Journal of Biomolecular Structure and Dynamics
ISSN: 0739-1102 (Print) 1538-0254 (Online) Journal homepage: http://www.tandfonline.com/loi/tbsd20
2-Deoxyglucose conjugated platinum (II) complexes for targeted therapy: design, synthesis, and antitumor activity Qian Mi, Yuru Ma, Xiangqian Gao, Ran Liu, Pengxing Liu, Yi Mi, Xuegang Fu & Qingzhi Gao To cite this article: Qian Mi, Yuru Ma, Xiangqian Gao, Ran Liu, Pengxing Liu, Yi Mi, Xuegang Fu & Qingzhi Gao (2015): 2-Deoxyglucose conjugated platinum (II) complexes for targeted therapy: design, synthesis, and antitumor activity, Journal of Biomolecular Structure and Dynamics, DOI: 10.1080/07391102.2015.1114972 To link to this article: http://dx.doi.org/10.1080/07391102.2015.1114972
Accepted author version posted online: 02 Nov 2015. Published online: 30 Nov 2015. Submit your article to this journal
Article views: 15
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbsd20 Download by: [University of Sussex Library]
Date: 06 December 2015, At: 04:57
Journal of Biomolecular Structure and Dynamics, 2015 http://dx.doi.org/10.1080/07391102.2015.1114972
2-Deoxyglucose conjugated platinum (II) complexes for targeted therapy: design, synthesis, and antitumor activity Qian Mia, Yuru Maa, Xiangqian Gaoa, Ran Liua, Pengxing Liua, Yi Mib, Xuegang Fua and Qingzhi Gaoa* a
Tianjin Key Laboratory for Modern Drug Delivery & High-Efficiency, Collaborative Innovation Center of Chemical Science and Engineering, School of Pharmaceutical Science and Technology, Tianjin University, 92 Weijin Road, Nankai District, Tianjin 300072, P.R. China; bCentral Institute of Pharmaceutical Research, CSPC Pharmaceutical Group, 226 Huanghe Road, Shijiazhuang, Hebei 050035, P.R. China
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
Communicated by Ramaswamy H. Sarma (Received 15 August 2015; accepted 27 October 2015) Malignant neoplasms exhibit an elevated rate of glycolysis over normal cells. To target the Warburg effect, we designed a new series of 2-deoxyglucose (2-DG) conjugated platinum (II) complexes for glucose transporter 1 (GLUT1)-mediated anticancer drug delivery. The potential GLUT1 transportability of the complexes was investigated through a comparative molecular docking analysis utilizing the latest GLUT1 protein crystal structure. The key binding site for 2-DG as GLUT1’s substrate was identified with molecular dynamics simulation, and the docking study demonstrated that the 2-DG conjugated platinum (II) complexes can be recognized by the same binding site as potential GLUT1 substrate. The conjugates were synthesized and evaluated for in vitro cytotoxicity study with seven human cancer cell lines. The results of this study revealed that 2-DG conjugated platinum (II) complexes are GLUT1 transportable substrates and exhibit improved cytotoxicities in cancer cell lines that over express GLUT1 when compared to the clinical drug, Oxaliplatin. The correlation between GLUT1 expression and antitumor effects are also confirmed. The study provides fundamental information supporting the potential of the 2-DG conjugated platinum (II) complexes as lead compounds for further pharmaceutical R&D. Keywords: 2-Deoxyglucose conjugated platinum (II) complex; tumor targeting; molecular dynamics; glucose transporter; anticancer agent
Introduction Since the German scientist Otto Warburg discovered the phenomenon that cancerous tissues exhibit increased glucose uptake and aerobic glycolisys (Warburg, Wind, & Negelein, 1927), targeting the Warburg effect by glycoconjugation as tumor-targeting strategy has garnered a great deal of interest in targeted therapy research. Later studies revealed that glycolytic enzymes, as well as some members of major facilitator superfamily (MFS) such as glucose transporter GLUT1, GLUT3, and GLUT5, are widely overexpressed in human cancer cells (Boado, Black, & Pardridge, 1994; Godoy, Ulloa, & Rodríguez, 2006; Kurata, Oguri, Isobe, Ishioka, & Yamakido, 1999; Younes, Brown, Stephenson, Gondo, & Cagle, 1997). Furthermore, high expression of these proteins are positively correlated with poor cancer prognosis and survival (Haber, Rathan, & Weiser, 1998; Kunkel, Reichert, & Benz, 2003). GLUT1 is the first transmembrane glucose transporter isoform to be purified, and it is the most extensively studied among all MFS proteins due to the fact that it is associated with the energy supply of cancer cell, thus an important prognostic indicator for tumor *Corresponding author. Email: [email protected] © 2015 Taylor & Francis
genesis (Liu et al., 2014; Schechter et al., 2009; Zhang et al., 2003). Based on these scientific achievements, the 2-deoxy2-(18F) fluoro-D-glucose (18F-FDG) PET imaging system has been successfully developed for clinical cancer diagnosis and staging (Ben-Haim & Ell, 2009; Plathow & Weber, 2008). Although the glycoconjugation strategy for tumor targeting has been actively conducted by medicinal chemists, the structure-based computational approach was not frequently adopted by scientists due to the lack of satisfied structure template for homology modeling and experimentally reliable GLUT1 model (Cunningham, Afzal-Ahmed, & Naftalin, 2006; Holyoake, Caulfeild, Baldwin, & Sansom, 2006; SalasBurgos, Iserovich, Zuniga, Vera, & Fischbarg, 2004). In 2014, the great effort from Yan’s group achieved the first success in GLUT1 crystallization (PDB ID: 4PYP) (Deng et al., 2014). According to the latest achievement from the structural biology research, we are now able to, from the aspects of CADD approach, perform more precise structure-based molecular design and lead generation.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
2
Q. Mi et al.
Platinum (II) complexes as anticancer drugs are efficiently used in the clinics worldwide. Over the past few decades, despite the synthetization and evaluation of thousands of platinum complexes for their activities and potencies (Eslami Moghadam et al., 2015; Kostova, 2006; Lu, Gao, Wu, Zhang-Negrerie, & Gao, 2011; Negureanu & Salsbury, 2014), there are still multiple obstacles and challenges that need to be overcome on the road to success. One of the most notable of the aforementioned barriers is the lack of tumor selectivity and low water solubility of the platinum-containing complexes, as they may contribute to major organ toxicity by metal accumulation. To fulfill these aims of developing a safe but effective generation of platinum-based anticancer agent, we consider that tumor-specific glucose transporter – GLUT1-targeted glycoconjugate would possess promising features with desirable profiles for platinum-based drug design. In 2013, we reported the first example for glucoseconjugated (trans-R,R-cyclohenxane-1,2-diamine)-malonatoplatinum(II) complexes with extremely high water solubility, comparable or more potent anticancer activity (Liu et al., 2013). Biological studies demonstrated that the glucose analog, 2-deoxyglucose (2-DG), has three times larger Michaelis constant toward hexokinase compared to glucose (Kapoor et al., 1989). GLUT1-mediated sugar transport investigation in oocyte system also demonstrated that 2-DG exhibits much higher uptake than D- and L-glucose and with higher GLUT1-binding affinity (Mueckler & Makepeace, 1997). By taking the advantage of 2-DG as a more specific GLUT1 substrate, and combined with the newest available GLUT1 protein model, in this project we performed for the first time, the design of a new series of 2-DG conjugated platinum (II) complexes, the GLUT1 crystal structure-based docking study for the designed platinum (II) conjugates report herein as the initial example for lead generation study of 2-DG conjugated platinum (II) anticancer agent.
Figure 1.
Materials and methods Glucose transporter-targeted conjugate design For the design concept, we take the advantage of the third generation platinum drug oxaliplatin by retaining the diaminocyclohexane chelating ligand, which plays an important role in circumventing cross-resistence between cisplatin/carboplatin and oxaliplatin. The 2-DG moiety was attached to the 2-position of the malonate structure and it was expected to act as both the solubility increasing auxiliary and transporter recognition group that potentially possess the key characteristics for GLUT1 targeting (Figure 1). Computational transportability assessment with GLUT1 Molecular dynamics (MD) simulation study for protein minimization and binding pocket identification of 2-DG were performed using AutoDock 4.0 software. To assess the potential binding affinity of the designed 2-DG conjugated platinum (II) complexes, molecular docking analysis of the designed 2-DG conjugates was performed and compared with 2-DG itself using SYBYL-X 2.0 with Surflex-Dock algorithm running on a Linux workstation. Protein source We adopted the latest crystal structure of the human GLUT1 (PDB ID: 4PYP), which was bound with n-nonyl-β-D-glucopyranoside (β-NG) from RCSB Protein Data Bank at http://www.rcsb.org/pdb/ (Deng et al., 2014). Ligand positioning To determine the 2-DG binding site in GLUT1 by MD simulation, the ligand of n-nonyl-β-D-glucopyranoside was replaced by 2-DG according to the hexose function
Design concept of platinum (II)–sugar conjugates and the structures of 2-DG conjugated platinum (II) complexes.
GLUT1 targeted platinum (II) complexes moiety of the ligand in 4PYP complex. 2-DG conjugated platinum (II) complexes were docked into the identified binding site of 2-DG for Surflex docking analysis. To assure geometric accuracy of the platinum–cyclohexanediamine chelating complex, geometric constraint between the platinum metal and the diamino ligand was applied based on the crystal structure which we have obtained for glucose-conjugated platinum complex (Liu et al., 2013).
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
MD simulation Minimization of the protein structure with replaced 2-DG (2-DG-occluded GLUT1) and binding site identification for 2-DG were performed by MD simulation. To mimic the physiological environment for the GLUT1 transporter, the protein was put in the center of a 1-palmitoyl-2-oleylhosphatidylcholine (POPC) lipid bilayer which was comprised of about 209 POPC molecules. Subsequently, these systems of protein membrane were solvated in a water cubic box (solvation layer of ~10 Å thicknesses with the periodic box size ~120 Å × 120 Å × 100 Å), and were added 17 chloride ions to preserve the electric neutrality using VMD v1.91 (Humphrey, Dalke, & Schulten, 1996). A 20-ns long MD simulation was performed on the solvated initial systems with the CHARMM27 force field after 25,000 steps of minimization using the NAMD 2.9 package (Phillips et al., 2005). The long-range electrostatic forces were controlled by the smooth particle–mesh Ewald method (Cheatham, Miller, Fox, Darden, & Kollman, 1995). The non-bonded cut-off was set to 12 Å. The bonds formed by hydrogen atoms were constrained by the SHAKE algorithm (Ryckaert, Ciccotti, & Berendsen, 1977). The systems were heated from 0 to 310 K. Efficient pressure control was achieved by applying the Langevin piston method, with the target pressure set to 1 atm. The integration time step was set to 2 fs. VMD v1.91 was used for trajectory analysis. Surflex docking The file of the docking ligands is prepared by SYBYL-X 2.0 embedded module (SYBYL-X software 2015). To define an appropriate receptor in the simulation, all water molecules were removed from the protein structure. 2-DG ligand (after MD simulation) was extracted to generate protomol subsequently. All hydrogen atoms were added randomly, and side chains were fixed during the protein preparation. The structure was then subjected to an energy refinement procedure. Gasteiger–Marsili charges and AMBER7 FF99 charges were loaded for the 2-DG conjugated platinum (II) complexes and protein, respectively. The docking mode was set to Surflex-Dock (GEMO). The binding property of 2-DG conjugated
3
platinum (II) complexes was then estimated using different scoring functions. Chemistry and biology Oxaliplatin, trans-R, R-cyclohexane-1, 2-diamine, K2PtCl4 were purchased from Sigma-Aldrich. Platinum (II) glycoconjugates were synthesized according to the method described below. HPLC analyses were conducted using CXTH-LC3000 analytical and semi-preparative gradient HPLC system with DaisoGel C18 (4.6 × 250 mm, 5 μm) and DaisoGel C18 (20 × 250 mm, 10 μm) column, respectively, at room temperature. The mobile phase consisted by MeOH and H2O was used and the flow rate of 1 mL/min for analytical and 10 mL/min for preparative purification were used. 1H NMR spectra was carried out on a Bruker Avance 400 MHz spectrometer. High-resolution mass spectra were recorded on a Bruker MicroTOF spectrometer. Thiazolyl blue tetrazolium bromide (MTT) reagent and Dulbecco’s phosphate-buffered saline from SigmaAldrich were used for cytotoxicity evaluation. All other chemicals obtained from commercial suppliers were used as received and were of analytical grade. Stock solutions of platinum (II) complexes and oxaliplatin for cytotoxicity studies were prepared in deionized water at room temperature just before use. Oxaliplatin stock solution was prepared under ultrasonication at room temperature for 15 min and all further dilution to designated concentrations was made using deionized water. Cell lines and cell cultures HT29 (human colon cancer cell line), MCF7 (human breast cancer cell line), A549 (cell line of human lung carcinoma), H460 (human lung cancer cell line), SKOV3 (human ovarian cancer cell line), and DU145 (human prostate cancer cell line) were obtained from Central Institute of Pharmaceutical Research, CSPC Pharmaceutical Group, China. MCF7 was cultured in DMEM (Gibco), and HT29, H460, SKOV3, and DU145 on monolayer using RPMI 1640 (Invitrogen) supplemented with 10% fetal bovine serum, 2 mm glutamine, and .25 units/ml insulin and in an incubator (37 °C) continuously gassed with 5% CO2. Cells were subcultured using .0625% trypsin in HBSS to maintain cells in the exponential growth phase. Cytotoxicity evaluation MTT assay： Cells were seeded in a 96-well flatbottomed microplate at 2000–7500 cells/well in 100 μL of growth medium solution (10% fetal calf serum and penicillin–streptomycin in RPMI-1640 medium (Invitrogen) on day 0. On day 1, cells were treated either with
