[ 13]
~H NMR SPECTROSCOPYOF DNA
235
[13] 1H NMR Spectroscopy of DNA By JULI FEIGON, VLADIM[R SKLEN~, EDMOND WANG, DARA E. GILBERT, ROM,~.N F. MACAYA, and I~TER SCHULTZE Introduction Advances in N M R technology and instrumentation since the mid1980s have led to a revolution in the use of N M R spectroscopy for the determination of macromolecular structures. ~ Protein structures determined from data obtained by N M R methods are now accepted by both N M R spectroscopists and crystallographers. Application of these methods to the determination of nucleic acid structures has lagged somewhat behind the progress made for proteins. This is partially because nucleic acids, with only four different bases (usually) and generally linear structures for DNA, require somewhat different approaches from proteins in obtaining appropriate spectra, in assignment methodology, and in using the information derived from the N M R data to generate structures. The accuracy and utility of structures of DNA that can be obtained using N M R data are still a matter of investigation and debate, primarily owing to the lower proton density of nucleic acids relative to proteins and the difficulty in constraining the phosphodiester backbone from tH N M R data alone. This structure determination is the ultimate goal of N M R studies of nucleic acids. To achieve this goal, it is necessary first to obtain high quality N M R data to use for input into whatever approach is being used to generate the final structure. This chapter focuses primarily on the methods currently being used in our laboratory to obtain, process, assign, and analyze N M R spectra of DNA oligonucleotides. The utility of these studies for qualitative analysis of DNA structures will be discussed. A brief overview of current approaches to using the N M R data for three-dimensional (3-D) structure determination will be presented at the end. N M R spectroscopy of DNA oligonucleotides was largely made possible by the advent of convenient DNA synthesis methods at about the same time that two-dimensional (2-D) N M R was beginning to be applied to the study of proteins. Prior to that, most ~H N M R spectroscopy of nucleic acids was done on tRNA and synthetic RNA polymers. 2-4 Much of the K. Wiithrich, "NMR of Proteins and NucleicAcids." Wiley,New York, 1986. z D. R. Kearns and P. H. Bolton, in "BiomolecularStructure and Function," (P. F. Agris, R. N. Loeppky,and B. D. Sykes,eds.), p. 493. AcademicPress, New York, 1978. 3D. R. Kearns, Annu. Rev. Biophys. Bioeng. 6, 477 (1977). 4D. R. Kearns, Prog. Nucleic Acid Res. Mol. Biol. 18, 91 (1976). METHODS IN ENZYMOLOGY, VOL. 211
Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
236
SPECTROSCOPIC METHODS FOR ANALYSIS OF D N A
[ 13]
early work focused on observation of exchangeable imino resonances, and assignments were based largely on chemical shift and ring current shift arguments. The application of one-dimensional nuclear Overhauser effects (NOEs) was the first reliable assignment method for imino AH2 resonances. 5 Assignments of nonexchangeable resonances were still largely based on chemical shifts. The first two-dimensional spectra of doublestranded DNA were published in 1982. 6 It was apparent from these early spectra that they contained the information for making assignments of the nonexchangeable protons in right-handed B-DNA structures, 6 and sequential assignment strategies for B-DNA oligonudeotides were soon published. 7-9 Two-dimensional N M R techniques have since been applied to study a wide range of oligonucleotide structures (reviewed in Refs. 1 and 10-15), including B-DNA duplexes containing mismatches, bulges, and modified bases, d r u g - D N A complexes, and protein-DNA complexes. In addition, non-B-DNA structures, such as Z-DNA, triplexes, quadruplexes, dumbbells, hairpin loops, and Holliday junctions have also been characterized by NMR. Sample P r e p a r a t i o n
Synthesis and Purification DNA in the milligram quantities needed for ~H NMR spectroscopy can be conveniently synthesized on commercial DNA synthesizers. Because large quantities are needed and purity is a more important issue for NMR studies than for uses like cloning, it is necessary to ensure that the machine is working optimally and chemicals are fresh. We have found that one 10/lmol synthesis is adequate for about two N M R samples of DNA of 5 V. Sanchez, A. G. Redfield, P. D. Johnston, and J. Tropp, Proc. Natl. Acad. Sci. U.S.A. 77, 5659 (1980). 6 j. Feigon, J. M. Wright, W. A. Denny, W. Leupin, and D. R. Kearns, J. Am. Chem. Soc. 104, 5540 (1982). 7 j. Feigon, W. Leupin, W. A. Denny, and D. R. Kearns, Biochemistry 22, 5943 (1983). s R. M. Scheek, N. Russo, R. Boelens, and R. Kaptein, £ Am. Chem. Soc. 105, 2914 (1983). 9 D. R. Hare, D. E. Wemmer, S. H. Chou, G. Drobny, and B. R. Reid, £ Mol. Biol. 171, 319 (1983). to D. E. Wemmer and B. R. Reid, Annu. Rev. Phys. Chem. 36, 105 0985). it F. J. M. van de Ven and C. W. Hilbers, Fur. J. Biochem. 178, 1 (1988). 12 B. R. Reid, Q. Rev. Biophys. 20, 1 (1987). 13 D. J. Patel and L. Shapiro, Q. Rev. Biophys. 20, 35 (1987). 14 D. J. Patel, L. Shapiro, and D. Hare, Annu. Rev. Biophys. Biophys. Chem. 16, 423 (1987). 15 D. E. Gilbert and J. F. Feigon, Curt. Opin. Struct. Biol. 1, 439 (1991); D. E. Wemmer, Curt. Opin. Struct. Biol. 1, 452 (1991).
[13]
IH NMR SPECTROSCOPYOF DNA
237
length 16 bases or less. For longer DNA, we get better results by combining several 1 #tool syntheses. The most difficult part of obtaining DNA for NMR samples is purification. Many laboratories use high-performance liquid chromatography (HPLC) with adequate results. The method we have found to be overall most satisfactory, in terms of final purity, yield, and time, is to separate full-length sequences from failure sequences and other by-products of the synthesis on Sephadex gel filtration columns using only water as the eluant, following the method of Kintanar et aL ~ Typical column sizes are 2.4 cm wide and 110 cm long. Sephadex G-25 superfine is used for DNA oligonucleotides 12 bases or less, and Sephadex G-50 is used for more than 12 bases. The peak fractions are then assayed on DNA sequencing gels after kinasing with [~-32p]ATP in order to see which fractions contain only the desired DNA. Because the DNA comes off the column as a very broad peak, many fractions will contain some amount of full-length as well as failure sequences; because these are discarded (or, in some cases, repooled and rerun on the column) a fair amount of the total yield is wasted by this method. Nevertheless, we find that our overall yields of product of NMR quality are still higher than those we have obtained by HPLC, since we do not need to do any additional purification to remove protonated solvents, salts, etc. Once the fractions containing only full-length oligonucleotide are determined, they are pooled and lyophilized. The lyophilized DNA is dissolved in a small amount of water and pooled into a single Eppendorf tube, relyophilized, and stored frozen in the presence of a desiccant until ready for use. N M R Sample
Our typical NMR sample contains 2 - 4 m M in strand in 400/A buffer. Samples are generally prepared by dissolving the lyophilized powder in a small amount of H20 or D20 and removing the appropriate amount for the desired final DNA concentration to an Eppendorf tube. Alternatively, the desired amount of the lyophilized DNA may be weighed out. Salts and buffer solutions are added to the sample to the desired final concentration. Because a nonprotonated buffer is needed, phosphate has generally been the buffer of choice. However, this buffer can be a problem if divalent metal ions are also used or if one also wishes to acquire 3~p NMR spectra on the same sample. The best solution is frequently just to add the desired salts and adjust the pH of the sample to the desired pH without adding any buffer. 16 A. Kintanar, R. E. Klevit, and B. R. Reid, Nucleic Acids Res. 15, 5845 (1987).
