho et al., 2009). Decrease gene expression of Wnt3a is associated with inhibition of Wnt/-catenin pathway and osteoblastic differentiation (López-Herradón et al., 2013). Dkk1 is an upstream inhibitor of Wnt/-catenin pathway (Mao et al., 2001a). The increase of Dkk-1 inactivates Wnt/-catenin pathway and inhibits osteoblastic differentiation (Fujita and Janz, 2007; Qiang et al., 2008; Chen et al., 2010). In this experiment, the decrease of Wnt3a
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
mRNA and the increase of Dkk-1 mRNA indicate that AlCl3 inhibited the Wnt/-catenin pathway. Moreover, inaction of Wnt/-catenin pathway further increases the expression of Dkk-1 which is target gene of Wnt/-catenin pathway (Chamorro et al., 2005). Thus, the inhibitory effect of AlCl3 on Wnt/-catenin pathway may be induced by downregulated Wnt3a. The GSK3 phosphorylates -catenin, thereby induces degradation of -catenin (Zeng et al., 1997), and p-GSK3 increases cytoplasmic stabilization of -catenin. Previous studies showed decrease of p-GSK-3/GSK-3 induces degradation of -catenin and inaction of Wnt/-catenin pathway (Matsuzaki et al., 2006; Chen et al., 2010; López-Herradón et al., 2013). In this experiment, AlCl3 down-regulates p-GSK3/GSK3, and then promotes the degradation of -catenin in OBs. Furthermore, p-GSK3/GSK3 is regulated by multiple molecular mechanisms such as Wnt/catenin, PI3K/Akt and BMPs signaling pathway in OBs (Fukuda et al., 2010; Wang and Guo, 2013). Thus, our present data determines AlCl3 decrease p-GSK3/GSK3 in part by inactivating the Wnt/-catenin signaling pathway. In our future study, we will further check molecular mechanism of decrease of p-GSK3/GSK3 in Al-treated OBs. -catenin is the molecular node of the Wnt/-catenin pathway (Gordon and Nusse, 2006). -catenin expression and translocation is required for OBs to complete the differentiation process and synthesize properly formed bone (Day et al., 2005; Hill et al., 2005; Holmen et al., 2005; Hu et al., 2005). Decrease of expression and translocation of -catenin leads to diminish the expression of osteoblastic genes such as ALP, Col1 and Runx2 in OBs (Gaur et al., 2005; Sato et al., 2009; López-Herradón et al., 2013). In present study, our results show that the decreased gene expression of ALP, COL-Iand Runx2 are accredited to the decrease of -catenin protein expression and nuclear translocation in Al-treated primary rat OBs. Runx2, a transcription factor, regulates osteoblast-related genes (COL-I, ALP, osteocalcin) in OBs (Bialek et al., 2004; Komori, 2010; Prince et al., 2001). Several significant observations show that Runx2 is a direct target of the Wnt/-catenin pathway and plays an essential role in osteoblastic differentiation and bone formation (Gaur et al., 2005; Day et al., 2005). Our results demonstrate that AlCl3 decreases Runx2 gene expression, and it is reversed by exogenous Wnt3a application. Therefore, it can be concluded that AlCl3 decreases Runx2 gene expression through inactivation of Wnt/catenin signaling. 5. Conclusions In conclusion, our results indicate that AlCl3 inhibits osteoblastic differentiation through inactivation of Wnt/-catenin signaling pathway in OBs. Exogenous Wnt3a application targets this pathway and thereby counteracts inhibitory effect of AlCl3 on osteoblastic differentiation. Acknowledgements This work was supported by the following grant: Northeast Agricultural University Innovation Foundation for Postgraduate (yjscx14016), Natural Science Foundation of Heilongjiang Province (C201425) and National Natural Science Foundation of China (31372496). References Arioka, M., Takahashi-Yanaga, F., Sasaki, M., Yoshihara, T., Morimoto, S., Hirata, M., Mori, Y., Sasaguri, T., 2014. Acceleration of bone regeneration by local application of lithium: Wnt signal-mediated osteoblastogenesis and Wnt signal-independent suppression of osteoclastogenesis. Biochem. Pharmacol. 90, 397–405.
203
Bain, G., Muller, T., Wang, X., Papkoff, J., 2003. Activated beta-catenin induces osteoblast differentiation of C3H10T1/2 cells and participates in BMP2 mediated signal transduction. Biochem. Biophys. Res. Commun. 301, 84–91. Bancroft, G.N., Sikavitsas, V.I., van den Dolder, J., Sheffield, T.L., Ambrose, C.G., Jansen, J.A., Mikos, A.G., 2002. Fluid flow increases mineralized matrix deposition in 3D perfusion culture of marrow stromal osteoblasts in a dose-dependent manner. Proc. Natl. Acad. Sci. U.S.A. 99, 12600–12605. Baron, R., Kneissel, M., 2013. WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nat. Med. 19, 179–192. Bellows, C.G., Aubin, J.E., Heersche, J.N.M., 1995. Aluminum inhibits both initiation and progression of mineralization of osteoid nodules formed in differentiating rat calvaria cell cultures. J. Bone Miner. Res. 10, 2011–2016. Bennett, C.N., Longo, K.A., Wright, W.S., Suva, L.J., Lane, T.F., Hankenson, K.D., MacDougald, O.A., 2005. Regulation of osteoblastogenesis and bone mass by Wnt10b. Proc. Natl. Acad. Sci. U.S.A. 102, 3324–3329. Bialek, P., Kern, B., Yang, X., Schrock, M., Sosic, D., Hong, N., Wu, H., Yu, K., Ornitz, D.M., Olson, E.N., Justice, M.J., Karsenty, G., 2004. A twist code determines the onset of osteoblast differentiation. Dev. Cell 6, 423–435. Blair, H.C., Finch, J.L., Avioli, R., Crouch, E.C., Slatopolsky, E., Teitelbaum, S.L., 1989. Micromolar aluminum levels reduce 3H-thymidine incorporation by cell line UMR 106-01. Kidney Int. 35, 1119–1125. Borgmann, U., Couillard, Y., Grapentine, L.C., 2007. Relative contribution of food and water to 27 metals and metalloids accumulated by caged hyalella azteca in two rivers affected by metal mining. Environ. Pollut. 145, 753–765. Boullemant, A., 2011. PM2.5 emissions from aluminum smelters: coefcients and environmental impact. J. Air Waste Manage. Assoc. 61, 311–318. Boyce, B.F., Byars, J., Mcwilliams, S., Mocan, M.Z., Elder, H.Y., Boyle, I.T., Junor, B.J., 1992. Histological and electron microprobe studies of mineralisation in aluminium-related osteomalacia. J. Clin. Pathol. 45, 502–508. Bushinsky, D.A., 1997. Bone disease in moderate renal failure: cause, nature and prevention. Annu. Rev. Med. 48, 167–176. Cao, H., Qiao, L., Zhang, H., Chen, J., 2010. Exposure and risk assessment for aluminium and heavy metals in Puerh tea. Sci. Total Environ. 