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
4
Q. Mi et al.
vehicle or the complexes (Oxaliplatin, 2-DG-derived Pt (II) complexes were dissolved in deionized water and mixed with the growth medium; samples for 2-DG conjugated platinum (II) complexes were prepared with deionized water. Platinum-based serial dilution was made and added to each well). The microplate was incubated at 37 °C, 5% CO2, 95% air in a humidified incubator for 72 h. MTT (Sigma-Aldrich) was added to each well at the final concentration of .83 mg/mL and incubated for 3 h. Cells were lysed by MTT lysis buffer (15% SDS, .015 M HCl) and uptake of MTT was measured at 570 nm absorbance using a multiwell-reading UV–vis spectrometer. For each complex, cell surviving rates are expressed as the relative percentage of absorbance compared to controls without drug. The IC50 values of each test sample (concentration required to reduce the absorbance by 50% compared to the controls) were determined by the dose dependence of surviving cells after exposure to the test sample for 72 h. Experimental conditions were performed in five replicates (5 wells of the 96-well plate per experimental condition). Cellular RNA isolation and real-time RT-PCR Total cellular RNA was isolated immediately from cultured cancer cells using Trizol Reagent (Gibco BRL, Gaithersburg, MD), according to the manufacturer’s instructions. Two micrograms of total RNA were reverse transcribed using the superscript III first-stand synthesis system for RT-PCR kit (Invitrogen). Real-time RT-PCR was performed using a SYBR green dye I (Applied Biosystems, Foster City, CA) with the ABI 7900 Sequence Detection System (PE Applied Biosystems). cDNA was first denatured at 95 °C for 2 min and then amplified through 40 amplification cycles, according to the manufacturer’s protocol as follows: denatured at 95 °C for 15 s, and annealed/extended at 60 °C for 60 s. Fluorescence signals were recorded in each cycle. Relative quantitation of gene expression was carried out using the standard curve method and analyzed with RQ-manager 1.2 (ABI 7900 Sequence Detection System, Applied Biosystems). Samples were run as triplicates in separate tubes to permit quantification of the target gene normalized to GAPDH used for equal loading. Sequences of human GLUT-1 primers used are forward primer, GGCCAAGAGTGTGCTAAAGAA; reverse primer, ACAGCGTTGATGCCAGACAG. The specificity of the PCR products was confirmed on a 2.0% agarose gel by showing a specific single band with the expected size. Preparation of 2-deoxy-3,4,6-tri-O-acetyl-β-bromoethylD-glucopyranoside (1) 1,3,4,6-Tetra-O-acetyl-2-deoxy-D-glucopyranose (2-DGOAc) was prepared according to the literature method
(Zhang et al., 2005). To an ice-cooled solution of 2-DGOAc (4 mmol, 1.3 g) and 2-bromoethanol (4.8 mmol, 340 μL) in dry DCM (16 mL) was added BF3·Et2O (600 μL) and stirred for 1 h. Then, the reaction mixture was poured into ice water (15 mL), and 30 mL of DCM was added to extract the product. The organic phase was washed successively with sat. NaHCO3 (15 mL), water (15 mL), and brine (15 mL). Then, it was dried over Na2SO4 and evaporated to dryness. The resulting crude product was subjected to column chromatography on silica gel (PE/EtOAc = 5:1) to give compound 1 as a colorless oil. Yield: 90%. 1H NMR (400 MHz, CDCl3): 5.28– 5.35 (m, 1H), 4.97–5.02 (m, 2H), 4.24–4.31 (m, 1H), 4.06–4.11 (m, 2H), 3.91–3.97 (m, 1H), 3.78–3.84 (m, 1H), 3.50 (t, J = 6.0 Hz, 2H), 2.29 (dd, J1 = 13.0 Hz, J2 = 5.3 Hz, 1H), 2.09 (s, 3H), 2.05 (s, 3H), 2.01 (s, 3H), 1.80–1.87 (m, 1H). 13C NMR (100 MHz, CDCl3): 170.52, 170.00, 169.79, 97.11, 69.14, 68.79, 68.20, 67.85, 62.23, 34.77, 30.17, 20.87, 20.67, 20.65. IR (KBr): 3457.38, 2943.26, 1745.14, 1642.07, 1434.35, 1368.43, 1230.99, 1130.50, 1048.97, 978.03. HRMS: Calcd. for C14H21BrO8 (M+): 397.0493, found: 397.0495. Preparation of diethylmalonate 2-deoxy-3,4,6-tri-Oacetyl-D-glucopyranose conjugate (2) To a mixture of 1 (3.0 mmol, 1.43 g) and diethyl malonate (6 mmol, .96 g) in dry DMF (18 mL) was added K2CO3 (12 mmol, 1.7 g) and stirred overnight. Then, 100 mL of ethyl acetate was added and washed with sat.NH4Cl (100 mL), water (100 mL), and brine (100 mL), dried over Na2SO4, and evaporated to dryness. The obtained crude product was purified by silica gel column chromatography (PE/EtOAc: 3/1) to give 2a as a colorless oil. Yield: 91%. 1H NMR (400 MHz, CDCl3): 5.21–5.28 (m, 1H), 4.98 (t, J = 9.8 Hz, 1H), 4.90 (d, J = 3.2 Hz, 1H), 4.14–4.32 (m, 5H), 3.92–4.04 (m, 2H), 3.68–3.74 (m, 1H), 3.52 (t, J = 7.3 Hz, 1H), 3.39–3.49 (m, 1H), 2.16–2.24 (m, 3H), 2.08 (s, 3H), 2.03 (s, 3H), 2.00 (s, 3H), 1.76–1.83 (m, 1H), 1.27 (t, J = 7.1 Hz, 6H). 13C NMR (100 MHz, CDCl3): 170.40, 169.85, 169.63, 168.94, 168.88, 96.85, 69.08, 68.86, 67.75, 64.83, 62.11, 61.28, 61.26, 49.06, 34.68, 28.28, 20.72, 20.50, 13.89, 13.88. IR (KBr): 3467.88, 2982.11, 1747.07, 1445.66, 1369.66, 1233.80, 1155.66, 1135.68, 1049.80, 602.47. HRMS: Calcd. for C21H32O12 (M+): 477.1967, found: 477.1970. Preparation of diethyl-2-chloromalonate-2-deoxy-3,4,6tri-O-acetyl-D-glucopyranose conjugate (3-Cl) To a solution of 2 (1.2 mmol, 552 mg) in dry toluene (10 mL) was added NaH (56 mg, 60% suspension in mineral oil) slowly and stirred for 30 min, then NCS
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
GLUT1 targeted platinum (II) complexes (1.4 mmol, 186 mg) was added slowly and stirred overnight. Ethyl acetate (50 mL) was added and washed with sat. NH4Cl (50 mL), water (50 mL), and brine (50 ml), dried over Na2SO4, and evaporated to dryness. The obtained crude product was purified by silica gel column chromatography (PE/EtOAc: 3/1) to give 3-Cl as a colorless oil. Yield: 81%. 1H NMR (400 MHz, CDCl3): 5.12– 5.19 (m, 1H), 4.50 (t, J = 9.9 Hz, 1H), 4.88 (d, J = 3.3 Hz, 1H), 4.25–4.39 (m, 5H), 3.94–4.08 (m, 3H), 3.56–3.62 (m, 1H), 2.55–2.67 (m, 2H), 2.21 (dd, J1 = 13.0 Hz, J2 = 5.2 Hz, 1H), 2.09 (s, 3H), 2.06 (s, 3H), 2.01 (s, 3H), 1.73–1.80 (m, 1H), 1.28–1.33 (m, 6H). 13C NMR (100 MHz, CDCl3): 170.55, 169.95, 169.81, 166.41, 166.34, 97.16, 69.01, 68.99, 67.90, 63.01, 62.95, 62.54, 62.23, 36.42, 34.52, 20.83, 20.66, 20.63, 13.81, 13.78. IR (KBr): 3468.99, 2983.04, 1745.81, 1446.00, 1368.68, 1233.27, 1132.40, 1006.03, 942.61. HRMS: Calcd. for C21H31ClO12 (M+): 511.1577, found: 511.1579. Preparation of diethyl-2-fluoromalonate-2-deoxy-3,4,6tri-O-acetyl-D-glucopyranose conjugate (3-F) To a solution of 2 (1.3 mmol, 620 mg) in dry DMF (10 mL) was added NaH (63 mg, 60% suspension in mineral oil) slowly and stirred for 30 min, then selectfluor (1.6 mmol, 552 mg) was added slowly and stirred overnight. Ethyl acetate (50 mL) was added and washed with sat. NH4Cl (50 mL), water (50 mL), and brine (50 mL), dried over Na2SO4, and evaporated to dryness. The obtained crude product was purified by silica gel column chromatography (PE/EtOAc: 3/1) to give 3-F as a colorless oil. Yield: 93%. 1H NMR (400 MHz, CDCl3): 5.12–5.19 (m, 1H), 4.98 (t, J = 9.7 Hz, 1H), 4.88 (d, J = 3.2 Hz, 1H), 4.26–4.37 (m, 5H), 3.95–4.05 (m, 2H), 3.82–3.86 (m, 1H), 3.49–3.54 (m, 1H), 2.47– 2.56 (m, 2H), 2.20 (dd, J1 = 13.0 Hz, J2 = 5.3 Hz, 1H), 2.07 (s, 3H), 2.04 (s, 3H), 1.99 (s, 3H), 1.72–1.79 (m, 1H), 1.28–1.32 (m, 6H). 13C NMR (100 MHz, CDCl3): 170.52, 169.91, 169.75, 166.05 (d, J = 10.5 Hz), 165.77 (d, J = 10.5 Hz), 97.00, 93.06, 91.10, 68.92, 68.90, 67.85, 62.56, 62.52, 62.16, 34.50, 33.50 (d, J = 20.9 Hz), 20.77, 20.59, 20.57, 13.83. IR (KBr): 2983.67, 1747.94, 1446.44, 1369.66, 1305.96, 1233.22, 1130.10, 1050.24, 1012.66, 859.72. HRMS: Calcd. for C21H31FO12 (M+): 495.1872, found: 495.1875. Preparation of (trans-R, R-cyclohexane-1, 2diamine)malonatoplatinum(II)-2-deoxy-D-glucopyranose conjugate (H-2DG-Pt) Compound 2 (1.3 mmol, 617 mg) was dissolved in MeOH (1.5 mL) at room temperature. A solution of NaOH (9.7 mmol, 390 mg) in water (3.0 mL) was then added
5
and stirred at 90 °C for 1 h. After completion of the reaction, the mixture was passed through a short column of DOWEX 88 strong acid cation resin. The desired product was then obtained after prep-HPLC purification (5% MeOH-99% H2O + .1% HCOOH) and lyophilization. Finally, the product was directly used for the next step. To a solution of the above product (.5 mmol, 160 mg) in water (3 mL) under an argon atmosphere was slowly added a saturated Ba(OH)2·8H2O aqueous solution until pH = 7.0. The mixture was stirred for 30 min at room temperature. [trans-R, R-cyclohexane-1, 2-diamine]PtSO4 (.6 mmol, 241 mg) in water (1.5 mL) was then added and stirred in the dark for 2 h. The precipitate was filtered and the filtrate was subjected to prepHPLC (15%MeOH-95% H2O) and then lyophilized to afford Pt(II) complex H-2DG-Pt as a white solid. Yield: 31%, over two steps. 1H NMR (400 MHz, D2O): δ 4.92 (d, J = 2.7 Hz, 1H), 4.22 (t, J = 7.0 Hz, 1H), 3.82–3.93 (m, 1H), 3.55–3.74 (m, 4H), 3.47–3.52 (m, 1H), 3.31 (t, J = 9.4 Hz, 1H), 2.29–2.35 (m, 4H), 2.06 (dd, J1 = 13.3 Hz, J2 = 5.0 Hz, 1H), 1.92 (br, 2H), 1.58–1.66 (m, 1H), 1.46 (d, J = 9.5 Hz, 2H), .90–1.50 (m, 4H). 13C NMR (100 MHz, D2O): 179.34, 179.01, 96.90, 72.37, 70.82, 68.36, 64.30, 62.41, 60.53, 54.52, 36.68, 31.73, 31.63, 28.51, 23.86, 23.81. IR (KBr): 3422, 3209, 3091, 2939, 1626, 1389, 1344, 1127, 1097, 1065, 1033, 976. HRMS: Calcd. for C17H30N2O9Pt (M+): 602.1677 (100.0%), 601.1656 (97.4%), 603.1679 (74.6%), found: 602.1679, 601.1658, 603.1681. Preparation of (trans-R, R-cyclohexane-1, 2-diamine)-2chloromalonatoplatinum(II)-2-deoxy-D-glucopyranose conjugate (Cl-2DG-Pt) Cl-2DG-Pt was prepared according to the procedure of H-2DG-Pt as a white solid after lyophilization. Yield: 32%, over two steps. 1H NMR (400 MHz, D2O): δ 4.92 (br, s, 1H), 3.55–3.80 (m, 7H), 3.17–3.25 (m, 1H), 3.05–3.15 (m, 1H), 2.32 (br, 2H), 1.85–2.02 (m, 3H), 1.40–1.58 (m, 3H), 1.18 (br, 2H), 1.03 (br, 2H). 13C NMR (100 MHz, D2O): 181.36, 181.07, 99.54, 81.83, 75.12, 73.54, 70.66, 65.42, 65.12, 64.59, 63.45, 40.55, 39.04, 34.46, 34.22, 26.39. IR (KBr): 3421, 2939, 2866, 1654, 1378, 1153, 1126, 1099, 1064, 1033, 972, 796. HRMS: Calcd. for C17H29ClN2O9Pt (M+): 636.1288 (100.0%), 635.1266 (97.4%), 637.1289 (74.6%), found: 636.1290, 635.1268, 637.1291. Preparation of (trans-R, R-cyclohexane-1, 2-diamine)-2fluoromalonatoplatinum(II)-2-deoxy-D-glucopyranose conjugate (F-2DG-Pt) F-2DG-Pt was prepared according to the procedure of H-2DG-Pt as a white solid. Yield: 35%, over two steps