238
SPECTROSCOPIC METHODSFOR ANALYSISOF DNA
[ 13]
In any case, the pH of the DNA sample should always be checked. We have found that dissolved DNA often has a very low pH (< 5). This may also lead to problems in dissolving the sample (owing to aggregation), which are relieved when the pH is adjusted toward neutrality. Even with added phosphate buffer the pH may remain low (or high); this has undoubtedly led to errors in the literature on sample pH and interpretation of the resulting spectra. Because the sample can be dried again, the change in volume from adjusting the pH does not matter. For spectra of the nonexchangeable protons, the sample is then lyophilized and redissolved in D20. This can be done once or twice, after which the sample is redissolved in D20 (99.98% or better) and transferred to an NMR tube which has been previously soaked in D20 and dried under a stream of N2t~ just before use. It is advisable to recheck the pH of the sample in the NMR tube with an NMR pH electrode. The sample can then be dried one more time in the NMR tube with a stream of filtered N2(~ by inserting a long syringe needle into the NMR tube just above the level of the solution. The sample is then redissolved in 99.996% D20. For spectra including the exchangeable protons, the DNA is dissolved in the appropriate solution with 90% H20/10% D20. If the DNA sample is not self-complementary, the two strands need to be mixed in the proper ratios. Approximate sample concentrations can be determined by absorbance at 260 nm or by weight. The duplex can be separated from any single strand by chromatography on a hydroxyapatite column, provided the DNA is long enough to be stable as a duplex at room temperature on the column. The fractions containing the duplex are pooled and concentrated by lyophilization. The excess salt can then be removed by dialysis against water or by chromatography on a Sephadex G-10 column. An alternative method to forming duplexes (or triplexes) from non-self complementary single strands is to titrate one strand into an NMR tube containing the other and monitoring the nonexchangeable resonances for duplex formation. The easiest resonances to monitor are usually the methyl resonances. Many laboratories use much higher concentrations of DNA than that suggested above. This may result in sample aggregation and increased solution viscosity, both of which will lead to wider linewidths. We have found that above about 3 mM strand for many of our samples the signalto-noise ratio (S/N) actually decreases due to line broadening. In addition, spin diffusion will become a problem in NOESY (nuclear Overhauser effect spectroscopy) experiments at shorter mixing times as the sample concentration is increased. Although with high sample concentrations it has been reported that mixing times of 40 msec and less must be used to
[ 13]
~H NMR SPECTROSCOPYOF DNA
239
stay in the linear range of NOE buildups, ~7 we have found that for a 12-base pair (bp) DNA oligonucleotide at 2 m M duplex sample concentration and 35* NOE buildup rates are linear out to at least 75 msec. TM Obtaining High Quality 1H N M R Spectra of DNA
One-Dimensional IH NMR Spectra Before beginning a lengthy two-dimensional NMR study of a DNA oligonucleotide, it is useful to obtain one-dimensional spectra in D20 and H20 at several temperatures in order to assess the thermal stability of the molecule under NMR conditions. Resonances in I)20 cover the range from about 9.5 to 0.5 ppm. Much of the early NMR work on nucleic acids monitored the melting of DNA by chemical shifts as a function of temperature? The one-dimensional spectra also allow a quick assessment of sample purity as well as the possible presence of more than one conformation. In general, both the imino and amino resonances of DNA exchange too fast to be observed in D20, and they must be observed in H20 solution? 9 For proteins, spectra in water are generally acquired with a presaturation pulse on the H20. This is not usually the method of choice for nucleic acids, since the amino and imino resonances will exchange with water during the presaturation pulse and therefore their intensity will usually be greatly diminished. For some molecules, enough resonance intensity remains that this may still be a useful technique for qualitative results in a 2-D experiment2°, or in a protein-DNA complex. In general, however, some sort of selective excitation which leaves the water unperturbed in the equilibrium position is used. These water suppression techniques have been recently reviewed.2~-2a The best method for water suppression appears to be instrument dependent, and new methods are still being proposed. In our laboratory, on our GN 500 MHz (GE NMR; Freemont, CA) 17B. R. Reid, K. Banks, P. Flynn, andW. Nerdal, Biochemistry28, 10001 (1989). ~s E. Wang and J. Feigon, unpublished results (1989). ~9D. R. Kearns, D. J. Patel, and R. G. Shulman, Nature (London) 229, 338 (1971). 2o p. Rajagopal, D. E. Gilbert, G. A. van der Marel, J. H. van Boom, and J. Feigon, J. Magn. Reson. 78, 526 (1988). 21 p. j. Hore, this series, Vol. 176, p. 64. 22 M. Gutron, P. Plateau, and M. Decorps, Prog. NMR Spectrosc. 23, 135 (1991). 23 V. Sklen~, in "NMR Applications in Biopolymers" (J. W. Finley, S. J. Schmidt, and A. S. Serianni, eds.), Vol. 56, p. 63. Plenum, New York, 1990.
240
S P E C T R O S C O P IMETHODS C FOR ANALYSIS OF D N A
[ 13]
spectrometer, we have found that consistently satisfactory results (even for nonexperienced operators) are obtained using the 1T spin echo pulse sequence proposed by Sklenfi~ and Bax. 24 This technique can tolerate relatively large inhomogeneities of both static magnetic and radiofrequency field and can easily be incorporated into various phase-sensitive 2-D N M R experiments. The pulse sequence 90,,-t-90.x-dl-90/-2t-90./-d2-Acqo[f= x,y,-x,-y; p=x,-x,x,-x; d i e d 2 - 3 0 - 5 0 g s e c ] gives an excitation profile proportional to sin 3 with the maxima at offsets + 1/[4(t + 2/3t9o)], where t9o is the length of the 90 ° pulse. There is no excitation at the carrier frequency, and spectra with very flat baselines can be obtained. The refocusing delay d2 in the I1 spin echo pulse sequence should be adjusted so that there is a near zero linear phase correction of the Fourier-transformed spectrum; this compensates for the signal delay on the filters which distorts the intensities of the first few points in the free induction decay (FID) resulting in baseline distortions. It is possible to obtain one-dimensional spectra in H20 with accurate intensities over almost the entire spectral range using the NEWS pulse sequence. 25 However, this pulse sequence will not work for two-dimensional N M R experiments, so its utility is limited. Obtaining Two-Dimensional Spectra in 1)20
Today, setting up various phase-sensitive two-dimensional N M R experiments in D20 is fairly routine. The most valuable data for DNA samples are obtained from NOESY, 26 ROESY, 27 TOCSY, 2sa9 P.(E).COSY, a°,31 2Q, 32 and H O E N O E 33 experiments. A flat baseline in both frequency dimensions is a basic precondition for reliable analysis of phase-sensitive two-dimensional N M R spectra. This requires both optimization of the acquisition parameters, discussed here, and the processing parameters, discussed below. In the f2 domain the appropriate choice of audiofrequency filters and of the preacquisition delay are important. For instruments where there is a choice between Bessel and Butterworth filters, 24V. Sldel~ and A. Bax, J. Magn. Reson. 74, 469 (1987). 25L. Pfi~ek,E. Wang, J. Feigon, Z. Star~uk, and V. Slden~, J. Magn. Resort. 91, 120 (1991). 26A. Kumar, R. R. Ernst, and K. Wiithrich,Biochem. Biophys. Res. Commun. 95, 1 (1980). 27A. A. Bothner-By,R. L. Stephens, J. Lee, C. D. Warren, and R. W. Jeanloz,J. Am. Chem. Soc. 106, 811 (1984). 2s A. Bax and D. G. Davis,J. Magn. Res. 65, 355 (1985). 29L. Brannschweilerand R. R. Ernst, J. Magn. Resort. 53, 521 (1983). 30D. Marion and A. Bax, J. Magn. Resort. 80, 528 (1988). 31L. MueUer,J. Magn. Reson. 72, 191 0987). 32L. Braunschweiler,G. Bodenhausen,and R. R. Ernst, MoL Phys. 48, 535 (1983). 33V. Sklen~ and J. Feigon,J. Am. Chem. Soc. 112, 5644 (1990).