408, 2777–2784. Cao, Z., Liu, D., Zhang, Q., Sun, X., Li, Y., 2015. Aluminum chloride induces osteoblasts apoptosis via disrupting calcium homeostasis and activating Ca2+ /CaMKII signal pathway. Biol. Trace Elem. Res., http://dx.doi.org/10.1007/s12011-015-0417-1. Chamorro, M.N., Schwartz, D.R., Alin, V., Brivanlou, A.H., Cho, K.R., Varmus, H.E., 2005. FGF-20 and dkk1 are transcriptional targets of beta-catenin and FGF-20 is implicated in cancer and development. EMBO J. 24, 73–84. Chen, J.R., Lazarenko, O.P., Wu, X., Kang, J., Blackburn, M.L., Shankar, K., Badger, T.M., Ronis, M.J., 2010. Dietary-induced serum phenolic acids promote bone growth via p38 MAPK/-catenin canonical Wnt signaling. J. Bone Miner Res. 25, 2399–2411. Cho, S.W., Yang, J.Y., Sun, H.J., Jung, J.Y., Her, S.J., Cho, H.Y., Choi, H.J., Kim, S.W., Kim, S.Y., Shin, C.S., 2009. Wnt inhibitory factor (WIF)-1 inhibits osteoblastic differentiation in mouse embryonic mesenchymal cells. Bone 44, 1069–1077. Dabeka, R., Fouquet, A., Belisle, S., Turcotte, S., 2011. Lead, cadmium and aluminum in Canadian infant formulae, oral electrolytes and glucose solutions. Food Addit. Contam. A 28, 744–753. Day, T.F., Guo, X., Garrett-Beal, L., Yang, Y., 2005. Wnt/-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev. Cell 8, 739–750. Deschaseaux, F., Sensebe, L., Heymann, D., 2009. Mechanisms of bone repair and regeneration. Trends Mol. Med. 15, 417–429. Ducy, P., Schinke, T., Karsenty, G., 2000. The osteoblast: a sophisticated fibroblast under central surveillance. Science 289, 1501–1504. Fujita, K., Janz, S., 2007. Attenuation of wnt signaling by Dkk-1 and -2 regulates BMP2-induced osteoblast differentiation and expression of OPG, RANKL and MCSF. Mol. Cancer 6, 5158–5164. Fukuda, T., Kokabu, S., Ohte, S., Sasanuma, H., Kanomata, K., Yoneyama, K., Kato, H., Akita, M., Oda, H., Katagiri, T., 2010. Canonical Wnts and BMPs cooperatively induce osteoblastic differentiation through a GSK3-dependent and -cateninindependent mechanism. Differentiation 80, 46–52. Ganrot, P.O., 1986. Metabolism and possible health efects of aluminum. Environ. Health Persp. 65, 363–441. Gaur, T., Lengner, C.J., Hovhannisyan, H., Bhat, R.A., Bodine, P.V., Komm, B.S., Javed, A., van Wijnen, A.J., Stein, J.L., Stein, G.S., Lian, J.B., 2005. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J. Biol. Chem. 280, 33132–33140. Glass 2nd., D.A., Karsenty, G., 2007. In vivo analysis of Wnt signaling in bone. Endocrinology 148, 2630–2634. Gordon, M.D., Nusse, R., 2006. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J. Biol. Chem. 281, 22429–22433. Guo, A.J., Choi, R.C., Cheung, A.W., Chen, V.P., Xu, S.L., Dong, T.T., Chen, J.J., Tsim, K.W., 2011. Baicalin, a flavone, induces the differentiation of cultured osteoblasts: an action via the Wnt/-catenin signaling. J. Biol. Chem. 286, 27882–27893. Hill, T.P., Spater, D., Taketo, M.M., Birchmeier, W., Hartmann, C., 2005. Canonical Wnt/-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev. Cell 8, 727–738. Hodsman, A.B., Sherrard, D.J., Alfrey, A.C., Ott, S., Brickman, A.S., Miller, N.L., Maloney, N.A., Coburn, J.W., 1982. Bone aluminum and histomorphometric features of renal osteodystrophy. J. Clin. Endocr. Metab. 54, 539–546. Holmen, S.L., Zylstra, C.R., Mukherjee, A., Sigler, R.E., Faugere, M.C., Bouxsein, M.L., Deng, L., Clemens, T.L., Nilliams, B.O., 2005. Essential role of -catenin in postnatal bone acquisition. J. Biol. Chem. 280, 21162–21168.
204
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
Hu, H., Hilton, M.J., Tu, X., Yu, K., Ornitz, D.M., Long, F., 2005. Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 132, 49–60. Jeffery, E.H., Abreo, K., Burgess, E., Cannata, J., Greger, J.L., 1996. Systemic aluminum toxicity: effects on bone, hematopoietic tissue, and kidney. J. Toxicol. Environ. Health 48, 649–666. Jorgetti, V., Soeiro, N.M., Mendes, V., Pereira, R.C., Crivellari, M.E., Coutris, G., Borelli, A., Leite, M.O., Nussenzweig, I., Marcondes, M., 1994. Aluminium-related osteodystrophy and desferrioxamine treatment: role of phosphorus. Nephrol. Dial. Transplant. 9, 668–674. Karlsson, M., Pålsgård, E., Wilshaw, P.R., Di Silvio, L., 2003. Initial in vitro interaction of osteoblasts with nano-porous alumina. Biomaterials 24, 3039–3046. Kasai, K., Hori, M.T., Goodman, W.G., 1991. Transferrin enhances the antiproliferative effect of aluminum on osteoblast-like cells. Am. J. Physiol. 260, 537–543. Kim, H.J., Kim, S.H., Kim, M.S., Lee, E.J., Oh, H.G., Oh, W.M., Park, S.W., Kim, W.J., Lee, G.J., Choi, N.G., Koh, J.T., Dinh, D.B., Hardin, R.R., Johnson, K., Sylvia, V.L., Schmitz, J.P., Dean, D.D., 2005. Varying Ti–6Al–4V surface roughness induces different early morphologic and molecular responses in MG63 osteoblast-like cells. J. Biomed. Mater. Res. A 74, 366–373. Komori, T., 2010. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res. 339, 189–195. Krewski, D., Yokel, R.A., Nieboer, E., Borchelt, D., Cohen, J., Harry, J., Kacew, S., Lindsay, J., Mahfouz, A.M., Rondeau, V., 2007. Human health risk assessment for aluminium, aluminium oxide, and aluminium hydroxide. J. Toxicol. Environ. Health B: Crit. Rev. 10, 1–269. Lau, K.H., Yoo, A., Shu, P.W., 1991. Aluminum stimulates the proliferation and differentiation of osteoblasts in vitro by a mechanism that is different from fluoride. Mol. Cell Biochem. 105, 93–105. Li, X., Hu, C., Zhu, Y., Sun, H., Li, Y., Zhang, Z., 2011. Effects of aluminum exposure on bone mineral density, mineral, and trace elements in rats. Biol. Trace Elem. Res. 143, 378–385. Li, X., Han, Y., Guan, Y., Zhang, L., Bai, C., Li, Y., 2012. Aluminum induces osteoblast apoptosis through the oxidative stress-mediated JNK signaling pathway. Biol. Trace Elem. Res. 150, 502–508. Lieberherr, M., Grosse, B., Cournot-Witmer, G., Hermann-Erlee, M.P., Balsan, S., 1987. Aluminum action on mouse bone cell metabolism and response to PTH and 1,25(OH)2D3. Kidney Int. 31, 736–743. ˜ López-Herradón, A., Portal-Núnez, S., García-Martín, A., Lozano, D., Pérez-Martínez, ˜ V., Esbrit, P., 2013. Inhibition of the canonical wnt pathway by high F.C., Cena, glucose can be reversed by parathyroid hormone-related protein in osteoblastic cells. J. Cell Biochem. 114, 1908–1916. Malluche, H.H., Faugere, M.C., Friedler, R.M., Matthews, C., Fanti, P., 1987. Calcitriol, parathyroid hormone, and accumulation of aluminum in bone in dogs with renal failure. J. Clin. Invest. 79, 754–761. Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A., Nihrs, C., 2001a. LDLreceptor-related protein 6 is a receptor for Dickkopf proteins. Nature 411, 321–325. Mao, J., Wang, J., Liu, B., Pan, W., Farr 3rd., G.H., Flynn, C., Yuan, H., Takada, S., Kimelman, D., Li, L., Wu, D., 2001b. Low-density lipoprotein receptor-related protein-5 binds to Axin and regulates the canonical Wnt signaling pathway. Mol. Cell 7, 801–809. Matsuzaki, E., Takahashi-Yanaga, F., Miwa, Y., Hirata, M., Watanabe, Y., Sato, N., Morimoto, S., Hirofuji, T., Maeda, K., Sasaguri, T., 2006. Differentiationinducing factor-1 alters canonical Wnt signaling and suppresses alkaline phosphatase expression in osteoblast-like cell lines. J. Bone Miner. Res. 21, 1307–1316. Ohno, K., Ishikawa, K., Kurosawa, Y., Matsui, Y., Matsushita, T., Magara, Y., 2010. Exposure assessment of metal intakes from drinking water relative to those from total diet in Japan. Water Sci. Technol. 62, 2694–2701.