6
Q. Mi et al.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
after lyophilization. 1H NMR (400 MHz, D2O): δ 4.90 (d, J = 2.6 Hz, 1H), 3.51–3.65 (m, 7H), 3.05–3.20 (m, 2H), 2.30 (br, 2H), 1.85–2.02 (m, 3H), 1.40–1.59 (m, 3H), .90–1.30 (m, 4H). 13C NMR (100 MHz, D2O): 175.51 (d, J = 23.7 Hz), 175.23 (d, J = 24.1 Hz), 96.12, 94.17, 72.64, 70.95, 68.11, 62.60 (d, J = 27.8 Hz), 62.57, 61.38, 60.86, 36.55, 36.47, 36.32, 31.78, 31.52, 23.81. IR (KBr): 3423, 2939, 2391, 2292, 1673, 1391, 1137, 1065, 1036, 972, 795. HRMS: Calcd. for C17H29FN2O9Pt (M+): 620.1583 (100.0%), 619.1562 (97.4%), 621.1585 (74.6%), found: 620.1586, 619.1565, 621.1588. Solubility of 2-DG conjugated platinum (II) complexes in water Solubility study of cisplatin, carboplatin, and oxaliplatin were conducted by placing excess of the drugs in deionized water in a series of 10-mL stoppered volumetric test tubes. The tubes were shaken in an incubating shaker at 25 °C for 1 h. The test tubes containing equilibrated solutions were then removed and filtered immediately by passing through .2-μm filters. Filtered samples (.5 mL) were diluted appropriately with deionized water. Drug estimation was made by using HPLC analysis for cisplatin, carboplatin, and oxaliplatin, with UV detector at 280 nm. The average value of three trials was taken. Standard curve obeyed Beer–Lambert’s law in the respective concentration range as >R2 = .999. Solubility for sugar-conjugated platinum (II) complexes were measured by a method of direct analysis of compound quality in saturated water solutions. Samples were filtered into a pre-weighed fine glass tube by passing through .2μm filters after shaking at 25 °C for 1 h, the mass of the filtrate plus the sample tube was then measured with electronic analytical balance (1:10,000). Filtrate was lyophilized to dryness and the mass for both water and platinum (II) complexes in the saturated test solution was calculated. The obtained water solubility results were combined into Table 1 with cytotoxicity analysis results. Results and discussion Chemistry The synthesis of the 2-DG-derived platinum (II) conjugates (H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt) was
Table 1.
accomplished starting from acetylated 2-deoxyglucose (Zhang et al., 2005) in a five-step sequence (Scheme 1). The alkylated 2-DG 1 was prepared by coupling of acetylated 2-DG with bromoethanol in dichloromethane in the presence of BF3·Et2O (90%). Alkylation of diethyl malonate with 1 using potassium carbonate to give 2 in 91% yield. Halogenation of 2 with N-chlorosuccinimide (NCS) or Selectfluor using sodium hydride in DMF afforded the corresponding chlorinated and fluorinated compounds of 3-Cl and 3-F (Cl: 81%, F: 93%). After hydrolysis with sodium hydroxide, the 2-DG conjugated platinum (II) complexes were obtained by platination reaction with 1R, 2R-diaminocyclohexaneplatinumsulfate (Pt(DACH)SO4) in the presence of barium hydroxide in water. The final products were purified with preparative HPLC using Disogel column and 15% MeOH-85% H2O as eluent (over 2 steps, 31% for H2DG-Pt, 32% for Cl-2DG-Pt, 35% for F-2DG-Pt). Representative 1H NMR characteristics including the stereochemical configuration for the α-form of the obtained 2DG conjugated platinum (II) complexes are depicted in Figure 2. All three 2-DG conjugated platinum (II) complexes were obtained as α-configuration from the adopted synthetic method illustrated in Scheme 1. The chemical shift of the 1-H for 2-deoxy-D-glucopyranoside showed the characteristic doublet signal of α-configuration at 4.90–4.92 ppm with a small coupling constant (J = 2.6, 2.7 Hz), whereas the 1-H signal of β-form for 2-deoxyD-glucopyranoside should appear around 4.0–4.5 ppm as doublet–doublet peaks (Figure 2). The assignment of the obtained compounds as α-anomeric configuration can be also confirmed by comparison of the 1H and 13C NMR spectra data of the deprotected samples derived from 2, 3-Cl, and 3-F with the literature report on α and β methyl 2-deoxy-D-glucopyranoside (Rauter et al., 2001). As illustrated in Figure 3, both 1H and 13C NMR chemical shifts as well as the H–H coupling constants of the derived sugar conjugates are well in consistent with the α-methyl 2-deoxy-D-glucopyranoside which support the stereochemical assignment. Other 1H NMR characteristics include the axial and equatorial proton of the 2-position (labeled as b in Figure 2), as well as the amino proton of the diaminocyclohexane ligand (labeled as d in Figure 2, partially deuterated by D2O), were kept almost identical in all three complexes.
Surflex docking results of the designed 2-DG conjugated platinum (II) complexes compared with 2-DG.
Compounds
Total_Score
Crash
Polar
D_SCORE
PMF_SCORE
G_SCORE
CHEMSCORE
CSCORE
Cl-2DG-Pt F-2DG-Pt H-2DG-Pt α-2-DG β-2-DG
7.23 6.83 6.13 3.10 2.36
−5.34 −5.80 −2.33 −2.33 −2.60
4.11 1.62 2.24 1.62 2.65
−206.52 −193.23 −154.56 −83.28 −87.38
−98.75 −84.36 −66.54 −23.35 −33.36
−345.81 −310.54 −210.16 −118.86 −133.80
−33.37 −24.28 −17.25 −10.12 −15.16
5 5 3 1 1
GLUT1 targeted platinum (II) complexes OAc
OAc OAc
AcO
(i)
OAc
O
Br O
O
O
O
O
O
OAc
2
(iv), (v)
H-2DG-Pt Cl-2DG-Pt
F-2DG-Pt
OAc OAc
F O
O
OAc
3-Cl
O
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
EtO
OAc
Cl
EtO EtO
OAc
OAc
H
OAc
O EtO EtO
(ii)
EtO
1
2-DG-OAc
(iii)
O
OAc
O OAc
7
O
O
OAc
3-F
Reagent and conditions: (i) BF3 .Et 2O, DCM; (ii) K2CO3, DMF; (iii) NCS or Selectf lour, NaH, DMF; (iv) NaOH, MeOH/H2O, 90 oC; (v) Ba(OH)2.8H2O, Pt(DACH)SO4, H2O, r.t.
Scheme 1.
Synthesis of the 2-DG conjugated platinum (II) complexes.
Computer-aided transportability assessment As described in the Method Section, after the MD minimization of the 2-DG-occluded GLUT1 system, 2-DG downshifted about 1.5 Å from the starting position toward the cytoplasmic side to be stabilized in a binding site which we consider that is the important 2-DG recognition pocket. Figure 4 shows both the α- and β-2-DG as
Figure 2.
1
GLUT1 substrate are binding in the same site that surrounded by the N domain TM2, 4, 5, and C domain TM7, 8, 10, 11 (in physiological condition, both α- and β-2-DG existing in an equilibrium state). Analysis of the whole simulation trajectory for the 2-DG-occluded system revealed that the conformation of the 2-DG-ligated GLUT1 reached equilibrium after 10 ns into the MD
HNMR characteristics of the synthesized 2-DG–platinum (II) conjugates.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
8
Q. Mi et al.
Figure 3.
Comparison of the 1H and
13
C NMR characteristics of the sugar-conjugated ligands with literature compounds.
Figure 4. Substrate recognition binding site of GLUT1 for 2-DG and glucose identified from molecular dynamics simulation. (A) α-2-DG and β-2-DG docked into the substrate binding pocket. (B) α-glucose and β-glucose docked into the substrate binding pocket.
simulation (Figure 5). This result indicated that this wellstabilized binding position of the 2-DG in the equilibrium conformation could be considered as the key binding site for 2-DG, which will be critical for 2-DG recognition and transportation in GLUT1. Following the same MD simulation procedure, the key substrate binding site for glucose was also identified. Consequently, results showed that the binding pocket for glucose in GLUT1 was almost identical with that of 2-DG (although with slightly different binding mode). This further emphasized that the identified binding site may play a key role in GLUT1-mediated substrate recognition and transportation. Docking results of 2-DG conjugated platinum (II) complexes As described in the Introduction Section, 2-DG has long been known and demonstrated to be a good substrate of
GLUT1 for facilitative cell uptake. Therefore, comparison of the binding mode as well as the docking scores with 2-DG in the substrate recognition site may provide meaningful information to estimate whether the 2-DGderived platinum glycoconjugates are potential substrates for the GLUT1 transporter. With the optimized GLUT1 3D model, 2-DG conjugated platinum (II) complexes were successively docked into the identified 2-DG binding site with SYBYL-X’s Surflex-Dock module of Tripos, Inc. (now Certara USA Inc., http://www.certara.com). As shown in Figure 6, the docked binding site of sugar moiety in the designed title complexes exactly overlaps with the GLUT1 substrates (2-DG and glucose). This result suggests that 2-DG conjugated platinum (II) complexes H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt are potentially GLUT1 transportable and can be recognized by GLUT1 in the same way. The binding mode of the
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
GLUT1 targeted platinum (II) complexes
9
Figure 5. (A) 2-DG-occluded GLUT1 structure extracted after MD simulation. (B) The root mean square deviation (RMSD) fluctuations of backbone atoms reached the equilibrium after 10 ns simulation of the 2-DG-occluded GLUT1 system. Structure in cyan is the starting structure and the magenta is the optimized structure. RMSD means the Cα-based root mean square deviation of the two structures.