[ 13]
1H NMR SPECTROSCOPYOF DNA
241
the Bessel filter usually gives a flatter baseline with only a small decrease in signal-to-noise ratio. For magnitude experiments or spectra processed with an unshifted sine-bell or similar function, the Butterworth filter is acceptable. For spectrometers where a fiat baseline cannot be obtained with these methods, application of a refocusing pulse at the end of the pulse sequence is useful. ~ The preacquisition delay which separates the last pulse in the pulse sequence and the start of the data acquisition should be carefully adjusted until the best baseline is obtained; the optimum situation gives a one-dimensional spectrum for which the first-order phase correction is near zero. In the f~ dimension, different procedures must be applied for spectra obtained with TPPI or hypercomplex Fourier transform acquisition schemes. As has been recently shown by Bax and co-workers,35 the following approach gives a fiat baseline in f~ for data acquired with the hypercomplex method. The first t~ increment is set to [DWJ2 - k(2/n)tgo], where DW~ is the dwell time in the t~ dimension, tgo is the length of the 90 ° pulse, and k - - 2 for NOESY and k = 1 for TOCSY experiments. No scaling factor is applied to the first points of the t~ FIDs, and the spectra in thef~ domain are phase corrected with a linear phase correction of 180 °. The most effective method for tracing out single-step J connectivities and for measuring J coupling constants in the DNA sugar residues is the P.COSY experiment, a° If a mixing pulse of 90 ° is applied, the cross-peak patterns are essentially the same as those obtained with DQF-COSY 3~ but can be obtained in one-fourth the time. A mixing pulse of 45 ° or less results in E.COSY 36 type spectra from which the J coupling constants for H I ' - H 2 ' , H I ' - H 2 " , and H 2 ' - H 2 " can be directly measured. 37 The artificial generation of the dispersive diagonal which is subsequently subtracted from the phase-sensitive COSY spectrum reduces the experimental time to one-quarter for the P.COSY alternative to DQF-COSY and to one-sixth for the P.E.COSY alternative to E.COSY experiments. Sixteen scans are required to fulfill the coherence transfer selection and CYCLOPS 3s phase cycles per tx complex point. If measuring time is a limiting factor, the experimental protocols for many of these experiments can be optimized to obtain the highest quality spectra in the shortest possible time. If the rf channels are well balanced, the CYCLOPS phase cycling can be omitted in TOCSY, HOENOE, and 34 D. G. Davis, J. Magn. Reson. 81,603 (1989). 35 A. Bax, M. Ikura, L. E. Kay, and G. Zhu, J. Magn. Reson. 91, 174 (1991). 36 C. Griesinger, O. W. Sorensen, and R. R. Ernst, J. Am. Chem. Soc. 107, 6394 0985). 37 A. Bax and L. Lerner, J. Magn. Reson. 79, 429 (1988). 3s D. I. Hoult and R. E. Richards, Proc. R. Soc. London, A 344, 311 (1975).
242
SPECTROSCOPIC METHODS FOR ANALYSIS OF D N A
[13]
NOESY experiments. Axial peaks and single-quantum coherence can be suppressed in NOESY spectra by applying a short homospoil pulse during the mixing period. Two to four dummy scans are usually used at the beginning of each tl increment to establish a dynamic equilibrium in the spin system; these can usually be eliminated if a "pulse equilibrium cascade" is applied at the beginning of the pulse sequence. This is done by putting two short spin-lock pulses (2-3 msec) applied in perpendicular directions followed by a short homospoil pulse (3-5 msec) at the beginning of the relaxation delay. As a result, the spin system is completely incoherent at the beginning of the relaxation interval, and the artifacts resulting from different magnetization magnitudes at the beginning of the tl- preparation period are effectively suppressed. With these schemes, good TOCSY and NOESY spectra on 2 - 3 mM DNA samples can be obtained with only four and eight scans per t~ complex point, respectively. A 256 × 1024 complex data matrix can be obtained in less than one hour. This approach is especially useful for quickly checking a new sample and is essential if three-dimensional spectra are to be obtained. For spectra with a high signal-to-noise ratio, the full phase cycle and acquisition times up to 12-24 hr are recommended.
Obtaining Two-Dimensional Spectra in 1-120 NMR studies of the exchangeable resonances of DNA have been largely limited until recently to one-dimensional spectra and assignments of the imino resonances only via one-dimensional NOEs. 5 The imino and amino resonances are very important indicators of the hydrogen bonding of the bases and provide some of the few cross-strand connectivities, and they are therefore very important for structure determination. Most of these resonances can be readily assigned from two-dimensional NOESY spectra taken in water,2°,39,4° and the NOESY experiment is the most informative two-dimensional experiment for DNA samples in H20. Most studies on DNA conformation have been done at neutral pH. However, the exchange rate of the imino resonances decreases with lower pH, so it is useful to obtain spectra in H20 at somewhat lower pH ( - 6 ) in order to see crosspeaks to something other than H20. Some DNA sequences have pH-dependent structural transitions, however, so it is important to determine if this is the case before changing the pH. Running at low temperature will also help, although in general the peaks are broader and poorer water suppression is obtained at low temperature. 39 R. Boelens, R. M. Scheek, K. Dijkstra, and R. Kaptein, J. Magn. Reson. 63, 378 (1985). 4o V. Sklen~ and J. Feigon, Nature (London) 345, 836 (1990).
[13]
~H NMR SPECTROSCOPYOF DNA
243
Obtaining good spectra of DNA in water depends both on using optimal acquisition conditions and on processing data appropriately. Data processing will be discussed in the next subsection. The most important factors in terms of acquisition are proper shimming to decrease the water "hump" and appropriate adjustment of parameters so that a fiat baseline is obtained with minimum first-order baseline correction. The standard pulse sequences are used except that the nonselective read pulse is replaced by a selective pulse sequence. The selective read pulse can be the 1-[ spin echo, 24 jump and return, 41 or other pure selective excitation sequence. This gives a spectrum with accurate intensities along f~, so that with proper processing most of the cross-peaks can be seen at least on one side of the diagonal. The water magnetization which survives in the transverse plane during the mixing period must be destroyed by application of a homospoil pulse. Problems with radiation damping which may occur in scans when the water magnetization is aligned along the - z axis at the beginning of an acquisition can be solved by modifying the phase cycle42 or by detuning of the probe. In our experience, slight detuning which lowers the sensitivity by only about 5-10% is usually sufficient to prevent receiver overload during the acquisition. In certain cases, NOESY spectra of DNA in H20 can be obtained using a selective saturation pulse on water during the recycle delay and mixing time, 2° as is done for proteins, which can be useful for assignment purposes but not for quantitation. The exchangeable resonance intensity will be decreased, and the intensity of observable exchangeable resonances and their cross-peaks will depend on their exchange rate with water. In general, this method results in loss of all of the resonance intensity of the G amino and terminal exchangeable resonances.