Park, K.H., Kang, J.W., Lee, E.M., Kim, J.S., Rhee, Y.H., Kim, M., Jeong, S.J., Park, Y.G., Kim, S.H., 2011. Melatonin promotes osteoblastic differentiation through the BMP/ERK/Wnt signaling pathways. J. Pineal. Res. 51, 187–194. Pan, L., Shi, X., Liu, S., Guo, X., Zhao, M., Cai, R., Sun, G., 2014. Fluoride promotes osteoblastic differentiation through canonical wnt/-catenin signaling pathway. Toxicol. Lett. 225, 34–42. Priest, N.D., 2004. The biological behaviour and bioavailability of aluminium in man, with special reference to studies employing aluminium-26 as a tracer: review and study update. J. Environ. Montior. 6, 375–403. Prince, M., Banerjee, C., Javed, A., Green, J., Lian, J.B., Stein, G.S., Bodine, P.V., Komm, B.S., 2001. Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J. Cell Biochem. 80, 424–440. Qiang, Y.W., Barlogie, B., Rudikoff, S., Shaughnessy Jr., J.D., 2008. Dkk1-induced inhibition of Wnt signaling in osteoblast differentiation is an underlying mechanism of bone loss in multiple myeloma. Bone 42, 669–680. Quarles, L.D., 1990. Attenuated bone aluminum deposition in nonuremic beagles with reduced bone remodeling. Am. J. Physiol. 258, 576–581. Sato, M.M., Nakashima, A., Nashimoto, M., Yawaka, Y., Tamura, M., 2009. Bone morphogenetic protein-2 enhances Wnt/-catenin signaling-induced osteoprotegerin expression. Genes Cells 14, 141–153. Sedman, A.B., Alfrey, A.C., Miller, N., Goodman, W.G., 1987. Tissue and cellular basis for impaired bone formation in aluminum-related osteomalacia in the pig. J. Clin. Invest. 79, 86–92. Shin, H., Zygourakis, K., Farach-Carson, M.C., Yaszemski, M.J., Mikos, A.G., 2004. Modulation of differentiation and mineralization of marrow stromal cells cultured on biomimetic hydrogels modified with Arg–Gly–Asp containing peptides. J. Biomed. Mater. Res. 69, 535–543. Skalny, A.V., Skalnaya, M.G., Tinkov, A.A., Serebryansky, E.P., Demidov, V.A., Lobanova, Y.N., Grabeklis, A.R., Berezkina, E.S., Gryazeva, I.V., Skalny, A.A., Nikonorov, A.A., 2015. Reference values of hair toxic trace elements content in occupationally non-exposed Russian population. Environ. Toxicol. Pharmacol. 40, 18–21. Smith, R.W., 1996. Kinetic aspects of aqueous aluminum chemistry: environmental implications. Coord. Chem. Rev. 149, 81–93. Song, Y., Yang, J., Morita, Y., Song, G., 2013. Effect of the nanostructure of porous alumina on growth behavior of MG63 osteoblast-like cells. J. Biosci. Bioeng. 116, 509–515. Tian, Y., Xu, Y., Fu, Q., He, M., 2011. Parathyroid hormone regulates osteoblast differentiation in a Wnt/-catenin-dependent manner. Mol. Cell Biochem. 355, 211–216. Wang, Z., Guo, J., 2013. Mechanical induction of BMP-7 in osteocyte blocks glucocorticoid-induced apoptosis through PI3K/AKT/GSK3 pathway. Cell Biochem. Biophys. 67, 567–574. Weinbruch, S., Benker, N., Koch, W., Ebert, M., Drabløs, P.A., Skaugset, N.P., Ellingsen, D.G., Thomassen, Y., 2010. Hygroscopic properties of the workroom aerosol in aluminium smelter potrooms: a case for transport of HF and SO2 into the lower airways. J. Environ. Monit. 12, 448–454. Willhite, C.C., Karyakina, N.A., Yokel, R.A., Yenugadhati, N., Wisniewski, T.M., Arnold, I.M., Momoli, F., Krewski, D., 2014. Systematic review of potential health risks posed by pharmaceutical, occupational and consumer exposures to metallic and nanoscale aluminum, aluminum oxides, aluminum hydroxide and its soluble salts. Crit. Rev. Toxicil. 44, 1–80. Yokel, R.A., Mcnamara, P.J., 2001. Aluminium toxicokinetics: an updated minireview. Pharmacol. Toxicol. 88, 159–167. Zeng, L., Fagotto, F., Zhang, T., Hsu, W., Vasicek, T.J., Perry 3rd., W.L., Lee, J.J., Tilghman, S.M., Gumbiner, B.M., Costantini, F., 1997. The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Cell 90, 181–192.
Contents lists available at ScienceDirect
Environmental Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/etap
Aluminum trichloride inhibits osteoblastic differentiation through inactivation of Wnt/-catenin signaling pathway in rat osteoblasts Zheng Cao 1 , Yang Fu 1 , Xudong Sun, Qiuyue Zhang, Feibo Xu, Yanfei Li ∗ College of Veterinary Medicine, Northeast Agricultural University, NO. 59 Mucai Street, Xiangfang District, Harbin 150030, China
a r t i c l e
i n f o
Article history: Received 28 August 2015 Received in revised form 25 November 2015 Accepted 30 November 2015 Available online 8 December 2015 Keywords: Aluminum trichloride Osteoblastic differentiation Wnt/-catenin pathway Rat osteoblasts
a b s t r a c t Exposure to aluminum (Al) suppresses bone formation. Osteoblastic differentiation plays a key role in the process of bone formation. However, the effect of Al on osteoblastic differentiation is still controversial, and the mechanism remains unclear. To investigate the effect of Al on osteoblastic differentiation and whether Wnt signaling pathway was involved in it, the primary rat osteoblasts were exposed to 1/40 IC50, 1/20 IC50 and 1/10 IC50 of aluminum trichloride (AlCl3 ) for 24 h, respectively. The activity analysis of alkaline phosphate, qRT-PCR analysis of type I collagen, alkaline phosphate, Wnt3a and Dkk-1, Western blot analysis of p-GSK3, GSK3 and -catenin protein and Immunofluorescence staining for -catenin suggested that AlCl3 inhibited osteoblastic differentiation and Wnt/-catenin pathway. Moreover, we found exogenous Wnt3a application reversed the inhibitory effect of AlCl3 on osteoblastic differentiation, accompanied by activating the Wnt/-catenin pathway. Taken together, these findings suggest that AlCl3 inhibites osteoblastic differentiation through inactivation of Wnt/-catenin pathway in osteoblasts. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Aluminum (Al) is an accumulative toxic metal for human and can enter body via air, water and foods (Willhite et al., 2014). However, Al is used in various fields, such as water purifiers, food additives, pharmaceuticals, and vaccines; it is also present in ambient and occupational airborne particulatesal (Cao et al., 2010; Ohno et al., 2010; Weinbruch et al., 2010; Boullemant, 2011; Dabeka et al., 2011; Skalny et al., 2015). In addition, the growing prevalence of acid rain and bauxite mines exploitation can result in the discharge of larger amounts of Al salts from insoluble minerals, raising the risk of human contact with Al (Smith, 1996; Borgmann et al., 2007). In daily life, the Al of human absorbed from water and food are 0.005 g/kg/day and 0.08–0.5 g/kg/day. But Al absorbed from industrial air and dialysis solution can reach up to 0.6–8 g/kg/day and 9 g/kg/day(Yokel and Mcnamara, 2001). Although, only 0.05–2.2% of daily Al intake is absorbed, its elimination is slow and accumulated in deep compartment (e.g., bone) for years under continuous intake conditions(Priest, 2004; Ohno et al., 2010). Bone is the main target organ of Al accumulation, 58–70% of the total human Al body burden accumulates in bone (Ganrot, 1986;
∗ Corresponding author. Tel.: +86 13936574268; fax: +86 451 55191672. E-mail address: [email protected] (Y. Li). 1 Both authors are contributed equally to this study. http://dx.doi.org/10.1016/j.etap.2015.11.023 1382-6689/© 2015 Elsevier B.V. All rights reserved.