2-DG-coupled platinum complexes illustrated in Figure 7 suggests that the 2-DG structural moiety makes the key contribution to the recognition. For H-2DG-Pt, residues N411 on TM11, and S80 on TM2 formed direct hydrogen bonding interaction with O4 and O6 of 2-DG. In Cl-2DG-Pt-bound pocket, N411 with O3 of the 2-DG moiety, W388 on TM10 with malonatocarbonyl oxygen, respectively, formed direct hydrogen bonds, and hydrogen bonding network between O6 and N411 or N415 made further contribution to the binding affinity that reflected by the highest G_SCORE and CHEMSCORE as summarized in Table 1. The fluorine-containing compound F-2DG-Pt also showed the similar binding mode
Figure 6. 2-DG conjugated platinum (II) complexes are docked into the same binding site with 2-DG and glucose in GLUT1 (cyan = β-2-DG, yellow = β-glucose, gray = H-2DG-Pt, blue = Cl-2DG-Pt, purple = F-2DG-Pt).
with Cl-2DG-Pt, and the O6 mediated hydrogen bonding network with residues on TM11 (N411, Q283, and N415) seems playing an important role for the sugar recognition. As the total score and the consensus score report the sum of the number of favorite docking results for the ligand in each scoring function, the higher Total_Score and CSCORE for the 2-DG conjugated platinum (II) complexes (Cl-2DG-Pt and F-2DG-Pt in Table 1) indicate that the predicted potency of transportability of the 2-DG glycoconjugates as GLUT1 substrate may lead to increased antitumor activity. Cytotoxicity evaluation The in vitro cytotoxicity evaluation results of the 2-DG conjugated platinum (II) complexes are summarized in Table 2. Oxaliplatin is the third generation platinumbased drug used as the primary therapy for metastatic colorectal cancer and other malignancies such as lung, breast, and ovarian cancers (Fu, Kavanagh, Hu, & Bast, 2006; Grothey, 2010; Raez, Kobina, & Santos, 2010; Stein & Arnold, 2012). The cytotoxicity of the synthesized complexes was comparable in some human cancer cell lines, and mostly better than oxaliplatin – despite a sizable increase of the water solubility. All tested cancer cells were reported to be over expressing GLUT1, especially for A549 (human lung carcinoma) (Ong et al., 2008), HT29 (human colon cancer) (Li et al., 2010), MCF7 (human breast cancer) (Medina & Owen, 2002), and DU145 (human prostate cancer) (Jadvar, 2013). As depicted in Table 2, all 2-DG conjugated complexes exhibited several fold more cytotoxic than clinical drug oxaliplatin toward these cancer cell lines. The average
10 Table 2.
Q. Mi et al. IC50 values (μM) and water solubility (mg/mL) of the titled 2-DG glycoconjugates in seven human cancer cell lines. IC50 (μM)
Solubility (mg/mL) 6.1 78.3 91.9 66.4
Cell lines
A549
SKOV3
MCF7
HT29
H460
DU145
Oxaliplatin H-2DG-Pt Cl-2DG-Pt F-2DG-Pt
2.86 ± .09 1.94 ± .23 1.03 ± .20 1.90 ± .28
14.94 ± .18 9.41 ± .23 10.10 ± .22 10.03 ± .19
1.79 ± .11 .97 ± .12 1.16 ± .14 .83 ± .10
5.83 ± .22 1.44 ± .18 .97 ± .12 1.13 ± .13
33.11 ± .26 22.22 ± .21 22.22 ± .14 10.19 ± .14
12.05 ± .19 5.00 ± .15 10.38 ± .17 2.30 ± .17
HEK293 49.46 ± 2.41 79.46 ± 4.26 102.19 ± 4.47 79.59 ± 4.58
(8) (55) (105) (70)
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
Notes: IC50 was tested with MTT assay for 72 h. All compounds are tested in the same batch and the experiments were performed tree times in five replicates. A549 (cell line for human lung carcinoma), MCF7 (human breast cancer cell line), SKOV3 (human ovarian cancer cell line), HT29 (human colon cancer cell line), H460 (human lung cancer cell line), DU145 (human prostate cancer cell line), and HEK293 (human embryonic kidney cells). Numbers in brackets are ratios of IC50 value in HEK293 against their IC50 in HT29.
Figure 7. Binding mode and direct hydrogen bonds and hydrogen bonding networks formed with 2-DG conjugated platinum (II) complexes. A: H-2DG-Pt, B: Cl-2DG-Pt, C: F-2DG-Pt.
IC50 values were also a good indicator to support the superior antitumor effect of the 2-DG conjugates as opposed to oxaliplatin. Take HT29 as an example, all three 2-DG conjugated platinum (II) complexes exhibited over 10-fold increase in water solubility, and the cytotoxicity for H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt were fourfold, sixfold, and fivefold stronger than oxaliplatin respectively. According to our GLUT1 expression analysis results that illustrated in Figure 8, among all tested cancer cells, HT29 was confirmed as one of the highest over expressing GLUT1 cell lines. The cytotoxicity results of H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt against HT29 demonstrated the perfect correlation between the antitumor effects and GLUT1 expression level. This is also consistent with the results of GLUT1-mediated molecular docking assessment. To further confirm the transporter dependency of cytotoxicity of the obtained sugar conjugates, we conducted the cell-killing test of the platinum complexes toward the human embryonic kidney cells (HEK293) which are well-known cell lines with very low endogenous transporter expression. As
shown in Table 2, all 2-DG conjugated platinum (II) complexes exhibited decreased cell-killing potency in cytotoxicities by 50–100 fold compared to the GLUT1 over express HT29 cancer cell lines. The positive corre-
Figure 8. Gene expression analysis of GLUT1 over expressing cell lines with qPCR measurement. RQ (relative quantity) shows the relative fold differences between the tested cell lines.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
GLUT1 targeted platinum (II) complexes lation between GLUT1 expression and the cytotoxicity in HT29 and HEK293 cell lines indicating the GLUT1mediated uptake is playing important role for the 2-DG conjugated platinum (II) complexes. Theoretically, the more hydrophilic molecules, the more difficult it is to cross the cell membrane without the aid of transport proteins. With this primary result, and the combining of molecular docking observations, we believe that the 2-DG conjugated platinum (II) complexes can be very promising lead compounds to be further investigated for GLUT1-mediated targeted therapy anticancer agents. The more detailed uptake mechanism studies for these molecules – the inductively coupled plasma (ICP) analysis, and in vivo tumor accumulation study – are now undergoing.
Conclusion To leverage the Warburg effect, we designed and synthesized novel 2-deoxyglucose conjugated platinum (II) complexes for GLUT1-mediated tumor targeting. The structure-based molecular docking analysis utilizing the GLUT1 crystal model allowed us to speculate on potential transportability of the designed 2-DG conjugates. In vitro cytotoxicity evaluation demonstrated that the 2-DG conjugated platinum (II) complexes exhibit improved cytotoxicities compared to the clinical drug oxaliplatin. The antitumor effects of the designed 2-DG-platinum (II) conjugates are demonstrated to be GLUT1-dependent in certain cell lines like HT29 which highly over expresses glucose transporters. This proof-of-concept study revealed that the 2-DG as platinum (II) glycoconjugate motif is suitable for GLUT1-mediated drug delivery and selective tumor targeting. The data and results from this research further support the potential of the obtained platinum (II) complexes as lead compounds for more preclinical studies.
Abbreviations 2-DG 2-Deoxyglucose GLUT Glucose transporter 18 F-FDG 2-Deoxy-2-(18F) fluoro-D-glucose PDB Protein Data Bank RMSD Root mean square deviation RT-PCR Real-time reverse transcription polymerase chain reaction Oxaliplatin (1R,2R-Diaminocyclohexane) oxalatoplatinum(II) 2-DG-OAc 1,3,4,6-Tetra-O-acetyl-2-deoxy-Dglucopyranose H-2DG-Pt Trans-R, R-cyclohexane-1, 2-diaminemalonatoplatinum(II)-2-deoxy-Dglucopyranose conjugate
Cl-2DG-Pt
F-2DG-Pt
IC50 MTT
11
Trans-R, R-cyclohexane-1, 2-diamine-2chloromalonatoplatinum(II)-2-deoxy-Dglucopyranose conjugate Trans-R, R-cyclohexane-1, 2-diamine-2fluoromalonatoplatinum(II)-2-deoxy-Dglucopyranose conjugate Inhibitory concentration at 50% inhibition 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide
Disclosure statement No potential conflict of interest was reported by the authors.
Funding This work was supported by Grants from the Tianjin Municipal Applied Basic and Key Research Scheme of China (11JCYBJC14400, 12ZCDZSY11500, 13JCZD27500), and by the Project of National Basic Research (973) Program of China (2015CB856500).
References Ben-Haim, S., & Ell, P. (2009). 18F-FDG PET and PET/CT in the evaluation of cancer treatment response. Journal of Nuclear Medicine, 50, 88–99. Boado, R. J., Black, K. L., & Pardridge, W. M. (1994). Gene expression of GLUT3 and GLUT1 glucose transporters in human brain tumors. Molecular Brain Research, 27, 51–57. Cheatham, T. E., Miller, J. L., Fox, T., Darden, T. A., & Kollman, P. A. (1995). Molecular dynamics simulations on solvated biomolecular systems: The particle mesh Ewald method leads to stable trajectories of DNA, RNA, and proteins. Journal of the American Chemical Society, 117, 4193–4194. Cunningham, P., Afzal-Ahmed, I., & Naftalin, R. J. (2006). Docking studies show that D-glucose and quercetin slide through the transporter Glut1. Journal of Biological Chemistry, 281, 5797–5803. Deng, D., Xu, C., Sun, P., Wu, J., Yan, C., Hu, M., & Yan, N. (2014). Crystal structure of the human glucose transporter GLUT1. Nature, 510, 121–125. Eslami Moghadam, M., Saidifar, M., Divsalar, A., MansouriTorshizi, H., Saboury, A. A., Farhangian, H., & Ghadamgahi, M. (2015). Rich spectroscopic and molecular dynamic studies on the interaction of cytotoxic Pt(II) and Pd(II) complexes of glycine derivatives with calf thymus DNA. Journal of Biomolecular Structure & Dynamics, 20, 1–17. Fu, S., Kavanagh, J. J., Hu, W., & Bast, R. C., Jr. (2006). Clinical application of oxaliplatin in epithelial ovarian cancer. International Journal of Gynecological Cancer, 16, 1717– 1732. Godoy, A., Ulloa, V., & Rodríguez, F. (2006). Differential subcellular distribution of glucose transporters GLUT1–6 and GLUT9 in human cancer: Ultrastructural localization of GLUT1 and GLUT5 in breast tumor tissues. Journal of Cellular Physiology, 207, 614–627. Grothey, A. (2010). Reintroduction of oxaliplatin: A viable approach to the long-term management of metastatic colorectal cancer. Oncology, 79, 389–399.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