Processing Two-Dimensional NMR Spectra Processing two-dimensional spectra of DNA in DzO is essentially like processing spectra of proteins. Sources of and approaches to eliminating various artifacts in t~ and t2 have been discussed elsewhere. 1,43 Optimal apodization functions to apply will depend on the type of experiment, the application (i.e., assignments versus quantitation), and the sample. In general, spectra are processed several different ways until the best results are obtained. In some cases, it is beneficial to baseline correct the spectrum in f2 and/or f~, usually with a first-order or first- or second-order polynomial fit, respectively. 41 p. Plateau and M. Gurron, J. Am. Chem. Soc. 104, 7310 (1982). 42 p. R. Blake and M. F. Summers, J. Magn. Resort. 86, 622 (1990). 43 G. Otting, H. Widmer, G. Wagner, and K. Wiithrich, J. Magn. Reson. 66, 187 (1986).
244
SPECTROSCOPIC METHODS FOR ANALYSIS OF D N A
[ 13]
A bib
E n.
1
i
ppm D
B
i.
:
?
f i
o
~1 i
O
;': t! ' ,s:'"
ii
ft.
iii O
,j'~
"' '.L. ."
,,*,
'
.
;i-
:,.~
,.. O
15'.0
12'.0
8~o
41o
ppm FIG. 1. Comparison of 500 MHz ~H NMR NOESY spectrum in H20 of the DNA oligonucleotide d(AGATAGAACCCCTTCTATCTTATATCTGTCTT) processed (A) without time domain convolution difference (smooth) and without polynomial baseline correction and (B) smoothed with a Gaussian window (_+32 points) in t2 and basdine corrected with a sixth-order polynomial in f2 and a second-order polynomial in f~. The NMR sample was 400/zl of 2.3 m M DNA oligonuclcotide in 100 m M NaCI, 5 m M MgC12, pH 5.5• The standard NOESY pulse sequenc~ 6 was used, except the read pulse was replaced with a IT spin echo observe pulse.24 Acquisition parameters were Zm = 150 msec, with a 5 msec homospoil
[ 13]
IH NMR SPECTROSCOPYOF DNA
245
The visual presentation of NOESY spectra in H20 can be improved by various postacquisition data processing methods which further reduce the residual water signal? 4-4~ The effect of the time domain convolution difference routine44 and baseline correction on a NOESY spectrum of a 32-base DNA oligonucleotide which folds to form an intramolecular triplex is shown in Fig. 1. As can be seen, this processing not only substantially improves the appearance of the spectrum, but also enhances the information content of the spectrum. This will be the case whenever the dispersive residual water impairs the baseline along the f2 dimension. Assignment Strategies
B-DNA Assignments Assignment strategies for the nonexchangeable proton resonances of B (or A) DNA are straightforward and have been well documented in the literature. 1,7-9,12,47-52 The base pairs and the deoxyribose sugar are shown in Fig. 2 with the numbering system used. Examination of the B-DNA helix reveals that there should be a series of sequential connectivities (i.e., short interproton distances which will give rise to NOEs) from base H8 or H6 to sugar HI', H2', H2" to base and so on in the 5 ' - Y direction along each strand of the helix. These sequential connectivities are illustrated schematically in Fig. 3A. Connectivities between protons in a given sugar can be obtained from correlated spectra (COSY, TOCSY, 2Q, etc). Be44 D. Marion, M. Ikura, and A. Bax, J. Mag. Res. 84, 425 (1989). 45 y. Kuroda, A. Wada, T. Yamazaki, and K. Nagayama, J. Magn. Resort. 84, 604 (1989). 46 p. Tsang, P. Wright, and M. Rance, J. Magn. Resort. 88, 210 (1990). 47 M. S. Broido, Biochem. Biophys. Res. Commun. 119, 663 (1984). 4s M. A. Weiss, D. J. Patel, R. T. Sauer, and M. Karplus, Proc. Natl. Acad. Sci. U.S.A. 81, 130 (1984). 49 R. M. Scheek, R. Boelens, N. Russo, J. H. van Boom, and R. Kaptein, Biochemistry 23, 1371 (1984). so C. A. G. Haasnoot, H. P. Westerink, G. A. van der Marel, and J. H. van Boom, J. Biomol. Stereodyn. 1, 131 (1983). 5~ W. J. Chazin, K. Wiithrich, M. Rance, S. Hyberts, W. A. Denny, and W. Leupin, J. Mol. Biol. 109, 439 (1986). 52 R. Grtitter, G. Otting, K. Wiithrich, and W. Leupin, Fur. Biophys. J. 16, 279 (1988).
at the beginning; 2 sec recycle delay, 11364 Hz spectral width in both dimensions (88/tsec dwell); acquisition time 180.224 msec; 2048 complex points in t2; 445 t~ increments collected; z for the 1T echo pulse = 56/tsec; 32 scans per h with two dummy scans. The spectra were processed with 2048 complex points in both dimensions and apodized with a shifted sine-bell squared function of 65 ° and 600 points in t2 and 75 ° and 445 points in h-
246
SPECTROSCOPIC METHODSFOR ANALYSISOF DNA
[ 13]
H
\
? - . .....% -'N9~04 / \
N ..... H~N3 \ /~ /C6~H N3"--C~,H o//C2--N~
A
T
H55. ' H ~~" /Y ,,/& n3' ~ / H
~Nr
c8
/
I N
O.... H
",.%--C6!/
if' o-o~
\
G
N
H
" N - . .....o//
\
"
IXHz
H2"
\ffc4-cs - -/
\k
/
~,.
H
.~,--H..... ~i/
N3"--C/2
ase
/oo-. .