Krewski et al., 2007). Excessive Al accumulation causes toxic effects on bones, thereby induces osteodystrophy, osteomalacia and osteoporosis (Boyce et al., 1992; Jorgetti et al., 1994; Jeffery et al., 1996; Li et al., 2011). In dialyzed patients, as bone Al concentrations increased from 46 ± 7 to 175 ± 22 mg/kg (dry weight), the severity of Al-induced bone disease increased (Hodsman et al., 1982). Al-induced bone disease is characterized by suppressed bone formation (Malluche et al., 1987; Quarles, 1990; Kasai et al., 1991). Osteoblasts (OBs) are main functional cells for bone formation, which can be influenced by proliferation, differentiation, mineralization and apoptosis of OBs (Ducy et al., 2000). Previous studies showed that Al induced osteoblast apoptosis and inhibited proliferation and mineralization of osteoblast (Sedman et al., 1987; Blair et al., 1989; Bellows et al., 1995; Li et al., 2012; Cao et al., 2015). However, the effect of Al on the osteoblastic differentiation is controversial. Some research showed that Al inhibited the osteoblastic differentiation (Lieberherr et al., 1987; Lau et al., 1991), while others presented the opposite results (Karlsson et al., 2003; Song et al., 2013). Thus, it is necessary to clarify the effect of Al on osteoblastic differentiation. The Wnt/-catenin pathway is an important modulator of OBs function and bone formation (Glass and Karsenty, 2007; Deschaseaux et al., 2009; Baron and Kneissel, 2013). This pathway is triggered by binding Wnt glycoprotein family members (such as Wnt-1 and 3) to a co-receptor complex including Frizzled and low density receptor-like proteins 5 and 6 (Mao et al., 2001b). This is followed by phosphorylation (inactivation) of glycogen
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
synthase kinase (GSK3) to stabilize of -catenin. The -catenin then translocates into the nucleus, where it forms a complex with a T-cell factor to induce the transcription of osteoblastic genes (Bennett et al., 2005; Gaur et al., 2005; Sato et al., 2009). Many studies showed that the Wnt/-catenin pathway is involved in the osteoblastic differentiation (Chen et al., 2010; Guo et al., 2011; Park et al., 2011; Tian et al., 2011; López-Herradón et al., 2013; Pan et al., 2014). However, it remains unknown whether Wnt/-catenin pathway is involved in the effect of Al on osteoblastic differentiation. To examine the effect of AlCl3 on osteoblastic differentiation and whether Wnt/-catenin pathway was involved in it, the primary rat OBs were treated with AlCl3 . Then the effects of AlCl3 on the osteoblastic differentiation markers (ALP, CoL-Iand Runx2) and key components of Wnt/-catenin signaling were determined in OBs. We found AlCl3 suppressed osteoblastic differentiation and inactivated the Wnt/-catenin pathway. Moreover, we observed the inhibitory effect of AlCl3 on osteoblastic differentiation and Wnt/catenin pathway were both reversed by exogenous Wnt3a. Our results suggest AlCl3 inhibits osteoblastic differentiation through inactivation of Wnt/-catenin pathway in rat OBs. 2. Materials and methods 2.1. OBs culture and treatment The experimental designs and procedures were approved by the Animal Ethics Committee of the Northeast Agricultural University (Harbin, CHN). The primary OBs were derived from calvarium of 1-day-old Sprague–Dawley rats as previously described (Pan et al., 2014). The rat calvarium was cut into 1–2 mm2 pieces and consecutively digested using trypsin (2.5 g/L; Gibco, USA) for 10 min and collagenase II (1.0 g/L; Gibco, USA) for three sequential digestion periods of 15, 30 and 60 min at 37 ◦ C. The supernatant of 15 min and 30 min digestions were discarded, and cells obtained from the 60 min digestions were in presence of DMEM(Gibco, USA) supplemented with 10% FBS(Gibco, USA), 2 mM-glutamine (Gibco, USA), 1% penicillin/streptomycin (Gibco, USA) in a humidified 5% CO2 incubator at 37 ◦ C. The cells between 2th and 3th passage were harvested after reaching 90% confluence, and then were plated in medium supplemented using 50 g/mL ascorbic acid (Sigma, USA) and 10 mM -glycerophosphate (Sigma,USA) for 12 days, and the medium was changed every 2 days. The treatments of OBs were divided into two parts, one part was treated with 0 (control group, CG), 1/40 IC50 (Low-dose group, LG), 1/20 IC50 (Mid-dose group, MG) and 1/10 IC50 (High-dose group, HG) of AlCl3 (Aladdin, CHN), the other part was treated with AlCl3 (1/10 IC50), AlCl3 (1/10 IC50) +Wnt3a (100 ng/mL; PeproTech, USA) and without AlCl3 and Wnt3a (control group, CG) at 37 ◦ C in 5% CO2 for 24 h, respectively. Our previous work had demonstrated that the IC50 of AlCl3 on OBs was 8.16 mmol/L (Li et al., 2012). The final concentration of Wnt3a was 100 ng/mL, according to the previous research (Guo et al., 2011; Arioka et al., 2014).
199
2.3. qRT-PCR analysis OBs were harvested and rinsed twice using ice-cold PBS. The total RNA was extracted using Trizol Reagent (Invitrogen, USA), and was analyzed using spectrophotometry at 260 and 280 nm (Pharmacia Biotech, UK). Only samples with an optical density ratio at 260/280 nm > 1.8 were used for further analyses. Then each sample was reversely transcribed into cDNA using a reverse transcription kit (Trans Script First-Strand cDNA Synthesis Super Mix, Trans Gen Blotech, CHN). The primers of the genes are shown in Table 1. Gene expressions were examined using SYBR Green/Fluoresce in qPCR Master Mix via 7000 real-time PCR detection system (ABI, USA). 2.4. Western blot analysis The OBs were harvested in cell lysis buffer, and incubated for 15 min at 0 ◦ C. Then they were centrifuged for 5 min at 600 × g at 4 ◦ C, and the supernatant was used to detect the object protein. The protein concentration of the supernatant was determined by BCA assay (Beyotime, CHN). The protein was separated using polyacrylamide gels, electro-transferred onto PVDF membranes, and blocked with 5% non-fat milk in TBST buffer for 2 h. Then the membranes were incubated using anti-GSK3, anti-p-GSK3 and anti--catenin (Santa, USA) at dilutions of 1:400 in 5% non-fat milk overnight at 4 ◦ C, and washed three times using TBST, for 20 min each time. After that, the membranes were incubated using the secondary antibodies at dilutions of 1:4000 for 1 h at room temperature, and then washed three times using TBST. Finally, the object protein was detected using the enhanced chemiluminescent (ECL) reagent (Beyotime, CHN). To assess the presence of comparable amount of proteins in each lane, the membranes were stripped finally to detect the -actin. Quantitative analysis was carried out using Gel-Pro analyzer 4 image analysis system. 2.5. Immunofluorescence localization of ˇ-catenin The OBs growing on coverslips were exposed to AlCl3 for 24 h, and then rinsed using cold PBS twice, flexed using ice-cold methanol and permeabilized using 0.5% Triton X-100 for 15 min. After blocked with 0.5% bovine serum albumin for 1 h at room temperature, OBs were incubated using mouse monoclonal anti-catenin (1:200) overnight at 4 ◦ C followed by FITC-conjugated secondary antibody and DAPI. The fluorescence signal of -catenin was visualized using confocal fluorescence microscopy (Olympus, Japan). 2.6. Statistical analysis Data were presented as mean ± standard deviation (SD). The data were analyzed by one-way analysis of variance followed by Student’s t-test (SPSS 17.0 software; SPSS Inc., Chicago, IL, USA) and drawn histograms by Graphpad Prism 6.0. Values are means ± SD of at least three independent measurements in triplicate. Values of p < 0.05 (*or#) were considered statistically significant and values of p < 0.01 (**or##) were considered highly significant.