12
Q. Mi et al.
Haber, R. S., Rathan, A., & Weiser, K. R. (1998). GLUT1 glucose transporter expression in colorectal carcinoma. Cancer, 83, 34–40. Holyoake, J., Caulfeild, V., Baldwin, S. A., & Sansom, M. S. (2006). Modeling, docking, and simulation of the major facilitator superfamily. Biophysical Journal, 91, L84–L86. Humphrey, W., Dalke, A., & Schulten, K. (1996). VMD: Visual molecular dynamics. Journal of Molecular Graphics, 14, 33–38. Jadvar, H. (2013). Imaging evaluation of prostate cancer with 18 F-fluorodeoxyglucose PET/CT: Utility and limitations. European Journal of Nuclear Medicine and Molecular Imaging, 40, 5–10. Kapoor, R., Spence, A. M., Muzi, M., Graham, M. M., Abbott, G. L., & Krohn, K. A. (1989). Determination of the deoxyglucose and glucose phosphorylation ratio and the lumped constant in rat brain and a transplantable rat glioma. Journal of Neurochemistry, 53, 37–44. Kostova, I. (2006). Platinum complexes as anticancer agents. Recent Patents on Anti-Cancer Drug Discovery, 1, 1–22. Kunkel, M., Reichert, T. E., & Benz, P. (2003). Overexpression of Glut-1 and increased glucose metabolism in tumors are associated with a poor prognosis in patients with oral squamous cell carcinoma. Cancer, 97, 1015–1024. Kurata, T., Oguri, T., Isobe, T., Ishioka, S. I., & Yamakido, M. (1999). Differential expression of facilitative glucose transporter (GLUT) genes in primary lung cancers and their liver metastases. Japanese Journal of Cancer Research, 90, 1238–1243. Li, X. F., Ma, Y., Sun, X., Humm, J. L., Ling, C. C., & O’Donoghue, J. A. (2010). High 18F-FDG uptake in microscopic peritoneal tumors requires physiologic hypoxia. Journal of Nuclear Medicine, 51, 632–638. Liu, P., Lu, Y., Gao, X., Liu, R., Zhang-Negrerie, D., Shi, Y., … Gao, Q. (2013). Highly water-soluble platinum (II) complexes as GLUT substrates for targeted therapy: Improved anticancer efficacy and transporter-mediated cytotoxic properties. Chemical Communications, 49, 2421–2423. Liu, T., Zhang, J., Wang, X., Yang, J., Tang, Z., & Lu, J. (2014). Radiolabeled glucose derivatives for tumor imaging using SPECT and PET. Current Medicinal Chemistry, 21, 24–34. Lu, Y., Gao, X., Wu, M., Zhang-Negrerie, D., & Gao, Q. (2011). Strategies on the development of small molecule anticancer drugs for targeted therapy. Mini-Reviews in Medicinal Chemistry, 11, 611–624. Medina, R. A., & Owen, G. I. (2002). Glucose transporters: Expression, regulation and cancer. Biological Research, 35, 9–26. Mueckler, M., & Makepeace, C. (1997). Identification of an amino acid residue that lies between the exofacial vestibule and exofacial substrate-binding site of the Glut1 sugar permeation pathway. Journal of Biological Chemistry, 272, 30141–30146. Negureanu, L., & Salsbury, F. R., Jr. (2014). Non-specificity and synergy at the binding site of the carboplatin-induced DNA adduct via molecular dynamics simulations of the
MutSα-DNA recognition complex. Journal of Biomolecular Structure & Dynamics, 32, 969–992. Ong, L. C., Jin, Y., Song, I. C., Yu, S., Zhang, K., & Ong, L.-C. (2008). 2-[18F]-2-deoxy-D-glucose (FDG) uptake in human tumor cells is related to the expression of GLUT-1 and hexokinase II. Acta Radiologica, 49, 1145– 1153. Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., … Schulten, K. (2005). Scalable molecular dynamics with NAMD. Journal of Computational Chemistry, 26, 1781–1802. Plathow, C., & Weber, W. A. (2008). Tumor cell metabolism imaging. Journal of Nuclear Medicine, 49, 43S–63S. Raez, L. E., Kobina, S., & Santos, E. S. (2010). Oxaliplatin in first-line therapy for advanced non-small-cell lung cancer. Clinical Lung Cancer, 11, 18–24. Rauter, A. P., Figueiredo, J., Ismael, M., Canda, T., Font, J., & Figueredo, M. (2001). Efficient synthesis of α, β-unsaturated γ-lactones linked to sugars. Tetrahedron: Asymmetry, 12, 1131–1146. Ryckaert, J. P., Ciccotti, G., & Berendsen, H. C. (1977). Numerical integration of the cartesian equations of motion of a system with constraints: Molecular dynamics of nalkanes. Journal of Computational Physics, 23, 327–341. Salas-Burgos, A., Iserovich, P., Zuniga, F., Vera, J. C., & Fischbarg, J. (2004). Predicting the three-dimensional structure of the human facilitative glucose transporter Glut1 by a novel evolutionary homology strategy: Insights on the molecular mechanism of substrate migration, and binding sites for glucose and inhibitory molecules. Biophysical Journal, 87, 2990–2999. Schechter, N. R., Erwin, W. D., Yang, D., Kim, E. E., Munden, R. F., Forster, K., … Podoloff, D. A. (2009). Radiation dosimetry and biodistribution of 99mTc-ethylene dicysteinedeoxyglucose in patients with non-small-cell lung cancer. European Journal of Nuclear Medicine and Molecular Imaging, 36, 1583–1591. Stein, A., & Arnold, D. (2012). Oxaliplatin: A review of approved uses. Expert Opinion on Pharmacotherapy, 13, 125–137. Warburg, O., Wind, F., & Negelein, E. (1927). The metabolism of tumors in the body. The Journal of General Physiology, 8, 519–530. Younes, M., Brown, R. W., Stephenson, M., Gondo, M., & Cagle, P. T. (1997). Overexpression of glut1 and glut3 in stage I nonsmall cell lung carcinoma is associated with poor survival. Cancer, 80, 1046–1051. Zhang, G., Fang, L.-Y., Zhu, L.-Z., Aimiuwu, J. E., Shen, J., Cheng, H., … Wang, P. G. (2005). Syntheses and biological activities of disaccharide daunorubicins. Journal of Medicinal Chemistry, 48, 5269–5278. Zhang, M., Zhang, Z., Blessington, D., Li, H., Busch, T. M., Madrak, V., … Zheng, G. (2003). Pyropheophorbide 2-deoxyglucosamide: A new photosensitizer targeting glucose transporters. Bioconjugate Chemistry, 14, 709–714.
ISSN: 0739-1102 (Print) 1538-0254 (Online) Journal homepage: http://www.tandfonline.com/loi/tbsd20
2-Deoxyglucose conjugated platinum (II) complexes for targeted therapy: design, synthesis, and antitumor activity Qian Mi, Yuru Ma, Xiangqian Gao, Ran Liu, Pengxing Liu, Yi Mi, Xuegang Fu & Qingzhi Gao To cite this article: Qian Mi, Yuru Ma, Xiangqian Gao, Ran Liu, Pengxing Liu, Yi Mi, Xuegang Fu & Qingzhi Gao (2015): 2-Deoxyglucose conjugated platinum (II) complexes for targeted therapy: design, synthesis, and antitumor activity, Journal of Biomolecular Structure and Dynamics, DOI: 10.1080/07391102.2015.1114972 To link to this article: http://dx.doi.org/10.1080/07391102.2015.1114972
Accepted author version posted online: 02 Nov 2015. Published online: 30 Nov 2015. Submit your article to this journal
Article views: 15
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbsd20 Download by: [University of Sussex Library]
Date: 06 December 2015, At: 04:57
Journal of Biomolecular Structure and Dynamics, 2015 http://dx.doi.org/10.1080/07391102.2015.1114972
2-Deoxyglucose conjugated platinum (II) complexes for targeted therapy: design, synthesis, and antitumor activity Qian Mia, Yuru Maa, Xiangqian Gaoa, Ran Liua, Pengxing Liua, Yi Mib, Xuegang Fua and Qingzhi Gaoa* a
Tianjin Key Laboratory for Modern Drug Delivery & High-Efficiency, Collaborative Innovation Center of Chemical Science and Engineering, School of Pharmaceutical Science and Technology, Tianjin University, 92 Weijin Road, Nankai District, Tianjin 300072, P.R. China; bCentral Institute of Pharmaceutical Research, CSPC Pharmaceutical Group, 226 Huanghe Road, Shijiazhuang, Hebei 050035, P.R. China
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
Communicated by Ramaswamy H. Sarma (Received 15 August 2015; accepted 27 October 2015) Malignant neoplasms exhibit an elevated rate of glycolysis over normal cells. To target the Warburg effect, we designed a new series of 2-deoxyglucose (2-DG) conjugated platinum (II) complexes for glucose transporter 1 (GLUT1)-mediated anticancer drug delivery. The potential GLUT1 transportability of the complexes was investigated through a comparative molecular docking analysis utilizing the latest GLUT1 protein crystal structure. The key binding site for 2-DG as GLUT1’s substrate was identified with molecular dynamics simulation, and the docking study demonstrated that the 2-DG conjugated platinum (II) complexes can be recognized by the same binding site as potential GLUT1 substrate. The conjugates were synthesized and evaluated for in vitro cytotoxicity study with seven human cancer cell lines. The results of this study revealed that 2-DG conjugated platinum (II) complexes are GLUT1 transportable substrates and exhibit improved cytotoxicities in cancer cell lines that over express GLUT1 when compared to the clinical drug, Oxaliplatin. The correlation between GLUT1 expression and antitumor effects are also confirmed. The study provides fundamental information supporting the potential of the 2-DG conjugated platinum (II) complexes as lead compounds for further pharmaceutical R&D. Keywords: 2-Deoxyglucose conjugated platinum (II) complex; tumor targeting; molecular dynamics; glucose transporter; anticancer agent
Introduction Since the German scientist Otto Warburg discovered the phenomenon that cancerous tissues exhibit increased glucose uptake and aerobic glycolisys (Warburg, Wind, & Negelein, 1927), targeting the Warburg effect by glycoconjugation as tumor-targeting strategy has garnered a great deal of interest in targeted therapy research. Later studies revealed that glycolytic enzymes, as well as some members of major facilitator superfamily (MFS) such as glucose transporter GLUT1, GLUT3, and GLUT5, are widely overexpressed in human cancer cells (Boado, Black, & Pardridge, 1994; Godoy, Ulloa, & Rodríguez, 2006; Kurata, Oguri, Isobe, Ishioka, & Yamakido, 1999; Younes, Brown, Stephenson, Gondo, & Cagle, 1997). Furthermore, high expression of these proteins are positively correlated with poor cancer prognosis and survival (Haber, Rathan, & Weiser, 1998; Kunkel, Reichert, & Benz, 2003). GLUT1 is the first transmembrane glucose transporter isoform to be purified, and it is the most extensively studied among all MFS proteins due to the fact that it is associated with the energy supply of cancer cell, thus an important prognostic indicator for tumor *Corresponding author. Email: [email protected] © 2015 Taylor & Francis
genesis (Liu et al., 2014; Schechter et al., 2009; Zhang et al., 2003). Based on these scientific achievements, the 2-deoxy2-(18F) fluoro-D-glucose (18F-FDG) PET imaging system has been successfully developed for clinical cancer diagnosis and staging (Ben-Haim & Ell, 2009; Plathow & Weber, 2008). Although the glycoconjugation strategy for tumor targeting has been actively conducted by medicinal chemists, the structure-based computational approach was not frequently adopted by scientists due to the lack of satisfied structure template for homology modeling and experimentally reliable GLUT1 model (Cunningham, Afzal-Ahmed, & Naftalin, 2006; Holyoake, Caulfeild, Baldwin, & Sansom, 2006; SalasBurgos, Iserovich, Zuniga, Vera, & Fischbarg, 2004). In 2014, the great effort from Yan’s group achieved the first success in GLUT1 crystallization (PDB ID: 4PYP) (Deng et al., 2014). According to the latest achievement from the structural biology research, we are now able to, from the aspects of CADD approach, perform more precise structure-based molecular design and lead generation.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
2
Q. Mi et al.
Platinum (II) complexes as anticancer drugs are efficiently used in the clinics worldwide. Over the past few decades, despite the synthetization and evaluation of thousands of platinum complexes for their activities and potencies (Eslami Moghadam et al., 2015; Kostova, 2006; Lu, Gao, Wu, Zhang-Negrerie, & Gao, 2011; Negureanu & Salsbury, 2014), there are still multiple obstacles and challenges that need to be overcome on the road to success. One of the most notable of the aforementioned barriers is the lack of tumor selectivity and low water solubility of the platinum-containing complexes, as they may contribute to major organ toxicity by metal accumulation. To fulfill these aims of developing a safe but effective generation of platinum-based anticancer agent, we consider that tumor-specific glucose transporter – GLUT1-targeted glycoconjugate would possess promising features with desirable profiles for platinum-based drug design. In 2013, we reported the first example for glucoseconjugated (trans-R,R-cyclohenxane-1,2-diamine)-malonatoplatinum(II) complexes with extremely high water solubility, comparable or more potent anticancer activity (Liu et al., 2013). Biological studies demonstrated that the glucose analog, 2-deoxyglucose (2-DG), has three times larger Michaelis constant toward hexokinase compared to glucose (Kapoor et al., 1989). GLUT1-mediated sugar transport investigation in oocyte system also demonstrated that 2-DG exhibits much higher uptake than D- and L-glucose and with higher GLUT1-binding affinity (Mueckler & Makepeace, 1997). By taking the advantage of 2-DG as a more specific GLUT1 substrate, and combined with the newest available GLUT1 protein model, in this project we performed for the first time, the design of a new series of 2-DG conjugated platinum (II) complexes, the GLUT1 crystal structure-based docking study for the designed platinum (II) conjugates report herein as the initial example for lead generation study of 2-DG conjugated platinum (II) anticancer agent.
Figure 1.
Materials and methods Glucose transporter-targeted conjugate design For the design concept, we take the advantage of the third generation platinum drug oxaliplatin by retaining the diaminocyclohexane chelating ligand, which plays an important role in circumventing cross-resistence between cisplatin/carboplatin and oxaliplatin. The 2-DG moiety was attached to the 2-position of the malonate structure and it was expected to act as both the solubility increasing auxiliary and transporter recognition group that potentially possess the key characteristics for GLUT1 targeting (Figure 1). Computational transportability assessment with GLUT1 Molecular dynamics (MD) simulation study for protein minimization and binding pocket identification of 2-DG were performed using AutoDock 4.0 software. To assess the potential binding affinity of the designed 2-DG conjugated platinum (II) complexes, molecular docking analysis of the designed 2-DG conjugates was performed and compared with 2-DG itself using SYBYL-X 2.0 with Surflex-Dock algorithm running on a Linux workstation. Protein source We adopted the latest crystal structure of the human GLUT1 (PDB ID: 4PYP), which was bound with n-nonyl-β-D-glucopyranoside (β-NG) from RCSB Protein Data Bank at http://www.rcsb.org/pdb/ (Deng et al., 2014). Ligand positioning To determine the 2-DG binding site in GLUT1 by MD simulation, the ligand of n-nonyl-β-D-glucopyranoside was replaced by 2-DG according to the hexose function
Design concept of platinum (II)–sugar conjugates and the structures of 2-DG conjugated platinum (II) complexes.
GLUT1 targeted platinum (II) complexes moiety of the ligand in 4PYP complex. 2-DG conjugated platinum (II) complexes were docked into the identified binding site of 2-DG for Surflex docking analysis. To assure geometric accuracy of the platinum–cyclohexanediamine chelating complex, geometric constraint between the platinum metal and the diamino ligand was applied based on the crystal structure which we have obtained for glucose-conjugated platinum complex (Liu et al., 2013).