.C2~N1 C
FIG. 2. Watson-Crick A.T and G'C base pairs and the deoxyribosesugar with numbering systems. cause the assignment procedures have already been well described elsewhere, in this section we simply point out some details which may be useful. B-DNA, with all anti glycosidic torsion angles, gives a pattern of strong H 6 , H 8 - H2',H2" cross-peaks and weaker H 6 , H 8 - H 1' cross-peaks which are used to make sequential assignments. Although the shortest intra- and internucleotide base-sugar connectivities are H 6 , H 8 - H 2 ' and H 6 , H 8 H2", respectively, it is usually easiest to make sequential assignments via the H 6 , H 8 - H I ' cross-peaks. The more complicated H 6 , H 8 - H 2 ' , H 2 " cross-peak region can be used to confirm these assignments and to resolve ambiguities. Although some of the intensity in the b a s e - H I ' cross-peak region arises from spin diffusion via the H2',H2" protons, this is not a
[13]
A
1H NMR SPECTROSCOPYOF DNA
5'
B
247
5'
FIG. 3. (A) Schematic of one strand ofa B-DNAduplex with the sequence d(ATA). Some of the sequential connectivities which should give rise to NOEs between purine H8 or pyfimidine H6 and the sugar protons are indicated. Although only the shortest intra- and interuucleotide base-sugar connectivities are indicated, each base H8 or H6 proton is within NOE distance (
~H NMR SPECTROSCOPYOF DNA
235
[13] 1H NMR Spectroscopy of DNA By JULI FEIGON, VLADIM[R SKLEN~, EDMOND WANG, DARA E. GILBERT, ROM,~.N F. MACAYA, and I~TER SCHULTZE Introduction Advances in N M R technology and instrumentation since the mid1980s have led to a revolution in the use of N M R spectroscopy for the determination of macromolecular structures. ~ Protein structures determined from data obtained by N M R methods are now accepted by both N M R spectroscopists and crystallographers. Application of these methods to the determination of nucleic acid structures has lagged somewhat behind the progress made for proteins. This is partially because nucleic acids, with only four different bases (usually) and generally linear structures for DNA, require somewhat different approaches from proteins in obtaining appropriate spectra, in assignment methodology, and in using the information derived from the N M R data to generate structures. The accuracy and utility of structures of DNA that can be obtained using N M R data are still a matter of investigation and debate, primarily owing to the lower proton density of nucleic acids relative to proteins and the difficulty in constraining the phosphodiester backbone from tH N M R data alone. This structure determination is the ultimate goal of N M R studies of nucleic acids. To achieve this goal, it is necessary first to obtain high quality N M R data to use for input into whatever approach is being used to generate the final structure. This chapter focuses primarily on the methods currently being used in our laboratory to obtain, process, assign, and analyze N M R spectra of DNA oligonucleotides. The utility of these studies for qualitative analysis of DNA structures will be discussed. A brief overview of current approaches to using the N M R data for three-dimensional (3-D) structure determination will be presented at the end. N M R spectroscopy of DNA oligonucleotides was largely made possible by the advent of convenient DNA synthesis methods at about the same time that two-dimensional (2-D) N M R was beginning to be applied to the study of proteins. Prior to that, most ~H N M R spectroscopy of nucleic acids was done on tRNA and synthetic RNA polymers. 2-4 Much of the K. Wiithrich, "NMR of Proteins and NucleicAcids." Wiley,New York, 1986. z D. R. Kearns and P. H. Bolton, in "BiomolecularStructure and Function," (P. F. Agris, R. N. Loeppky,and B. D. Sykes,eds.), p. 493. AcademicPress, New York, 1978. 3D. R. Kearns, Annu. Rev. Biophys. Bioeng. 6, 477 (1977). 4D. R. Kearns, Prog. Nucleic Acid Res. Mol. Biol. 18, 91 (1976). METHODS IN ENZYMOLOGY, VOL. 211
Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
236
SPECTROSCOPIC METHODS FOR ANALYSIS OF D N A
[ 13]
early work focused on observation of exchangeable imino resonances, and assignments were based largely on chemical shift and ring current shift arguments. The application of one-dimensional nuclear Overhauser effects (NOEs) was the first reliable assignment method for imino AH2 resonances. 5 Assignments of nonexchangeable resonances were still largely based on chemical shifts. The first two-dimensional spectra of doublestranded DNA were published in 1982. 6 It was apparent from these early spectra that they contained the information for making assignments of the nonexchangeable protons in right-handed B-DNA structures, 6 and sequential assignment strategies for B-DNA oligonudeotides were soon published. 7-9 Two-dimensional N M R techniques have since been applied to study a wide range of oligonucleotide structures (reviewed in Refs. 1 and 10-15), including B-DNA duplexes containing mismatches, bulges, and modified bases, d r u g - D N A complexes, and protein-DNA complexes. In addition, non-B-DNA structures, such as Z-DNA, triplexes, quadruplexes, dumbbells, hairpin loops, and Holliday junctions have also been characterized by NMR. Sample P r e p a r a t i o n
Synthesis and Purification DNA in the milligram quantities needed for ~H NMR spectroscopy can be conveniently synthesized on commercial DNA synthesizers. Because large quantities are needed and purity is a more important issue for NMR studies than for uses like cloning, it is necessary to ensure that the machine is working optimally and chemicals are fresh. We have found that one 10/lmol synthesis is adequate for about two N M R samples of DNA of 5 V. Sanchez, A. G. Redfield, P. D. Johnston, and J. Tropp, Proc. Natl. Acad. Sci. U.S.A. 77, 5659 (1980). 6 j. Feigon, J. M. Wright, W. A. Denny, W. Leupin, and D. R. Kearns, J. Am. Chem. Soc. 104, 5540 (1982). 7 j. Feigon, W. Leupin, W. A. Denny, and D. R. Kearns, Biochemistry 22, 5943 (1983). s R. M. Scheek, N. Russo, R. Boelens, and R. Kaptein, £ Am. Chem. Soc. 105, 2914 (1983). 9 D. R. Hare, D. E. Wemmer, S. H. Chou, G. Drobny, and B. R. Reid, £ Mol. Biol. 171, 319 (1983). to D. E. Wemmer and B. R. Reid, Annu. Rev. Phys. Chem. 36, 105 0985). it F. J. M. van de Ven and C. W. Hilbers, Fur. J. Biochem. 178, 1 (1988). 12 B. R. Reid, Q. Rev. Biophys. 20, 1 (1987). 13 D. J. Patel and L. Shapiro, Q. Rev. Biophys. 20, 35 (1987). 14 D. J. Patel, L. Shapiro, and D. Hare, Annu. Rev. Biophys. Biophys. Chem. 16, 423 (1987). 15 D. E. Gilbert and J. F. Feigon, Curt. Opin. Struct. Biol. 1, 439 (1991); D. E. Wemmer, Curt. Opin. Struct. Biol. 1, 452 (1991).
[13]
IH NMR SPECTROSCOPYOF DNA
237
length 16 bases or less. For longer DNA, we get better results by combining several 1 #tool syntheses. The most difficult part of obtaining DNA for NMR samples is purification. Many laboratories use high-performance liquid chromatography (HPLC) with adequate results. The method we have found to be overall most satisfactory, in terms of final purity, yield, and time, is to separate full-length sequences from failure sequences and other by-products of the synthesis on Sephadex gel filtration columns using only water as the eluant, following the method of Kintanar et aL ~ Typical column sizes are 2.4 cm wide and 110 cm long. Sephadex G-25 superfine is used for DNA oligonucleotides 12 bases or less, and Sephadex G-50 is used for more than 12 bases. The peak fractions are then assayed on DNA sequencing gels after kinasing with [~-32p]ATP in order to see which fractions contain only the desired DNA. Because the DNA comes off the column as a very broad peak, many fractions will contain some amount of full-length as well as failure sequences; because these are discarded (or, in some cases, repooled and rerun on the column) a fair amount of the total yield is wasted by this method. Nevertheless, we find that our overall yields of product of NMR quality are still higher than those we have obtained by HPLC, since we do not need to do any additional purification to remove protonated solvents, salts, etc. Once the fractions containing only full-length oligonucleotide are determined, they are pooled and lyophilized. The lyophilized DNA is dissolved in a small amount of water and pooled into a single Eppendorf tube, relyophilized, and stored frozen in the presence of a desiccant until ready for use. N M R Sample
Our typical NMR sample contains 2 - 4 m M in strand in 400/A buffer. Samples are generally prepared by dissolving the lyophilized powder in a small amount of H20 or D20 and removing the appropriate amount for the desired final DNA concentration to an Eppendorf tube. Alternatively, the desired amount of the lyophilized DNA may be weighed out. Salts and buffer solutions are added to the sample to the desired final concentration. Because a nonprotonated buffer is needed, phosphate has generally been the buffer of choice. However, this buffer can be a problem if divalent metal ions are also used or if one also wishes to acquire 3~p NMR spectra on the same sample. The best solution is frequently just to add the desired salts and adjust the pH of the sample to the desired pH without adding any buffer. 16 A. Kintanar, R. E. Klevit, and B. R. Reid, Nucleic Acids Res. 15, 5845 (1987).