2.2. ALP activity 3. Results The intracellular ALP activity was quantitated using commercially available kits (Beyotime, CHN). OBs were rinsed twice using ice-cold PBS, followed by homogenization in alkaline lysis buffer. After centrifugation, the resulting cell homogenate was incubated with p-nitrophenyl phosphate at 37 ◦ C for 30 min. The results were normalized by the total intracellular protein content determined by the bicinchoninic acid (BCA) Protein Assay Kit (Beyotime, CHN) and expressed in nanomoles of produced p-nitrophenol per min per mg of protein (nmol/min/mg protein).
3.1. AlCl3 inhibited osteoblastic differentiation To investigate the effect of AlCl3 on osteoblastic differentiation, ALP activity, the ALP and COL-I mRNA levels were examined using commercially available kits and qRT-PCR. The ALP activity and the mRNA levels of ALP and COL-I were lower in AlCl3 -treated group than those in control group (Fig. 1). These results suggest that AlCl3 inhibits osteoblastic differentiation in OBs.
200
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
Table 1 Primer sequence and amplification length of destination fragment. Gene
Upstream and downstream primer sequence
Primer length (bp)
Product length (bp)
ALP
UP 5 ACCCTGCCTTACCAACTCATT3 LOW5 TCTCCAGCCGTGTCTCCTC3
21 19
233
COL-I
UP 5 AGCAGACGGGAGTTTCACCTC3 LOW 5 TGTCTTCTTGGCCATGCGTC3
21 21
193
Wnt-3a
UP 5 AGAGTCTCGTGGCTGGGTGGAC3 LOW5 GTTGGGCTCGCAGAAGTTAGG3
21 21
108
Dkk-1
UP 5 TTTCCCTAAGTGACCGACAG3 LOW 5 TGGGACCATTCTTCAGCA3
20 18
158
Runx-2
UP 5 GCACTATCCAGCCACCTTCA3 LOW 5 CTTCCATCAGCGTCAACACC3
20 20
321
-actin
UP 5 AGGGAAATCGTGCGTGACAT3 LOW 5 CCTCGGGGCATCGGAA3
20 16
163
translocation into nucleus. These results suggest that AlCl3 inhibits stabilization and nuclear translocation of -catenin protein in OBs. We then focused on Wnt3a and Dkk-1 which are antagonistically upstream regulator of Wnt/-catenin pathway and may be affected by AlCl3 . The mRNA expression of Wnt3a in AlCl3 -treated group was lower than that in control group, and the mRNA expression of Dkk-1, which was a powerful antagonist of Wnt/-catenin signaling, was higher than that in control group (Fig. 3). Collectively, these results suggest that AlCl3 inactivates the Wnt/-catenin pathway. 3.3. AlCl3 suppressed osteoblastic differentiation via Wnt/ˇ-catenin pathway
Fig. 1. AlCl3 suppressed osteoblastic differentiation. The ALP activity and the mRNA levels of ALP and COL-I were examined using commercially available kits and qRTPCR. *p < 0.05 or ** p < 0.01 vs. control value.
The aforementioned results suggested an association among AlCl3 , Wnt/-catenin pathway and osteoblastic differentiation, that is, AlCl3 might suppress osteoblastic differentiation through Wnt/-catenin pathway. To prove it, the OBs were exposed to AlCl3 (1/10 IC50 ) with and without exogenous Wnt3a (100 ng/ml) for 24 h. Our results showed the intracellular ALP activity, mRNA levels of ALP and COL-I in AlCl3 + Wnt3a group were higher than those in AlCl3 group(Fig. 4A). Additionally, ratio of p-GSK3/GSK3 and level of -catenin protein in AlCl3 + Wnt3a group were also higher than those in AlCl3 group (Fig. 4B). These results suggest that the inhibitory effect of AlCl3 on osteoblastic differentiation is reversed by exogenous Wnt3a application, accompanied by activating Wnt/-catenin pathway. We next examined the effect of Al on the mRNA level of Runx2 by qRT-PCR. Runx2 is a target gene of Wnt/-catenin pathway and a master transcription factor in controlling the osteoblast differentiation. The mRNA level of Runx2 in AlCl3 group was lower than that in control group, and in AlCl3 + Wnt3a group was more than that in AlCl3 group (Fig. 4C). These results indicated that AlCl3 decreased Runx2 mRNA expression, and Wnt3a reversed this decrease. Collectively, these results suggest that AlCl3 suppresses osteoblastic differentiation by inactivating the Wnt/-catenin pathway.
3.2. AlCl3 inactivated the Wnt/ˇ-catenin signaling pathway 4. Discussion To investigate the effect of AlCl3 on Wnt/-catenin pathway, the key components of Wnt/-catenin pathway were initially examined using Western blot, including the p-GSK3, GSK-3 and -catenin. The relative intensity of p-GSK3 is normalized by GSK3 protein levels. The ratio of p-GSK3/GSK3 and the levels of -catenin protein were lower in AlCl3 -treated group than those in control group (Fig. 2A). Subsequently, we examined the effect of AlCl3 on the nucleus translocation of -catenin, which is a critical step in controlling the Wnt/-catenin pathway, using immunofluorescence assay. As shown in Fig. 2B, AlCl3 decreased -catenin
In this study, several important observations were obtained. First, we found that AlCl3 decreased ALP activity and mRNA expressions of ALP, COL-I and Runx2. These results indicated that AlCl3 suppressed osteoblastic differentiation. Then, we found that AlCl3 could target key components of the Wnt/-catenin pathway and decrease -catenin stabilization and translocation, which indicated the inhibitory effect of AlCl3 on Wnt/-catenin pathway in OBs. Finally, exogenous Wnt3a application reversed the inhibitory effect of AlCl3 on osteoblastic differentiation, accompanied by
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
201
Fig. 2. AlCl3 reduced relative intensities of p-GSK3ˇ and ˇ-catenin and suppressed ˇ-catenin nuclear translocation. (A) The p-GSK3, GSK3 and -catenin protein expressions were assessed by Western blot (left panel). Relative intensities of p-GSK3 and -catenin, which were normalized with total GSK3 and -actin protein levels, and were indicated at the right panel. * p < 0.05 or ** p < 0.01 vs. control value. (B) The OBs were exposed to AlCl3 for 24 h., followed by the immunofluorescence for -catenin (green) using anti--catenin. The nuclei were stained with DAPI (blue). Arrows indicate nuclear localization. A representative result from the three independent experiments is shown. Scale bar, 50 m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 3. AlCl3 affects Wnt3a and Dkk1 gene expression. The mRNA levels of Wnt3a and Dkk1 was examined using qRT-PCR. ** p < 0.01 vs. control value.