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
MD simulation Minimization of the protein structure with replaced 2-DG (2-DG-occluded GLUT1) and binding site identification for 2-DG were performed by MD simulation. To mimic the physiological environment for the GLUT1 transporter, the protein was put in the center of a 1-palmitoyl-2-oleylhosphatidylcholine (POPC) lipid bilayer which was comprised of about 209 POPC molecules. Subsequently, these systems of protein membrane were solvated in a water cubic box (solvation layer of ~10 Å thicknesses with the periodic box size ~120 Å × 120 Å × 100 Å), and were added 17 chloride ions to preserve the electric neutrality using VMD v1.91 (Humphrey, Dalke, & Schulten, 1996). A 20-ns long MD simulation was performed on the solvated initial systems with the CHARMM27 force field after 25,000 steps of minimization using the NAMD 2.9 package (Phillips et al., 2005). The long-range electrostatic forces were controlled by the smooth particle–mesh Ewald method (Cheatham, Miller, Fox, Darden, & Kollman, 1995). The non-bonded cut-off was set to 12 Å. The bonds formed by hydrogen atoms were constrained by the SHAKE algorithm (Ryckaert, Ciccotti, & Berendsen, 1977). The systems were heated from 0 to 310 K. Efficient pressure control was achieved by applying the Langevin piston method, with the target pressure set to 1 atm. The integration time step was set to 2 fs. VMD v1.91 was used for trajectory analysis. Surflex docking The file of the docking ligands is prepared by SYBYL-X 2.0 embedded module (SYBYL-X software 2015). To define an appropriate receptor in the simulation, all water molecules were removed from the protein structure. 2-DG ligand (after MD simulation) was extracted to generate protomol subsequently. All hydrogen atoms were added randomly, and side chains were fixed during the protein preparation. The structure was then subjected to an energy refinement procedure. Gasteiger–Marsili charges and AMBER7 FF99 charges were loaded for the 2-DG conjugated platinum (II) complexes and protein, respectively. The docking mode was set to Surflex-Dock (GEMO). The binding property of 2-DG conjugated
3
platinum (II) complexes was then estimated using different scoring functions. Chemistry and biology Oxaliplatin, trans-R, R-cyclohexane-1, 2-diamine, K2PtCl4 were purchased from Sigma-Aldrich. Platinum (II) glycoconjugates were synthesized according to the method described below. HPLC analyses were conducted using CXTH-LC3000 analytical and semi-preparative gradient HPLC system with DaisoGel C18 (4.6 × 250 mm, 5 μm) and DaisoGel C18 (20 × 250 mm, 10 μm) column, respectively, at room temperature. The mobile phase consisted by MeOH and H2O was used and the flow rate of 1 mL/min for analytical and 10 mL/min for preparative purification were used. 1H NMR spectra was carried out on a Bruker Avance 400 MHz spectrometer. High-resolution mass spectra were recorded on a Bruker MicroTOF spectrometer. Thiazolyl blue tetrazolium bromide (MTT) reagent and Dulbecco’s phosphate-buffered saline from SigmaAldrich were used for cytotoxicity evaluation. All other chemicals obtained from commercial suppliers were used as received and were of analytical grade. Stock solutions of platinum (II) complexes and oxaliplatin for cytotoxicity studies were prepared in deionized water at room temperature just before use. Oxaliplatin stock solution was prepared under ultrasonication at room temperature for 15 min and all further dilution to designated concentrations was made using deionized water. Cell lines and cell cultures HT29 (human colon cancer cell line), MCF7 (human breast cancer cell line), A549 (cell line of human lung carcinoma), H460 (human lung cancer cell line), SKOV3 (human ovarian cancer cell line), and DU145 (human prostate cancer cell line) were obtained from Central Institute of Pharmaceutical Research, CSPC Pharmaceutical Group, China. MCF7 was cultured in DMEM (Gibco), and HT29, H460, SKOV3, and DU145 on monolayer using RPMI 1640 (Invitrogen) supplemented with 10% fetal bovine serum, 2 mm glutamine, and .25 units/ml insulin and in an incubator (37 °C) continuously gassed with 5% CO2. Cells were subcultured using .0625% trypsin in HBSS to maintain cells in the exponential growth phase. Cytotoxicity evaluation MTT assay： Cells were seeded in a 96-well flatbottomed microplate at 2000–7500 cells/well in 100 μL of growth medium solution (10% fetal calf serum and penicillin–streptomycin in RPMI-1640 medium (Invitrogen) on day 0. On day 1, cells were treated either with
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
4
Q. Mi et al.
vehicle or the complexes (Oxaliplatin, 2-DG-derived Pt (II) complexes were dissolved in deionized water and mixed with the growth medium; samples for 2-DG conjugated platinum (II) complexes were prepared with deionized water. Platinum-based serial dilution was made and added to each well). The microplate was incubated at 37 °C, 5% CO2, 95% air in a humidified incubator for 72 h. MTT (Sigma-Aldrich) was added to each well at the final concentration of .83 mg/mL and incubated for 3 h. Cells were lysed by MTT lysis buffer (15% SDS, .015 M HCl) and uptake of MTT was measured at 570 nm absorbance using a multiwell-reading UV–vis spectrometer. For each complex, cell surviving rates are expressed as the relative percentage of absorbance compared to controls without drug. The IC50 values of each test sample (concentration required to reduce the absorbance by 50% compared to the controls) were determined by the dose dependence of surviving cells after exposure to the test sample for 72 h. Experimental conditions were performed in five replicates (5 wells of the 96-well plate per experimental condition). Cellular RNA isolation and real-time RT-PCR Total cellular RNA was isolated immediately from cultured cancer cells using Trizol Reagent (Gibco BRL, Gaithersburg, MD), according to the manufacturer’s instructions. Two micrograms of total RNA were reverse transcribed using the superscript III first-stand synthesis system for RT-PCR kit (Invitrogen). Real-time RT-PCR was performed using a SYBR green dye I (Applied Biosystems, Foster City, CA) with the ABI 7900 Sequence Detection System (PE Applied Biosystems). cDNA was first denatured at 95 °C for 2 min and then amplified through 40 amplification cycles, according to the manufacturer’s protocol as follows: denatured at 95 °C for 15 s, and annealed/extended at 60 °C for 60 s. Fluorescence signals were recorded in each cycle. Relative quantitation of gene expression was carried out using the standard curve method and analyzed with RQ-manager 1.2 (ABI 7900 Sequence Detection System, Applied Biosystems). Samples were run as triplicates in separate tubes to permit quantification of the target gene normalized to GAPDH used for equal loading. Sequences of human GLUT-1 primers used are forward primer, GGCCAAGAGTGTGCTAAAGAA; reverse primer, ACAGCGTTGATGCCAGACAG. The specificity of the PCR products was confirmed on a 2.0% agarose gel by showing a specific single band with the expected size. Preparation of 2-deoxy-3,4,6-tri-O-acetyl-β-bromoethylD-glucopyranoside (1) 1,3,4,6-Tetra-O-acetyl-2-deoxy-D-glucopyranose (2-DGOAc) was prepared according to the literature method
(Zhang et al., 2005). To an ice-cooled solution of 2-DGOAc (4 mmol, 1.3 g) and 2-bromoethanol (4.8 mmol, 340 μL) in dry DCM (16 mL) was added BF3·Et2O (600 μL) and stirred for 1 h. Then, the reaction mixture was poured into ice water (15 mL), and 30 mL of DCM was added to extract the product. The organic phase was washed successively with sat. NaHCO3 (15 mL), water (15 mL), and brine (15 mL). Then, it was dried over Na2SO4 and evaporated to dryness. The resulting crude product was subjected to column chromatography on silica gel (PE/EtOAc = 5:1) to give compound 1 as a colorless oil. Yield: 90%. 1H NMR (400 MHz, CDCl3): 5.28– 5.35 (m, 1H), 4.97–5.02 (m, 2H), 4.24–4.31 (m, 1H), 4.06–4.11 (m, 2H), 3.91–3.97 (m, 1H), 3.78–3.84 (m, 1H), 3.50 (t, J = 6.0 Hz, 2H), 2.29 (dd, J1 = 13.0 Hz, J2 = 5.3 Hz, 1H), 2.09 (s, 3H), 2.05 (s, 3H), 2.01 (s, 3H), 1.80–1.87 (m, 1H). 13C NMR (100 MHz, CDCl3): 170.52, 170.00, 169.79, 97.11, 69.14, 68.79, 68.20, 67.85, 62.23, 34.77, 30.17, 20.87, 20.67, 20.65. IR (KBr): 3457.38, 2943.26, 1745.14, 1642.07, 1434.35, 1368.43, 1230.99, 1130.50, 1048.97, 978.03. HRMS: Calcd. for C14H21BrO8 (M+): 397.0493, found: 397.0495. Preparation of diethylmalonate 2-deoxy-3,4,6-tri-Oacetyl-D-glucopyranose conjugate (2) To a mixture of 1 (3.0 mmol, 1.43 g) and diethyl malonate (6 mmol, .96 g) in dry DMF (18 mL) was added K2CO3 (12 mmol, 1.7 g) and stirred overnight. Then, 100 mL of ethyl acetate was added and washed with sat.NH4Cl (100 mL), water (100 mL), and brine (100 mL), dried over Na2SO4, and evaporated to dryness. The obtained crude product was purified by silica gel column chromatography (PE/EtOAc: 3/1) to give 2a as a colorless oil. Yield: 91%. 1H NMR (400 MHz, CDCl3): 5.21–5.28 (m, 1H), 4.98 (t, J = 9.8 Hz, 1H), 4.90 (d, J = 3.2 Hz, 1H), 4.14–4.32 (m, 5H), 3.92–4.04 (m, 2H), 3.68–3.74 (m, 1H), 3.52 (t, J = 7.3 Hz, 1H), 3.39–3.49 (m, 1H), 2.16–2.24 (m, 3H), 2.08 (s, 3H), 2.03 (s, 3H), 2.00 (s, 3H), 1.76–1.83 (m, 1H), 1.27 (t, J = 7.1 Hz, 6H). 13C NMR (100 MHz, CDCl3): 170.40, 169.85, 169.63, 168.94, 168.88, 96.85, 69.08, 68.86, 67.75, 64.83, 62.11, 61.28, 61.26, 49.06, 34.68, 28.28, 20.72, 20.50, 13.89, 13.88. IR (KBr): 3467.88, 2982.11, 1747.07, 1445.66, 1369.66, 1233.80, 1155.66, 1135.68, 1049.80, 602.47. HRMS: Calcd. for C21H32O12 (M+): 477.1967, found: 477.1970. Preparation of diethyl-2-chloromalonate-2-deoxy-3,4,6tri-O-acetyl-D-glucopyranose conjugate (3-Cl) To a solution of 2 (1.2 mmol, 552 mg) in dry toluene (10 mL) was added NaH (56 mg, 60% suspension in mineral oil) slowly and stirred for 30 min, then NCS
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