238
SPECTROSCOPIC METHODSFOR ANALYSISOF DNA
[ 13]
In any case, the pH of the DNA sample should always be checked. We have found that dissolved DNA often has a very low pH (< 5). This may also lead to problems in dissolving the sample (owing to aggregation), which are relieved when the pH is adjusted toward neutrality. Even with added phosphate buffer the pH may remain low (or high); this has undoubtedly led to errors in the literature on sample pH and interpretation of the resulting spectra. Because the sample can be dried again, the change in volume from adjusting the pH does not matter. For spectra of the nonexchangeable protons, the sample is then lyophilized and redissolved in D20. This can be done once or twice, after which the sample is redissolved in D20 (99.98% or better) and transferred to an NMR tube which has been previously soaked in D20 and dried under a stream of N2t~ just before use. It is advisable to recheck the pH of the sample in the NMR tube with an NMR pH electrode. The sample can then be dried one more time in the NMR tube with a stream of filtered N2(~ by inserting a long syringe needle into the NMR tube just above the level of the solution. The sample is then redissolved in 99.996% D20. For spectra including the exchangeable protons, the DNA is dissolved in the appropriate solution with 90% H20/10% D20. If the DNA sample is not self-complementary, the two strands need to be mixed in the proper ratios. Approximate sample concentrations can be determined by absorbance at 260 nm or by weight. The duplex can be separated from any single strand by chromatography on a hydroxyapatite column, provided the DNA is long enough to be stable as a duplex at room temperature on the column. The fractions containing the duplex are pooled and concentrated by lyophilization. The excess salt can then be removed by dialysis against water or by chromatography on a Sephadex G-10 column. An alternative method to forming duplexes (or triplexes) from non-self complementary single strands is to titrate one strand into an NMR tube containing the other and monitoring the nonexchangeable resonances for duplex formation. The easiest resonances to monitor are usually the methyl resonances. Many laboratories use much higher concentrations of DNA than that suggested above. This may result in sample aggregation and increased solution viscosity, both of which will lead to wider linewidths. We have found that above about 3 mM strand for many of our samples the signalto-noise ratio (S/N) actually decreases due to line broadening. In addition, spin diffusion will become a problem in NOESY (nuclear Overhauser effect spectroscopy) experiments at shorter mixing times as the sample concentration is increased. Although with high sample concentrations it has been reported that mixing times of 40 msec and less must be used to
[ 13]
~H NMR SPECTROSCOPYOF DNA
239
stay in the linear range of NOE buildups, ~7 we have found that for a 12-base pair (bp) DNA oligonucleotide at 2 m M duplex sample concentration and 35* NOE buildup rates are linear out to at least 75 msec. TM Obtaining High Quality 1H N M R Spectra of DNA
One-Dimensional IH NMR Spectra Before beginning a lengthy two-dimensional NMR study of a DNA oligonucleotide, it is useful to obtain one-dimensional spectra in D20 and H20 at several temperatures in order to assess the thermal stability of the molecule under NMR conditions. Resonances in I)20 cover the range from about 9.5 to 0.5 ppm. Much of the early NMR work on nucleic acids monitored the melting of DNA by chemical shifts as a function of temperature? The one-dimensional spectra also allow a quick assessment of sample purity as well as the possible presence of more than one conformation. In general, both the imino and amino resonances of DNA exchange too fast to be observed in D20, and they must be observed in H20 solution? 9 For proteins, spectra in water are generally acquired with a presaturation pulse on the H20. This is not usually the method of choice for nucleic acids, since the amino and imino resonances will exchange with water during the presaturation pulse and therefore their intensity will usually be greatly diminished. For some molecules, enough resonance intensity remains that this may still be a useful technique for qualitative results in a 2-D experiment2°, or in a protein-DNA complex. In general, however, some sort of selective excitation which leaves the water unperturbed in the equilibrium position is used. These water suppression techniques have been recently reviewed.2~-2a The best method for water suppression appears to be instrument dependent, and new methods are still being proposed. In our laboratory, on our GN 500 MHz (GE NMR; Freemont, CA) 17B. R. Reid, K. Banks, P. Flynn, andW. Nerdal, Biochemistry28, 10001 (1989). ~s E. Wang and J. Feigon, unpublished results (1989). ~9D. R. Kearns, D. J. Patel, and R. G. Shulman, Nature (London) 229, 338 (1971). 2o p. Rajagopal, D. E. Gilbert, G. A. van der Marel, J. H. van Boom, and J. Feigon, J. Magn. Reson. 78, 526 (1988). 21 p. j. Hore, this series, Vol. 176, p. 64. 22 M. Gutron, P. Plateau, and M. Decorps, Prog. NMR Spectrosc. 23, 135 (1991). 23 V. Sklen~, in "NMR Applications in Biopolymers" (J. W. Finley, S. J. Schmidt, and A. S. Serianni, eds.), Vol. 56, p. 63. Plenum, New York, 1990.
240
S P E C T R O S C O P IMETHODS C FOR ANALYSIS OF D N A
[ 13]
spectrometer, we have found that consistently satisfactory results (even for nonexperienced operators) are obtained using the 1T spin echo pulse sequence proposed by Sklenfi~ and Bax. 24 This technique can tolerate relatively large inhomogeneities of both static magnetic and radiofrequency field and can easily be incorporated into various phase-sensitive 2-D N M R experiments. The pulse sequence 90,,-t-90.x-dl-90/-2t-90./-d2-Acqo[f= x,y,-x,-y; p=x,-x,x,-x; d i e d 2 - 3 0 - 5 0 g s e c ] gives an excitation profile proportional to sin 3 with the maxima at offsets + 1/[4(t + 2/3t9o)], where t9o is the length of the 90 ° pulse. There is no excitation at the carrier frequency, and spectra with very flat baselines can be obtained. The refocusing delay d2 in the I1 spin echo pulse sequence should be adjusted so that there is a near zero linear phase correction of the Fourier-transformed spectrum; this compensates for the signal delay on the filters which distorts the intensities of the first few points in the free induction decay (FID) resulting in baseline distortions. It is possible to obtain one-dimensional spectra in H20 with accurate intensities over almost the entire spectral range using the NEWS pulse sequence. 25 However, this pulse sequence will not work for two-dimensional N M R experiments, so its utility is limited. Obtaining Two-Dimensional Spectra in 1)20
Today, setting up various phase-sensitive two-dimensional N M R experiments in D20 is fairly routine. The most valuable data for DNA samples are obtained from NOESY, 26 ROESY, 27 TOCSY, 2sa9 P.(E).COSY, a°,31 2Q, 32 and H O E N O E 33 experiments. A flat baseline in both frequency dimensions is a basic precondition for reliable analysis of phase-sensitive two-dimensional N M R spectra. This requires both optimization of the acquisition parameters, discussed here, and the processing parameters, discussed below. In the f2 domain the appropriate choice of audiofrequency filters and of the preacquisition delay are important. For instruments where there is a choice between Bessel and Butterworth filters, 24V. Sldel~ and A. Bax, J. Magn. Reson. 74, 469 (1987). 25L. Pfi~ek,E. Wang, J. Feigon, Z. Star~uk, and V. Slden~, J. Magn. Resort. 91, 120 (1991). 26A. Kumar, R. R. Ernst, and K. Wiithrich,Biochem. Biophys. Res. Commun. 95, 1 (1980). 27A. A. Bothner-By,R. L. Stephens, J. Lee, C. D. Warren, and R. W. Jeanloz,J. Am. Chem. Soc. 106, 811 (1984). 2s A. Bax and D. G. Davis,J. Magn. Res. 65, 355 (1985). 29L. Brannschweilerand R. R. Ernst, J. Magn. Resort. 53, 521 (1983). 30D. Marion and A. Bax, J. Magn. Resort. 80, 528 (1988). 31L. MueUer,J. Magn. Reson. 72, 191 0987). 32L. Braunschweiler,G. Bodenhausen,and R. R. Ernst, MoL Phys. 48, 535 (1983). 33V. Sklen~ and J. Feigon,J. Am. Chem. Soc. 112, 5644 (1990).