activating the Wnt/-catenin pathway. All above results suggest that AlCl3 inhibites osteoblastic differentiation through inactivation of Wnt/-catenin signaling pathway in OBs. ALP and COL-I are produced by OBs at distinct phases of differentiation and regard as osteoblast differentiation markers (Bancroft
et al., 2002; Shin et al., 2004; Kim et al., 2005). In this study, we found that AlCl3 at concentrations of 0.204 mM, 0.408 mM and 0.816 mM decreased the activity of ALP and the gene expressions of ALP and COL-I. However, other research observed the opposite results. Karlsson et al and Song et al study shown the nano-porous alumina increased ALP activity in human osteosarcoma MG-63 cells and primary human OBs (Karlsson et al., 2003; Song et al., 2013). One possible cause is the species differences. Another possibility is that nano-porous alumina is slightly resolved in the medium of OBs. Only 41 M of Al released from the nano-porous alumina when immersed in medium of OBs for 9 days (Karlsson et al., 2003). Thus, the concentrations of Al3+ in MG-63 cells and human OBs were lower than that in our cultures. Previous studies indicated that the effect of Al3+ on osteoblastic differentiation depended on cell type and concentration of Al. In neonatal mouse OBs, the concentrations within the range of 10−8 to 10−6 M of AlCl3 increased ALP activity and CoL1 synthesis, and concentrations within the range of 10−6 to 10−5 M of AlCl3 decreased them (Lieberherr et al., 1987). In human osteosarcoma TE-85 cells, the aluminum sulfate whose concentration is lower than 50 M increased ALP activity, whose concentrations within the range of 50 to 200 M caused
202
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
Fig. 4. The effect of exogenous Wnt3a on osteoblastic differentiation marks and Wnt/ˇ-catenin pathway in AlCl3 -treated OBs. (A) The ALP activity and the mRNA levels of ALP and COL-I were examined using commercially available kits and qRT-PCR. (B) The p-GSK3, GSK3 and -catenin protein expressions were assessed by Western blotand, and were indicated at the right panel. (C) The gene level of Runx2 was measured by qRT-PCR. ** p < 0.01 vs. control value; ## p < 0.01 vs. AlCl3 value.
toxicity on these cells, and whose concentration is more than 200 M reduced the ALP activity to the undetectable level (Lau et al., 1991). These studies indicated that low concentration of AlCl3 stimulated osteoblastic differentiation and high concentration of AlCl3 suppressed it. Our previous study showed the same concentration of AlCl3 as it in this study induced oxidative injury of rat OBs (Li et al., 2012), which maybe a main reason for the inhibitory effect of AlCl3 on osteoblastic differentiation. Moreover, in dialyzed patients, excessive bone Al accumulation (46 ± 7–175 ± 22 mg/kg) induced low-turnover bone disease, which is characterized by the decrese of osteoblastic acrivity and number (Bushinsky, 1997; Hodsman et al., 1982). It also provides histological evidence for
inhibitory effect of high Al concentration on OBs, which is consistent with our results. Wnt3a is an important member of the Wnt protein family. This protein activates canonical Wnt/-catenin pathway, and its expression is associated with osteoblast differentiation (Bain et al., 2003; Cho et al., 2009). Decrease gene expression of Wnt3a is associated with inhibition of Wnt/-catenin pathway and osteoblastic differentiation (López-Herradón et al., 2013). Dkk1 is an upstream inhibitor of Wnt/-catenin pathway (Mao et al., 2001a). The increase of Dkk-1 inactivates Wnt/-catenin pathway and inhibits osteoblastic differentiation (Fujita and Janz, 2007; Qiang et al., 2008; Chen et al., 2010). In this experiment, the decrease of Wnt3a
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
mRNA and the increase of Dkk-1 mRNA indicate that AlCl3 inhibited the Wnt/-catenin pathway. Moreover, inaction of Wnt/-catenin pathway further increases the expression of Dkk-1 which is target gene of Wnt/-catenin pathway (Chamorro et al., 2005). Thus, the inhibitory effect of AlCl3 on Wnt/-catenin pathway may be induced by downregulated Wnt3a. The GSK3 phosphorylates -catenin, thereby induces degradation of -catenin (Zeng et al., 1997), and p-GSK3 increases cytoplasmic stabilization of -catenin. Previous studies showed decrease of p-GSK-3/GSK-3 induces degradation of -catenin and inaction of Wnt/-catenin pathway (Matsuzaki et al., 2006; Chen et al., 2010; López-Herradón et al., 2013). In this experiment, AlCl3 down-regulates p-GSK3/GSK3, and then promotes the degradation of -catenin in OBs. Furthermore, p-GSK3/GSK3 is regulated by multiple molecular mechanisms such as Wnt/catenin, PI3K/Akt and BMPs signaling pathway in OBs (Fukuda et al., 2010; Wang and Guo, 2013). Thus, our present data determines AlCl3 decrease p-GSK3/GSK3 in part by inactivating the Wnt/-catenin signaling pathway. In our future study, we will further check molecular mechanism of decrease of p-GSK3/GSK3 in Al-treated OBs. -catenin is the molecular node of the Wnt/-catenin pathway (Gordon and Nusse, 2006). -catenin expression and translocation is required for OBs to complete the differentiation process and synthesize properly formed bone (Day et al., 2005; Hill et al., 2005; Holmen et al., 2005; Hu et al., 2005). Decrease of expression and translocation of -catenin leads to diminish the expression of osteoblastic genes such as ALP, Col1 and Runx2 in OBs (Gaur et al., 2005; Sato et al., 2009; López-Herradón et al., 2013). In present study, our results show that the decreased gene expression of ALP, COL-Iand Runx2 are accredited to the decrease of -catenin protein expression and nuclear translocation in Al-treated primary rat OBs. Runx2, a transcription factor, regulates osteoblast-related genes (COL-I, ALP, osteocalcin) in OBs (Bialek et al., 2004; Komori, 2010; Prince et al., 2001). Several significant observations show that Runx2 is a direct target of the Wnt/-catenin pathway and plays an essential role in osteoblastic differentiation and bone formation (Gaur et al., 2005; Day et al., 2005). Our results demonstrate that AlCl3 decreases Runx2 gene expression, and it is reversed by exogenous Wnt3a application. Therefore, it can be concluded that AlCl3 decreases Runx2 gene expression through inactivation of Wnt/catenin signaling. 5. Conclusions In conclusion, our results indicate that AlCl3 inhibits osteoblastic differentiation through inactivation of Wnt/-catenin signaling pathway in OBs. Exogenous Wnt3a application targets this pathway and thereby counteracts inhibitory effect of AlCl3 on osteoblastic differentiation. Acknowledgements This work was supported by the following grant: Northeast Agricultural University Innovation Foundation for Postgraduate (yjscx14016), Natural Science Foundation of Heilongjiang Province (C201425) and National Natural Science Foundation of China (31372496). References Arioka, M., Takahashi-Yanaga, F., Sasaki, M., Yoshihara, T., Morimoto, S., Hirata, M., Mori, Y., Sasaguri, T., 2014. Acceleration of bone regeneration by local application of lithium: Wnt signal-mediated osteoblastogenesis and Wnt signal-independent suppression of osteoclastogenesis. Biochem. Pharmacol. 90, 397–405.