GLUT1 targeted platinum (II) complexes (1.4 mmol, 186 mg) was added slowly and stirred overnight. Ethyl acetate (50 mL) was added and washed with sat. NH4Cl (50 mL), water (50 mL), and brine (50 ml), dried over Na2SO4, and evaporated to dryness. The obtained crude product was purified by silica gel column chromatography (PE/EtOAc: 3/1) to give 3-Cl as a colorless oil. Yield: 81%. 1H NMR (400 MHz, CDCl3): 5.12– 5.19 (m, 1H), 4.50 (t, J = 9.9 Hz, 1H), 4.88 (d, J = 3.3 Hz, 1H), 4.25–4.39 (m, 5H), 3.94–4.08 (m, 3H), 3.56–3.62 (m, 1H), 2.55–2.67 (m, 2H), 2.21 (dd, J1 = 13.0 Hz, J2 = 5.2 Hz, 1H), 2.09 (s, 3H), 2.06 (s, 3H), 2.01 (s, 3H), 1.73–1.80 (m, 1H), 1.28–1.33 (m, 6H). 13C NMR (100 MHz, CDCl3): 170.55, 169.95, 169.81, 166.41, 166.34, 97.16, 69.01, 68.99, 67.90, 63.01, 62.95, 62.54, 62.23, 36.42, 34.52, 20.83, 20.66, 20.63, 13.81, 13.78. IR (KBr): 3468.99, 2983.04, 1745.81, 1446.00, 1368.68, 1233.27, 1132.40, 1006.03, 942.61. HRMS: Calcd. for C21H31ClO12 (M+): 511.1577, found: 511.1579. Preparation of diethyl-2-fluoromalonate-2-deoxy-3,4,6tri-O-acetyl-D-glucopyranose conjugate (3-F) To a solution of 2 (1.3 mmol, 620 mg) in dry DMF (10 mL) was added NaH (63 mg, 60% suspension in mineral oil) slowly and stirred for 30 min, then selectfluor (1.6 mmol, 552 mg) was added slowly and stirred overnight. Ethyl acetate (50 mL) was added and washed with sat. NH4Cl (50 mL), water (50 mL), and brine (50 mL), dried over Na2SO4, and evaporated to dryness. The obtained crude product was purified by silica gel column chromatography (PE/EtOAc: 3/1) to give 3-F as a colorless oil. Yield: 93%. 1H NMR (400 MHz, CDCl3): 5.12–5.19 (m, 1H), 4.98 (t, J = 9.7 Hz, 1H), 4.88 (d, J = 3.2 Hz, 1H), 4.26–4.37 (m, 5H), 3.95–4.05 (m, 2H), 3.82–3.86 (m, 1H), 3.49–3.54 (m, 1H), 2.47– 2.56 (m, 2H), 2.20 (dd, J1 = 13.0 Hz, J2 = 5.3 Hz, 1H), 2.07 (s, 3H), 2.04 (s, 3H), 1.99 (s, 3H), 1.72–1.79 (m, 1H), 1.28–1.32 (m, 6H). 13C NMR (100 MHz, CDCl3): 170.52, 169.91, 169.75, 166.05 (d, J = 10.5 Hz), 165.77 (d, J = 10.5 Hz), 97.00, 93.06, 91.10, 68.92, 68.90, 67.85, 62.56, 62.52, 62.16, 34.50, 33.50 (d, J = 20.9 Hz), 20.77, 20.59, 20.57, 13.83. IR (KBr): 2983.67, 1747.94, 1446.44, 1369.66, 1305.96, 1233.22, 1130.10, 1050.24, 1012.66, 859.72. HRMS: Calcd. for C21H31FO12 (M+): 495.1872, found: 495.1875. Preparation of (trans-R, R-cyclohexane-1, 2diamine)malonatoplatinum(II)-2-deoxy-D-glucopyranose conjugate (H-2DG-Pt) Compound 2 (1.3 mmol, 617 mg) was dissolved in MeOH (1.5 mL) at room temperature. A solution of NaOH (9.7 mmol, 390 mg) in water (3.0 mL) was then added
5
and stirred at 90 °C for 1 h. After completion of the reaction, the mixture was passed through a short column of DOWEX 88 strong acid cation resin. The desired product was then obtained after prep-HPLC purification (5% MeOH-99% H2O + .1% HCOOH) and lyophilization. Finally, the product was directly used for the next step. To a solution of the above product (.5 mmol, 160 mg) in water (3 mL) under an argon atmosphere was slowly added a saturated Ba(OH)2·8H2O aqueous solution until pH = 7.0. The mixture was stirred for 30 min at room temperature. [trans-R, R-cyclohexane-1, 2-diamine]PtSO4 (.6 mmol, 241 mg) in water (1.5 mL) was then added and stirred in the dark for 2 h. The precipitate was filtered and the filtrate was subjected to prepHPLC (15%MeOH-95% H2O) and then lyophilized to afford Pt(II) complex H-2DG-Pt as a white solid. Yield: 31%, over two steps. 1H NMR (400 MHz, D2O): δ 4.92 (d, J = 2.7 Hz, 1H), 4.22 (t, J = 7.0 Hz, 1H), 3.82–3.93 (m, 1H), 3.55–3.74 (m, 4H), 3.47–3.52 (m, 1H), 3.31 (t, J = 9.4 Hz, 1H), 2.29–2.35 (m, 4H), 2.06 (dd, J1 = 13.3 Hz, J2 = 5.0 Hz, 1H), 1.92 (br, 2H), 1.58–1.66 (m, 1H), 1.46 (d, J = 9.5 Hz, 2H), .90–1.50 (m, 4H). 13C NMR (100 MHz, D2O): 179.34, 179.01, 96.90, 72.37, 70.82, 68.36, 64.30, 62.41, 60.53, 54.52, 36.68, 31.73, 31.63, 28.51, 23.86, 23.81. IR (KBr): 3422, 3209, 3091, 2939, 1626, 1389, 1344, 1127, 1097, 1065, 1033, 976. HRMS: Calcd. for C17H30N2O9Pt (M+): 602.1677 (100.0%), 601.1656 (97.4%), 603.1679 (74.6%), found: 602.1679, 601.1658, 603.1681. Preparation of (trans-R, R-cyclohexane-1, 2-diamine)-2chloromalonatoplatinum(II)-2-deoxy-D-glucopyranose conjugate (Cl-2DG-Pt) Cl-2DG-Pt was prepared according to the procedure of H-2DG-Pt as a white solid after lyophilization. Yield: 32%, over two steps. 1H NMR (400 MHz, D2O): δ 4.92 (br, s, 1H), 3.55–3.80 (m, 7H), 3.17–3.25 (m, 1H), 3.05–3.15 (m, 1H), 2.32 (br, 2H), 1.85–2.02 (m, 3H), 1.40–1.58 (m, 3H), 1.18 (br, 2H), 1.03 (br, 2H). 13C NMR (100 MHz, D2O): 181.36, 181.07, 99.54, 81.83, 75.12, 73.54, 70.66, 65.42, 65.12, 64.59, 63.45, 40.55, 39.04, 34.46, 34.22, 26.39. IR (KBr): 3421, 2939, 2866, 1654, 1378, 1153, 1126, 1099, 1064, 1033, 972, 796. HRMS: Calcd. for C17H29ClN2O9Pt (M+): 636.1288 (100.0%), 635.1266 (97.4%), 637.1289 (74.6%), found: 636.1290, 635.1268, 637.1291. Preparation of (trans-R, R-cyclohexane-1, 2-diamine)-2fluoromalonatoplatinum(II)-2-deoxy-D-glucopyranose conjugate (F-2DG-Pt) F-2DG-Pt was prepared according to the procedure of H-2DG-Pt as a white solid. Yield: 35%, over two steps
6
Q. Mi et al.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
after lyophilization. 1H NMR (400 MHz, D2O): δ 4.90 (d, J = 2.6 Hz, 1H), 3.51–3.65 (m, 7H), 3.05–3.20 (m, 2H), 2.30 (br, 2H), 1.85–2.02 (m, 3H), 1.40–1.59 (m, 3H), .90–1.30 (m, 4H). 13C NMR (100 MHz, D2O): 175.51 (d, J = 23.7 Hz), 175.23 (d, J = 24.1 Hz), 96.12, 94.17, 72.64, 70.95, 68.11, 62.60 (d, J = 27.8 Hz), 62.57, 61.38, 60.86, 36.55, 36.47, 36.32, 31.78, 31.52, 23.81. IR (KBr): 3423, 2939, 2391, 2292, 1673, 1391, 1137, 1065, 1036, 972, 795. HRMS: Calcd. for C17H29FN2O9Pt (M+): 620.1583 (100.0%), 619.1562 (97.4%), 621.1585 (74.6%), found: 620.1586, 619.1565, 621.1588. Solubility of 2-DG conjugated platinum (II) complexes in water Solubility study of cisplatin, carboplatin, and oxaliplatin were conducted by placing excess of the drugs in deionized water in a series of 10-mL stoppered volumetric test tubes. The tubes were shaken in an incubating shaker at 25 °C for 1 h. The test tubes containing equilibrated solutions were then removed and filtered immediately by passing through .2-μm filters. Filtered samples (.5 mL) were diluted appropriately with deionized water. Drug estimation was made by using HPLC analysis for cisplatin, carboplatin, and oxaliplatin, with UV detector at 280 nm. The average value of three trials was taken. Standard curve obeyed Beer–Lambert’s law in the respective concentration range as >R2 = .999. Solubility for sugar-conjugated platinum (II) complexes were measured by a method of direct analysis of compound quality in saturated water solutions. Samples were filtered into a pre-weighed fine glass tube by passing through .2μm filters after shaking at 25 °C for 1 h, the mass of the filtrate plus the sample tube was then measured with electronic analytical balance (1:10,000). Filtrate was lyophilized to dryness and the mass for both water and platinum (II) complexes in the saturated test solution was calculated. The obtained water solubility results were combined into Table 1 with cytotoxicity analysis results. Results and discussion Chemistry The synthesis of the 2-DG-derived platinum (II) conjugates (H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt) was
Table 1.
accomplished starting from acetylated 2-deoxyglucose (Zhang et al., 2005) in a five-step sequence (Scheme 1). The alkylated 2-DG 1 was prepared by coupling of acetylated 2-DG with bromoethanol in dichloromethane in the presence of BF3·Et2O (90%). Alkylation of diethyl malonate with 1 using potassium carbonate to give 2 in 91% yield. Halogenation of 2 with N-chlorosuccinimide (NCS) or Selectfluor using sodium hydride in DMF afforded the corresponding chlorinated and fluorinated compounds of 3-Cl and 3-F (Cl: 81%, F: 93%). After hydrolysis with sodium hydroxide, the 2-DG conjugated platinum (II) complexes were obtained by platination reaction with 1R, 2R-diaminocyclohexaneplatinumsulfate (Pt(DACH)SO4) in the presence of barium hydroxide in water. The final products were purified with preparative HPLC using Disogel column and 15% MeOH-85% H2O as eluent (over 2 steps, 31% for H2DG-Pt, 32% for Cl-2DG-Pt, 35% for F-2DG-Pt). Representative 1H NMR characteristics including the stereochemical configuration for the α-form of the obtained 2DG conjugated platinum (II) complexes are depicted in Figure 2. All three 2-DG conjugated platinum (II) complexes were obtained as α-configuration from the adopted synthetic method illustrated in Scheme 1. The chemical shift of the 1-H for 2-deoxy-D-glucopyranoside showed the characteristic doublet signal of α-configuration at 4.90–4.92 ppm with a small coupling constant (J = 2.6, 2.7 Hz), whereas the 1-H signal of β-form for 2-deoxyD-glucopyranoside should appear around 4.0–4.5 ppm as doublet–doublet peaks (Figure 2). The assignment of the obtained compounds as α-anomeric configuration can be also confirmed by comparison of the 1H and 13C NMR spectra data of the deprotected samples derived from 2, 3-Cl, and 3-F with the literature report on α and β methyl 2-deoxy-D-glucopyranoside (Rauter et al., 2001). As illustrated in Figure 3, both 1H and 13C NMR chemical shifts as well as the H–H coupling constants of the derived sugar conjugates are well in consistent with the α-methyl 2-deoxy-D-glucopyranoside which support the stereochemical assignment. Other 1H NMR characteristics include the axial and equatorial proton of the 2-position (labeled as b in Figure 2), as well as the amino proton of the diaminocyclohexane ligand (labeled as d in Figure 2, partially deuterated by D2O), were kept almost identical in all three complexes.
Surflex docking results of the designed 2-DG conjugated platinum (II) complexes compared with 2-DG.
Compounds
Total_Score
Crash
Polar
D_SCORE
PMF_SCORE
G_SCORE
CHEMSCORE
CSCORE
Cl-2DG-Pt F-2DG-Pt H-2DG-Pt α-2-DG β-2-DG
7.23 6.83 6.13 3.10 2.36
−5.34 −5.80 −2.33 −2.33 −2.60
4.11 1.62 2.24 1.62 2.65
−206.52 −193.23 −154.56 −83.28 −87.38
−98.75 −84.36 −66.54 −23.35 −33.36
−345.81 −310.54 −210.16 −118.86 −133.80
−33.37 −24.28 −17.25 −10.12 −15.16
5 5 3 1 1
GLUT1 targeted platinum (II) complexes OAc
OAc OAc
AcO
(i)
OAc
O
Br O
O
O
O
O
O
OAc
2
(iv), (v)
H-2DG-Pt Cl-2DG-Pt
F-2DG-Pt
OAc OAc
F O
O
OAc
3-Cl
O
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
EtO
OAc
Cl
EtO EtO
OAc
OAc
H
OAc
O EtO EtO
(ii)
EtO
1
2-DG-OAc
(iii)
O
OAc
O OAc
7
O
O
OAc
3-F
Reagent and conditions: (i) BF3 .Et 2O, DCM; (ii) K2CO3, DMF; (iii) NCS or Selectf lour, NaH, DMF; (iv) NaOH, MeOH/H2O, 90 oC; (v) Ba(OH)2.8H2O, Pt(DACH)SO4, H2O, r.t.
Scheme 1.
Synthesis of the 2-DG conjugated platinum (II) complexes.
Computer-aided transportability assessment As described in the Method Section, after the MD minimization of the 2-DG-occluded GLUT1 system, 2-DG downshifted about 1.5 Å from the starting position toward the cytoplasmic side to be stabilized in a binding site which we consider that is the important 2-DG recognition pocket. Figure 4 shows both the α- and β-2-DG as
Figure 2.
1
GLUT1 substrate are binding in the same site that surrounded by the N domain TM2, 4, 5, and C domain TM7, 8, 10, 11 (in physiological condition, both α- and β-2-DG existing in an equilibrium state). Analysis of the whole simulation trajectory for the 2-DG-occluded system revealed that the conformation of the 2-DG-ligated GLUT1 reached equilibrium after 10 ns into the MD
HNMR characteristics of the synthesized 2-DG–platinum (II) conjugates.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
8
Q. Mi et al.
Figure 3.
Comparison of the 1H and
13
C NMR characteristics of the sugar-conjugated ligands with literature compounds.