[ 13]
1H NMR SPECTROSCOPYOF DNA
241
the Bessel filter usually gives a flatter baseline with only a small decrease in signal-to-noise ratio. For magnitude experiments or spectra processed with an unshifted sine-bell or similar function, the Butterworth filter is acceptable. For spectrometers where a fiat baseline cannot be obtained with these methods, application of a refocusing pulse at the end of the pulse sequence is useful. ~ The preacquisition delay which separates the last pulse in the pulse sequence and the start of the data acquisition should be carefully adjusted until the best baseline is obtained; the optimum situation gives a one-dimensional spectrum for which the first-order phase correction is near zero. In the f~ dimension, different procedures must be applied for spectra obtained with TPPI or hypercomplex Fourier transform acquisition schemes. As has been recently shown by Bax and co-workers,35 the following approach gives a fiat baseline in f~ for data acquired with the hypercomplex method. The first t~ increment is set to [DWJ2 - k(2/n)tgo], where DW~ is the dwell time in the t~ dimension, tgo is the length of the 90 ° pulse, and k - - 2 for NOESY and k = 1 for TOCSY experiments. No scaling factor is applied to the first points of the t~ FIDs, and the spectra in thef~ domain are phase corrected with a linear phase correction of 180 °. The most effective method for tracing out single-step J connectivities and for measuring J coupling constants in the DNA sugar residues is the P.COSY experiment, a° If a mixing pulse of 90 ° is applied, the cross-peak patterns are essentially the same as those obtained with DQF-COSY 3~ but can be obtained in one-fourth the time. A mixing pulse of 45 ° or less results in E.COSY 36 type spectra from which the J coupling constants for H I ' - H 2 ' , H I ' - H 2 " , and H 2 ' - H 2 " can be directly measured. 37 The artificial generation of the dispersive diagonal which is subsequently subtracted from the phase-sensitive COSY spectrum reduces the experimental time to one-quarter for the P.COSY alternative to DQF-COSY and to one-sixth for the P.E.COSY alternative to E.COSY experiments. Sixteen scans are required to fulfill the coherence transfer selection and CYCLOPS 3s phase cycles per tx complex point. If measuring time is a limiting factor, the experimental protocols for many of these experiments can be optimized to obtain the highest quality spectra in the shortest possible time. If the rf channels are well balanced, the CYCLOPS phase cycling can be omitted in TOCSY, HOENOE, and 34 D. G. Davis, J. Magn. Reson. 81,603 (1989). 35 A. Bax, M. Ikura, L. E. Kay, and G. Zhu, J. Magn. Reson. 91, 174 (1991). 36 C. Griesinger, O. W. Sorensen, and R. R. Ernst, J. Am. Chem. Soc. 107, 6394 0985). 37 A. Bax and L. Lerner, J. Magn. Reson. 79, 429 (1988). 3s D. I. Hoult and R. E. Richards, Proc. R. Soc. London, A 344, 311 (1975).
242
SPECTROSCOPIC METHODS FOR ANALYSIS OF D N A
[13]
NOESY experiments. Axial peaks and single-quantum coherence can be suppressed in NOESY spectra by applying a short homospoil pulse during the mixing period. Two to four dummy scans are usually used at the beginning of each tl increment to establish a dynamic equilibrium in the spin system; these can usually be eliminated if a "pulse equilibrium cascade" is applied at the beginning of the pulse sequence. This is done by putting two short spin-lock pulses (2-3 msec) applied in perpendicular directions followed by a short homospoil pulse (3-5 msec) at the beginning of the relaxation delay. As a result, the spin system is completely incoherent at the beginning of the relaxation interval, and the artifacts resulting from different magnetization magnitudes at the beginning of the tl- preparation period are effectively suppressed. With these schemes, good TOCSY and NOESY spectra on 2 - 3 mM DNA samples can be obtained with only four and eight scans per t~ complex point, respectively. A 256 × 1024 complex data matrix can be obtained in less than one hour. This approach is especially useful for quickly checking a new sample and is essential if three-dimensional spectra are to be obtained. For spectra with a high signal-to-noise ratio, the full phase cycle and acquisition times up to 12-24 hr are recommended.
Obtaining Two-Dimensional Spectra in 1-120 NMR studies of the exchangeable resonances of DNA have been largely limited until recently to one-dimensional spectra and assignments of the imino resonances only via one-dimensional NOEs. 5 The imino and amino resonances are very important indicators of the hydrogen bonding of the bases and provide some of the few cross-strand connectivities, and they are therefore very important for structure determination. Most of these resonances can be readily assigned from two-dimensional NOESY spectra taken in water,2°,39,4° and the NOESY experiment is the most informative two-dimensional experiment for DNA samples in H20. Most studies on DNA conformation have been done at neutral pH. However, the exchange rate of the imino resonances decreases with lower pH, so it is useful to obtain spectra in H20 at somewhat lower pH ( - 6 ) in order to see crosspeaks to something other than H20. Some DNA sequences have pH-dependent structural transitions, however, so it is important to determine if this is the case before changing the pH. Running at low temperature will also help, although in general the peaks are broader and poorer water suppression is obtained at low temperature. 39 R. Boelens, R. M. Scheek, K. Dijkstra, and R. Kaptein, J. Magn. Reson. 63, 378 (1985). 4o V. Sklen~ and J. Feigon, Nature (London) 345, 836 (1990).
[13]
~H NMR SPECTROSCOPYOF DNA
243
Obtaining good spectra of DNA in water depends both on using optimal acquisition conditions and on processing data appropriately. Data processing will be discussed in the next subsection. The most important factors in terms of acquisition are proper shimming to decrease the water "hump" and appropriate adjustment of parameters so that a fiat baseline is obtained with minimum first-order baseline correction. The standard pulse sequences are used except that the nonselective read pulse is replaced by a selective pulse sequence. The selective read pulse can be the 1-[ spin echo, 24 jump and return, 41 or other pure selective excitation sequence. This gives a spectrum with accurate intensities along f~, so that with proper processing most of the cross-peaks can be seen at least on one side of the diagonal. The water magnetization which survives in the transverse plane during the mixing period must be destroyed by application of a homospoil pulse. Problems with radiation damping which may occur in scans when the water magnetization is aligned along the - z axis at the beginning of an acquisition can be solved by modifying the phase cycle42 or by detuning of the probe. In our experience, slight detuning which lowers the sensitivity by only about 5-10% is usually sufficient to prevent receiver overload during the acquisition. In certain cases, NOESY spectra of DNA in H20 can be obtained using a selective saturation pulse on water during the recycle delay and mixing time, 2° as is done for proteins, which can be useful for assignment purposes but not for quantitation. The exchangeable resonance intensity will be decreased, and the intensity of observable exchangeable resonances and their cross-peaks will depend on their exchange rate with water. In general, this method results in loss of all of the resonance intensity of the G amino and terminal exchangeable resonances.