203
Bain, G., Muller, T., Wang, X., Papkoff, J., 2003. Activated beta-catenin induces osteoblast differentiation of C3H10T1/2 cells and participates in BMP2 mediated signal transduction. Biochem. Biophys. Res. Commun. 301, 84–91. Bancroft, G.N., Sikavitsas, V.I., van den Dolder, J., Sheffield, T.L., Ambrose, C.G., Jansen, J.A., Mikos, A.G., 2002. Fluid flow increases mineralized matrix deposition in 3D perfusion culture of marrow stromal osteoblasts in a dose-dependent manner. Proc. Natl. Acad. Sci. U.S.A. 99, 12600–12605. Baron, R., Kneissel, M., 2013. WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nat. Med. 19, 179–192. Bellows, C.G., Aubin, J.E., Heersche, J.N.M., 1995. Aluminum inhibits both initiation and progression of mineralization of osteoid nodules formed in differentiating rat calvaria cell cultures. J. Bone Miner. Res. 10, 2011–2016. Bennett, C.N., Longo, K.A., Wright, W.S., Suva, L.J., Lane, T.F., Hankenson, K.D., MacDougald, O.A., 2005. Regulation of osteoblastogenesis and bone mass by Wnt10b. Proc. Natl. Acad. Sci. U.S.A. 102, 3324–3329. Bialek, P., Kern, B., Yang, X., Schrock, M., Sosic, D., Hong, N., Wu, H., Yu, K., Ornitz, D.M., Olson, E.N., Justice, M.J., Karsenty, G., 2004. A twist code determines the onset of osteoblast differentiation. Dev. Cell 6, 423–435. Blair, H.C., Finch, J.L., Avioli, R., Crouch, E.C., Slatopolsky, E., Teitelbaum, S.L., 1989. Micromolar aluminum levels reduce 3H-thymidine incorporation by cell line UMR 106-01. Kidney Int. 35, 1119–1125. Borgmann, U., Couillard, Y., Grapentine, L.C., 2007. Relative contribution of food and water to 27 metals and metalloids accumulated by caged hyalella azteca in two rivers affected by metal mining. Environ. Pollut. 145, 753–765. Boullemant, A., 2011. PM2.5 emissions from aluminum smelters: coefcients and environmental impact. J. Air Waste Manage. Assoc. 61, 311–318. Boyce, B.F., Byars, J., Mcwilliams, S., Mocan, M.Z., Elder, H.Y., Boyle, I.T., Junor, B.J., 1992. Histological and electron microprobe studies of mineralisation in aluminium-related osteomalacia. J. Clin. Pathol. 45, 502–508. Bushinsky, D.A., 1997. Bone disease in moderate renal failure: cause, nature and prevention. Annu. Rev. Med. 48, 167–176. Cao, H., Qiao, L., Zhang, H., Chen, J., 2010. Exposure and risk assessment for aluminium and heavy metals in Puerh tea. Sci. Total Environ. 408, 2777–2784. Cao, Z., Liu, D., Zhang, Q., Sun, X., Li, Y., 2015. Aluminum chloride induces osteoblasts apoptosis via disrupting calcium homeostasis and activating Ca2+ /CaMKII signal pathway. Biol. Trace Elem. Res., http://dx.doi.org/10.1007/s12011-015-0417-1. Chamorro, M.N., Schwartz, D.R., Alin, V., Brivanlou, A.H., Cho, K.R., Varmus, H.E., 2005. FGF-20 and dkk1 are transcriptional targets of beta-catenin and FGF-20 is implicated in cancer and development. EMBO J. 24, 73–84. Chen, J.R., Lazarenko, O.P., Wu, X., Kang, J., Blackburn, M.L., Shankar, K., Badger, T.M., Ronis, M.J., 2010. Dietary-induced serum phenolic acids promote bone growth via p38 MAPK/-catenin canonical Wnt signaling. J. Bone Miner Res. 25, 2399–2411. Cho, S.W., Yang, J.Y., Sun, H.J., Jung, J.Y., Her, S.J., Cho, H.Y., Choi, H.J., Kim, S.W., Kim, S.Y., Shin, C.S., 2009. Wnt inhibitory factor (WIF)-1 inhibits osteoblastic differentiation in mouse embryonic mesenchymal cells. Bone 44, 1069–1077. Dabeka, R., Fouquet, A., Belisle, S., Turcotte, S., 2011. Lead, cadmium and aluminum in Canadian infant formulae, oral electrolytes and glucose solutions. Food Addit. Contam. A 28, 744–753. Day, T.F., Guo, X., Garrett-Beal, L., Yang, Y., 2005. Wnt/-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev. Cell 8, 739–750. Deschaseaux, F., Sensebe, L., Heymann, D., 2009. Mechanisms of bone repair and regeneration. Trends Mol. Med. 15, 417–429. Ducy, P., Schinke, T., Karsenty, G., 2000. The osteoblast: a sophisticated fibroblast under central surveillance. Science 289, 1501–1504. Fujita, K., Janz, S., 2007. Attenuation of wnt signaling by Dkk-1 and -2 regulates BMP2-induced osteoblast differentiation and expression of OPG, RANKL and MCSF. Mol. Cancer 6, 5158–5164. Fukuda, T., Kokabu, S., Ohte, S., Sasanuma, H., Kanomata, K., Yoneyama, K., Kato, H., Akita, M., Oda, H., Katagiri, T., 2010. Canonical Wnts and BMPs cooperatively induce osteoblastic differentiation through a GSK3-dependent and -cateninindependent mechanism. Differentiation 80, 46–52. Ganrot, P.O., 1986. Metabolism and possible health efects of aluminum. Environ. Health Persp. 65, 363–441. Gaur, T., Lengner, C.J., Hovhannisyan, H., Bhat, R.A., Bodine, P.V., Komm, B.S., Javed, A., van Wijnen, A.J., Stein, J.L., Stein, G.S., Lian, J.B., 2005. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J. Biol. Chem. 280, 33132–33140. Glass 2nd., D.A., Karsenty, G., 2007. In vivo analysis of Wnt signaling in bone. Endocrinology 148, 2630–2634. Gordon, M.D., Nusse, R., 2006. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J. Biol. Chem. 281, 22429–22433. Guo, A.J., Choi, R.C., Cheung, A.W., Chen, V.P., Xu, S.L., Dong, T.T., Chen, J.J., Tsim, K.W., 2011. Baicalin, a flavone, induces the differentiation of cultured osteoblasts: an action via the Wnt/-catenin signaling. J. Biol. Chem. 286, 27882–27893. Hill, T.P., Spater, D., Taketo, M.M., Birchmeier, W., Hartmann, C., 2005. Canonical Wnt/-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev. Cell 8, 727–738. Hodsman, A.B., Sherrard, D.J., Alfrey, A.C., Ott, S., Brickman, A.S., Miller, N.L., Maloney, N.A., Coburn, J.W., 1982. Bone aluminum and histomorphometric features of renal osteodystrophy. J. Clin. Endocr. Metab. 54, 539–546. Holmen, S.L., Zylstra, C.R., Mukherjee, A., Sigler, R.E., Faugere, M.C., Bouxsein, M.L., Deng, L., Clemens, T.L., Nilliams, B.O., 2005. Essential role of -catenin in postnatal bone acquisition. J. Biol. Chem. 280, 21162–21168.