Processing Two-Dimensional NMR Spectra Processing two-dimensional spectra of DNA in DzO is essentially like processing spectra of proteins. Sources of and approaches to eliminating various artifacts in t~ and t2 have been discussed elsewhere. 1,43 Optimal apodization functions to apply will depend on the type of experiment, the application (i.e., assignments versus quantitation), and the sample. In general, spectra are processed several different ways until the best results are obtained. In some cases, it is beneficial to baseline correct the spectrum in f2 and/or f~, usually with a first-order or first- or second-order polynomial fit, respectively. 41 p. Plateau and M. Gurron, J. Am. Chem. Soc. 104, 7310 (1982). 42 p. R. Blake and M. F. Summers, J. Magn. Resort. 86, 622 (1990). 43 G. Otting, H. Widmer, G. Wagner, and K. Wiithrich, J. Magn. Reson. 66, 187 (1986).
244
SPECTROSCOPIC METHODS FOR ANALYSIS OF D N A
[ 13]
A bib
E n.
1
i
ppm D
B
i.
:
?
f i
o
~1 i
O
;': t! ' ,s:'"
ii
ft.
iii O
,j'~
"' '.L. ."
,,*,
'
.
;i-
:,.~
,.. O
15'.0
12'.0
8~o
41o
ppm FIG. 1. Comparison of 500 MHz ~H NMR NOESY spectrum in H20 of the DNA oligonucleotide d(AGATAGAACCCCTTCTATCTTATATCTGTCTT) processed (A) without time domain convolution difference (smooth) and without polynomial baseline correction and (B) smoothed with a Gaussian window (_+32 points) in t2 and basdine corrected with a sixth-order polynomial in f2 and a second-order polynomial in f~. The NMR sample was 400/zl of 2.3 m M DNA oligonuclcotide in 100 m M NaCI, 5 m M MgC12, pH 5.5• The standard NOESY pulse sequenc~ 6 was used, except the read pulse was replaced with a IT spin echo observe pulse.24 Acquisition parameters were Zm = 150 msec, with a 5 msec homospoil
[ 13]
IH NMR SPECTROSCOPYOF DNA
245
The visual presentation of NOESY spectra in H20 can be improved by various postacquisition data processing methods which further reduce the residual water signal? 4-4~ The effect of the time domain convolution difference routine44 and baseline correction on a NOESY spectrum of a 32-base DNA oligonucleotide which folds to form an intramolecular triplex is shown in Fig. 1. As can be seen, this processing not only substantially improves the appearance of the spectrum, but also enhances the information content of the spectrum. This will be the case whenever the dispersive residual water impairs the baseline along the f2 dimension. Assignment Strategies
B-DNA Assignments Assignment strategies for the nonexchangeable proton resonances of B (or A) DNA are straightforward and have been well documented in the literature. 1,7-9,12,47-52 The base pairs and the deoxyribose sugar are shown in Fig. 2 with the numbering system used. Examination of the B-DNA helix reveals that there should be a series of sequential connectivities (i.e., short interproton distances which will give rise to NOEs) from base H8 or H6 to sugar HI', H2', H2" to base and so on in the 5 ' - Y direction along each strand of the helix. These sequential connectivities are illustrated schematically in Fig. 3A. Connectivities between protons in a given sugar can be obtained from correlated spectra (COSY, TOCSY, 2Q, etc). Be44 D. Marion, M. Ikura, and A. Bax, J. Mag. Res. 84, 425 (1989). 45 y. Kuroda, A. Wada, T. Yamazaki, and K. Nagayama, J. Magn. Resort. 84, 604 (1989). 46 p. Tsang, P. Wright, and M. Rance, J. Magn. Resort. 88, 210 (1990). 47 M. S. Broido, Biochem. Biophys. Res. Commun. 119, 663 (1984). 4s M. A. Weiss, D. J. Patel, R. T. Sauer, and M. Karplus, Proc. Natl. Acad. Sci. U.S.A. 81, 130 (1984). 49 R. M. Scheek, R. Boelens, N. Russo, J. H. van Boom, and R. Kaptein, Biochemistry 23, 1371 (1984). so C. A. G. Haasnoot, H. P. Westerink, G. A. van der Marel, and J. H. van Boom, J. Biomol. Stereodyn. 1, 131 (1983). 5~ W. J. Chazin, K. Wiithrich, M. Rance, S. Hyberts, W. A. Denny, and W. Leupin, J. Mol. Biol. 109, 439 (1986). 52 R. Grtitter, G. Otting, K. Wiithrich, and W. Leupin, Fur. Biophys. J. 16, 279 (1988).
at the beginning; 2 sec recycle delay, 11364 Hz spectral width in both dimensions (88/tsec dwell); acquisition time 180.224 msec; 2048 complex points in t2; 445 t~ increments collected; z for the 1T echo pulse = 56/tsec; 32 scans per h with two dummy scans. The spectra were processed with 2048 complex points in both dimensions and apodized with a shifted sine-bell squared function of 65 ° and 600 points in t2 and 75 ° and 445 points in h-
246
SPECTROSCOPIC METHODSFOR ANALYSISOF DNA
[ 13]
H
\
? - . .....% -'N9~04 / \
N ..... H~N3 \ /~ /C6~H N3"--C~,H o//C2--N~
A
T
H55. ' H ~~" /Y ,,/& n3' ~ / H
~Nr
c8
/
I N
O.... H
",.%--C6!/
if' o-o~
\
G
N
H
" N - . .....o//
\
"
IXHz
H2"
\ffc4-cs - -/
\k
/
~,.
H
.~,--H..... ~i/
N3"--C/2
ase
/oo-. .
.C2~N1 C
FIG. 2. Watson-Crick A.T and G'C base pairs and the deoxyribosesugar with numbering systems. cause the assignment procedures have already been well described elsewhere, in this section we simply point out some details which may be useful. B-DNA, with all anti glycosidic torsion angles, gives a pattern of strong H 6 , H 8 - H2',H2" cross-peaks and weaker H 6 , H 8 - H 1' cross-peaks which are used to make sequential assignments. Although the shortest intra- and internucleotide base-sugar connectivities are H 6 , H 8 - H 2 ' and H 6 , H 8 H2", respectively, it is usually easiest to make sequential assignments via the H 6 , H 8 - H I ' cross-peaks. The more complicated H 6 , H 8 - H 2 ' , H 2 " cross-peak region can be used to confirm these assignments and to resolve ambiguities. Although some of the intensity in the b a s e - H I ' cross-peak region arises from spin diffusion via the H2',H2" protons, this is not a
[13]
A
1H NMR SPECTROSCOPYOF DNA
5'
B
247
5'
FIG. 3. (A) Schematic of one strand ofa B-DNAduplex with the sequence d(ATA). Some of the sequential connectivities which should give rise to NOEs between purine H8 or pyfimidine H6 and the sugar protons are indicated. Although only the shortest intra- and interuucleotide base-sugar connectivities are indicated, each base H8 or H6 proton is within NOE distance (