204
Z. Cao et al. / Environmental Toxicology and Pharmacology 42 (2016) 198–204
Hu, H., Hilton, M.J., Tu, X., Yu, K., Ornitz, D.M., Long, F., 2005. Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 132, 49–60. Jeffery, E.H., Abreo, K., Burgess, E., Cannata, J., Greger, J.L., 1996. Systemic aluminum toxicity: effects on bone, hematopoietic tissue, and kidney. J. Toxicol. Environ. Health 48, 649–666. Jorgetti, V., Soeiro, N.M., Mendes, V., Pereira, R.C., Crivellari, M.E., Coutris, G., Borelli, A., Leite, M.O., Nussenzweig, I., Marcondes, M., 1994. Aluminium-related osteodystrophy and desferrioxamine treatment: role of phosphorus. Nephrol. Dial. Transplant. 9, 668–674. Karlsson, M., Pålsgård, E., Wilshaw, P.R., Di Silvio, L., 2003. Initial in vitro interaction of osteoblasts with nano-porous alumina. Biomaterials 24, 3039–3046. Kasai, K., Hori, M.T., Goodman, W.G., 1991. Transferrin enhances the antiproliferative effect of aluminum on osteoblast-like cells. Am. J. Physiol. 260, 537–543. Kim, H.J., Kim, S.H., Kim, M.S., Lee, E.J., Oh, H.G., Oh, W.M., Park, S.W., Kim, W.J., Lee, G.J., Choi, N.G., Koh, J.T., Dinh, D.B., Hardin, R.R., Johnson, K., Sylvia, V.L., Schmitz, J.P., Dean, D.D., 2005. Varying Ti–6Al–4V surface roughness induces different early morphologic and molecular responses in MG63 osteoblast-like cells. J. Biomed. Mater. Res. A 74, 366–373. Komori, T., 2010. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res. 339, 189–195. Krewski, D., Yokel, R.A., Nieboer, E., Borchelt, D., Cohen, J., Harry, J., Kacew, S., Lindsay, J., Mahfouz, A.M., Rondeau, V., 2007. Human health risk assessment for aluminium, aluminium oxide, and aluminium hydroxide. J. Toxicol. Environ. Health B: Crit. Rev. 10, 1–269. Lau, K.H., Yoo, A., Shu, P.W., 1991. Aluminum stimulates the proliferation and differentiation of osteoblasts in vitro by a mechanism that is different from fluoride. Mol. Cell Biochem. 105, 93–105. Li, X., Hu, C., Zhu, Y., Sun, H., Li, Y., Zhang, Z., 2011. Effects of aluminum exposure on bone mineral density, mineral, and trace elements in rats. Biol. Trace Elem. Res. 143, 378–385. Li, X., Han, Y., Guan, Y., Zhang, L., Bai, C., Li, Y., 2012. Aluminum induces osteoblast apoptosis through the oxidative stress-mediated JNK signaling pathway. Biol. Trace Elem. Res. 150, 502–508. Lieberherr, M., Grosse, B., Cournot-Witmer, G., Hermann-Erlee, M.P., Balsan, S., 1987. Aluminum action on mouse bone cell metabolism and response to PTH and 1,25(OH)2D3. Kidney Int. 31, 736–743. ˜ López-Herradón, A., Portal-Núnez, S., García-Martín, A., Lozano, D., Pérez-Martínez, ˜ V., Esbrit, P., 2013. Inhibition of the canonical wnt pathway by high F.C., Cena, glucose can be reversed by parathyroid hormone-related protein in osteoblastic cells. J. Cell Biochem. 114, 1908–1916. Malluche, H.H., Faugere, M.C., Friedler, R.M., Matthews, C., Fanti, P., 1987. Calcitriol, parathyroid hormone, and accumulation of aluminum in bone in dogs with renal failure. J. Clin. Invest. 79, 754–761. Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A., Nihrs, C., 2001a. LDLreceptor-related protein 6 is a receptor for Dickkopf proteins. Nature 411, 321–325. Mao, J., Wang, J., Liu, B., Pan, W., Farr 3rd., G.H., Flynn, C., Yuan, H., Takada, S., Kimelman, D., Li, L., Wu, D., 2001b. Low-density lipoprotein receptor-related protein-5 binds to Axin and regulates the canonical Wnt signaling pathway. Mol. Cell 7, 801–809. Matsuzaki, E., Takahashi-Yanaga, F., Miwa, Y., Hirata, M., Watanabe, Y., Sato, N., Morimoto, S., Hirofuji, T., Maeda, K., Sasaguri, T., 2006. Differentiationinducing factor-1 alters canonical Wnt signaling and suppresses alkaline phosphatase expression in osteoblast-like cell lines. J. Bone Miner. Res. 21, 1307–1316. Ohno, K., Ishikawa, K., Kurosawa, Y., Matsui, Y., Matsushita, T., Magara, Y., 2010. Exposure assessment of metal intakes from drinking water relative to those from total diet in Japan. Water Sci. Technol. 62, 2694–2701.
Park, K.H., Kang, J.W., Lee, E.M., Kim, J.S., Rhee, Y.H., Kim, M., Jeong, S.J., Park, Y.G., Kim, S.H., 2011. Melatonin promotes osteoblastic differentiation through the BMP/ERK/Wnt signaling pathways. J. Pineal. Res. 51, 187–194. Pan, L., Shi, X., Liu, S., Guo, X., Zhao, M., Cai, R., Sun, G., 2014. Fluoride promotes osteoblastic differentiation through canonical wnt/-catenin signaling pathway. Toxicol. Lett. 225, 34–42. Priest, N.D., 2004. The biological behaviour and bioavailability of aluminium in man, with special reference to studies employing aluminium-26 as a tracer: review and study update. J. Environ. Montior. 6, 375–403. Prince, M., Banerjee, C., Javed, A., Green, J., Lian, J.B., Stein, G.S., Bodine, P.V., Komm, B.S., 2001. Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J. Cell Biochem. 80, 424–440. Qiang, Y.W., Barlogie, B., Rudikoff, S., Shaughnessy Jr., J.D., 2008. Dkk1-induced inhibition of Wnt signaling in osteoblast differentiation is an underlying mechanism of bone loss in multiple myeloma. Bone 42, 669–680. Quarles, L.D., 1990. Attenuated bone aluminum deposition in nonuremic beagles with reduced bone remodeling. Am. J. Physiol. 258, 576–581. Sato, M.M., Nakashima, A., Nashimoto, M., Yawaka, Y., Tamura, M., 2009. Bone morphogenetic protein-2 enhances Wnt/-catenin signaling-induced osteoprotegerin expression. Genes Cells 14, 141–153. Sedman, A.B., Alfrey, A.C., Miller, N., Goodman, W.G., 1987. Tissue and cellular basis for impaired bone formation in aluminum-related osteomalacia in the pig. J. Clin. Invest. 79, 86–92. Shin, H., Zygourakis, K., Farach-Carson, M.C., Yaszemski, M.J., Mikos, A.G., 2004. Modulation of differentiation and mineralization of marrow stromal cells cultured on biomimetic hydrogels modified with Arg–Gly–Asp containing peptides. J. Biomed. Mater. Res. 69, 535–543. Skalny, A.V., Skalnaya, M.G., Tinkov, A.A., Serebryansky, E.P., Demidov, V.A., Lobanova, Y.N., Grabeklis, A.R., Berezkina, E.S., Gryazeva, I.V., Skalny, A.A., Nikonorov, A.A., 2015. Reference values of hair toxic trace elements content in occupationally non-exposed Russian population. Environ. Toxicol. Pharmacol. 40, 18–21. Smith, R.W., 1996. Kinetic aspects of aqueous aluminum chemistry: environmental implications. Coord. Chem. Rev. 149, 81–93. Song, Y., Yang, J., Morita, Y., Song, G., 2013. Effect of the nanostructure of porous alumina on growth behavior of MG63 osteoblast-like cells. J. Biosci. Bioeng. 116, 509–515. Tian, Y., Xu, Y., Fu, Q., He, M., 2011. Parathyroid hormone regulates osteoblast differentiation in a Wnt/-catenin-dependent manner. Mol. Cell Biochem. 355, 211–216. Wang, Z., Guo, J., 2013. Mechanical induction of BMP-7 in osteocyte blocks glucocorticoid-induced apoptosis through PI3K/AKT/GSK3 pathway. Cell Biochem. Biophys. 67, 567–574. Weinbruch, S., Benker, N., Koch, W., Ebert, M., Drabløs, P.A., Skaugset, N.P., Ellingsen, D.G., Thomassen, Y., 2010. Hygroscopic properties of the workroom aerosol in aluminium smelter potrooms: a case for transport of HF and SO2 into the lower airways. J. Environ. Monit. 12, 448–454. Willhite, C.C., Karyakina, N.A., Yokel, R.A., Yenugadhati, N., Wisniewski, T.M., Arnold, I.M., Momoli, F., Krewski, D., 2014. Systematic review of potential health risks posed by pharmaceutical, occupational and consumer exposures to metallic and nanoscale aluminum, aluminum oxides, aluminum hydroxide and its soluble salts. Crit. Rev. Toxicil. 44, 1–80. Yokel, R.A., Mcnamara, P.J., 2001. Aluminium toxicokinetics: an updated minireview. Pharmacol. Toxicol. 88, 159–167. Zeng, L., Fagotto, F., Zhang, T., Hsu, W., Vasicek, T.J., Perry 3rd., W.L., Lee, J.J., Tilghman, S.M., Gumbiner, B.M., Costantini, F., 1997. The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Cell 90, 181–192.