Figure 4. Substrate recognition binding site of GLUT1 for 2-DG and glucose identified from molecular dynamics simulation. (A) α-2-DG and β-2-DG docked into the substrate binding pocket. (B) α-glucose and β-glucose docked into the substrate binding pocket.
simulation (Figure 5). This result indicated that this wellstabilized binding position of the 2-DG in the equilibrium conformation could be considered as the key binding site for 2-DG, which will be critical for 2-DG recognition and transportation in GLUT1. Following the same MD simulation procedure, the key substrate binding site for glucose was also identified. Consequently, results showed that the binding pocket for glucose in GLUT1 was almost identical with that of 2-DG (although with slightly different binding mode). This further emphasized that the identified binding site may play a key role in GLUT1-mediated substrate recognition and transportation. Docking results of 2-DG conjugated platinum (II) complexes As described in the Introduction Section, 2-DG has long been known and demonstrated to be a good substrate of
GLUT1 for facilitative cell uptake. Therefore, comparison of the binding mode as well as the docking scores with 2-DG in the substrate recognition site may provide meaningful information to estimate whether the 2-DGderived platinum glycoconjugates are potential substrates for the GLUT1 transporter. With the optimized GLUT1 3D model, 2-DG conjugated platinum (II) complexes were successively docked into the identified 2-DG binding site with SYBYL-X’s Surflex-Dock module of Tripos, Inc. (now Certara USA Inc., http://www.certara.com). As shown in Figure 6, the docked binding site of sugar moiety in the designed title complexes exactly overlaps with the GLUT1 substrates (2-DG and glucose). This result suggests that 2-DG conjugated platinum (II) complexes H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt are potentially GLUT1 transportable and can be recognized by GLUT1 in the same way. The binding mode of the
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
GLUT1 targeted platinum (II) complexes
9
Figure 5. (A) 2-DG-occluded GLUT1 structure extracted after MD simulation. (B) The root mean square deviation (RMSD) fluctuations of backbone atoms reached the equilibrium after 10 ns simulation of the 2-DG-occluded GLUT1 system. Structure in cyan is the starting structure and the magenta is the optimized structure. RMSD means the Cα-based root mean square deviation of the two structures.
2-DG-coupled platinum complexes illustrated in Figure 7 suggests that the 2-DG structural moiety makes the key contribution to the recognition. For H-2DG-Pt, residues N411 on TM11, and S80 on TM2 formed direct hydrogen bonding interaction with O4 and O6 of 2-DG. In Cl-2DG-Pt-bound pocket, N411 with O3 of the 2-DG moiety, W388 on TM10 with malonatocarbonyl oxygen, respectively, formed direct hydrogen bonds, and hydrogen bonding network between O6 and N411 or N415 made further contribution to the binding affinity that reflected by the highest G_SCORE and CHEMSCORE as summarized in Table 1. The fluorine-containing compound F-2DG-Pt also showed the similar binding mode
Figure 6. 2-DG conjugated platinum (II) complexes are docked into the same binding site with 2-DG and glucose in GLUT1 (cyan = β-2-DG, yellow = β-glucose, gray = H-2DG-Pt, blue = Cl-2DG-Pt, purple = F-2DG-Pt).
with Cl-2DG-Pt, and the O6 mediated hydrogen bonding network with residues on TM11 (N411, Q283, and N415) seems playing an important role for the sugar recognition. As the total score and the consensus score report the sum of the number of favorite docking results for the ligand in each scoring function, the higher Total_Score and CSCORE for the 2-DG conjugated platinum (II) complexes (Cl-2DG-Pt and F-2DG-Pt in Table 1) indicate that the predicted potency of transportability of the 2-DG glycoconjugates as GLUT1 substrate may lead to increased antitumor activity. Cytotoxicity evaluation The in vitro cytotoxicity evaluation results of the 2-DG conjugated platinum (II) complexes are summarized in Table 2. Oxaliplatin is the third generation platinumbased drug used as the primary therapy for metastatic colorectal cancer and other malignancies such as lung, breast, and ovarian cancers (Fu, Kavanagh, Hu, & Bast, 2006; Grothey, 2010; Raez, Kobina, & Santos, 2010; Stein & Arnold, 2012). The cytotoxicity of the synthesized complexes was comparable in some human cancer cell lines, and mostly better than oxaliplatin – despite a sizable increase of the water solubility. All tested cancer cells were reported to be over expressing GLUT1, especially for A549 (human lung carcinoma) (Ong et al., 2008), HT29 (human colon cancer) (Li et al., 2010), MCF7 (human breast cancer) (Medina & Owen, 2002), and DU145 (human prostate cancer) (Jadvar, 2013). As depicted in Table 2, all 2-DG conjugated complexes exhibited several fold more cytotoxic than clinical drug oxaliplatin toward these cancer cell lines. The average
10 Table 2.
Q. Mi et al. IC50 values (μM) and water solubility (mg/mL) of the titled 2-DG glycoconjugates in seven human cancer cell lines. IC50 (μM)
Solubility (mg/mL) 6.1 78.3 91.9 66.4
Cell lines
A549
SKOV3
MCF7
HT29
H460
DU145
Oxaliplatin H-2DG-Pt Cl-2DG-Pt F-2DG-Pt
2.86 ± .09 1.94 ± .23 1.03 ± .20 1.90 ± .28
14.94 ± .18 9.41 ± .23 10.10 ± .22 10.03 ± .19
1.79 ± .11 .97 ± .12 1.16 ± .14 .83 ± .10
5.83 ± .22 1.44 ± .18 .97 ± .12 1.13 ± .13
33.11 ± .26 22.22 ± .21 22.22 ± .14 10.19 ± .14
12.05 ± .19 5.00 ± .15 10.38 ± .17 2.30 ± .17
HEK293 49.46 ± 2.41 79.46 ± 4.26 102.19 ± 4.47 79.59 ± 4.58
(8) (55) (105) (70)
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
Notes: IC50 was tested with MTT assay for 72 h. All compounds are tested in the same batch and the experiments were performed tree times in five replicates. A549 (cell line for human lung carcinoma), MCF7 (human breast cancer cell line), SKOV3 (human ovarian cancer cell line), HT29 (human colon cancer cell line), H460 (human lung cancer cell line), DU145 (human prostate cancer cell line), and HEK293 (human embryonic kidney cells). Numbers in brackets are ratios of IC50 value in HEK293 against their IC50 in HT29.
Figure 7. Binding mode and direct hydrogen bonds and hydrogen bonding networks formed with 2-DG conjugated platinum (II) complexes. A: H-2DG-Pt, B: Cl-2DG-Pt, C: F-2DG-Pt.
IC50 values were also a good indicator to support the superior antitumor effect of the 2-DG conjugates as opposed to oxaliplatin. Take HT29 as an example, all three 2-DG conjugated platinum (II) complexes exhibited over 10-fold increase in water solubility, and the cytotoxicity for H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt were fourfold, sixfold, and fivefold stronger than oxaliplatin respectively. According to our GLUT1 expression analysis results that illustrated in Figure 8, among all tested cancer cells, HT29 was confirmed as one of the highest over expressing GLUT1 cell lines. The cytotoxicity results of H-2DG-Pt, Cl-2DG-Pt, and F-2DG-Pt against HT29 demonstrated the perfect correlation between the antitumor effects and GLUT1 expression level. This is also consistent with the results of GLUT1-mediated molecular docking assessment. To further confirm the transporter dependency of cytotoxicity of the obtained sugar conjugates, we conducted the cell-killing test of the platinum complexes toward the human embryonic kidney cells (HEK293) which are well-known cell lines with very low endogenous transporter expression. As
shown in Table 2, all 2-DG conjugated platinum (II) complexes exhibited decreased cell-killing potency in cytotoxicities by 50–100 fold compared to the GLUT1 over express HT29 cancer cell lines. The positive corre-
Figure 8. Gene expression analysis of GLUT1 over expressing cell lines with qPCR measurement. RQ (relative quantity) shows the relative fold differences between the tested cell lines.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
GLUT1 targeted platinum (II) complexes lation between GLUT1 expression and the cytotoxicity in HT29 and HEK293 cell lines indicating the GLUT1mediated uptake is playing important role for the 2-DG conjugated platinum (II) complexes. Theoretically, the more hydrophilic molecules, the more difficult it is to cross the cell membrane without the aid of transport proteins. With this primary result, and the combining of molecular docking observations, we believe that the 2-DG conjugated platinum (II) complexes can be very promising lead compounds to be further investigated for GLUT1-mediated targeted therapy anticancer agents. The more detailed uptake mechanism studies for these molecules – the inductively coupled plasma (ICP) analysis, and in vivo tumor accumulation study – are now undergoing.
Conclusion To leverage the Warburg effect, we designed and synthesized novel 2-deoxyglucose conjugated platinum (II) complexes for GLUT1-mediated tumor targeting. The structure-based molecular docking analysis utilizing the GLUT1 crystal model allowed us to speculate on potential transportability of the designed 2-DG conjugates. In vitro cytotoxicity evaluation demonstrated that the 2-DG conjugated platinum (II) complexes exhibit improved cytotoxicities compared to the clinical drug oxaliplatin. The antitumor effects of the designed 2-DG-platinum (II) conjugates are demonstrated to be GLUT1-dependent in certain cell lines like HT29 which highly over expresses glucose transporters. This proof-of-concept study revealed that the 2-DG as platinum (II) glycoconjugate motif is suitable for GLUT1-mediated drug delivery and selective tumor targeting. The data and results from this research further support the potential of the obtained platinum (II) complexes as lead compounds for more preclinical studies.
Abbreviations 2-DG 2-Deoxyglucose GLUT Glucose transporter 18 F-FDG 2-Deoxy-2-(18F) fluoro-D-glucose PDB Protein Data Bank RMSD Root mean square deviation RT-PCR Real-time reverse transcription polymerase chain reaction Oxaliplatin (1R,2R-Diaminocyclohexane) oxalatoplatinum(II) 2-DG-OAc 1,3,4,6-Tetra-O-acetyl-2-deoxy-Dglucopyranose H-2DG-Pt Trans-R, R-cyclohexane-1, 2-diaminemalonatoplatinum(II)-2-deoxy-Dglucopyranose conjugate
Cl-2DG-Pt
F-2DG-Pt
IC50 MTT
11
Trans-R, R-cyclohexane-1, 2-diamine-2chloromalonatoplatinum(II)-2-deoxy-Dglucopyranose conjugate Trans-R, R-cyclohexane-1, 2-diamine-2fluoromalonatoplatinum(II)-2-deoxy-Dglucopyranose conjugate Inhibitory concentration at 50% inhibition 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide
Disclosure statement No potential conflict of interest was reported by the authors.
Funding This work was supported by Grants from the Tianjin Municipal Applied Basic and Key Research Scheme of China (11JCYBJC14400, 12ZCDZSY11500, 13JCZD27500), and by the Project of National Basic Research (973) Program of China (2015CB856500).
References Ben-Haim, S., & Ell, P. (2009). 18F-FDG PET and PET/CT in the evaluation of cancer treatment response. Journal of Nuclear Medicine, 50, 88–99. Boado, R. J., Black, K. L., & Pardridge, W. M. (1994). Gene expression of GLUT3 and GLUT1 glucose transporters in human brain tumors. Molecular Brain Research, 27, 51–57. Cheatham, T. E., Miller, J. L., Fox, T., Darden, T. A., & Kollman, P. A. (1995). Molecular dynamics simulations on solvated biomolecular systems: The particle mesh Ewald method leads to stable trajectories of DNA, RNA, and proteins. Journal of the American Chemical Society, 117, 4193–4194. Cunningham, P., Afzal-Ahmed, I., & Naftalin, R. J. (2006). Docking studies show that D-glucose and quercetin slide through the transporter Glut1. Journal of Biological Chemistry, 281, 5797–5803. Deng, D., Xu, C., Sun, P., Wu, J., Yan, C., Hu, M., & Yan, N. (2014). Crystal structure of the human glucose transporter GLUT1. Nature, 510, 121–125. Eslami Moghadam, M., Saidifar, M., Divsalar, A., MansouriTorshizi, H., Saboury, A. A., Farhangian, H., & Ghadamgahi, M. (2015). Rich spectroscopic and molecular dynamic studies on the interaction of cytotoxic Pt(II) and Pd(II) complexes of glycine derivatives with calf thymus DNA. Journal of Biomolecular Structure & Dynamics, 20, 1–17. Fu, S., Kavanagh, J. J., Hu, W., & Bast, R. C., Jr. (2006). Clinical application of oxaliplatin in epithelial ovarian cancer. International Journal of Gynecological Cancer, 16, 1717– 1732. Godoy, A., Ulloa, V., & Rodríguez, F. (2006). Differential subcellular distribution of glucose transporters GLUT1–6 and GLUT9 in human cancer: Ultrastructural localization of GLUT1 and GLUT5 in breast tumor tissues. Journal of Cellular Physiology, 207, 614–627. Grothey, A. (2010). Reintroduction of oxaliplatin: A viable approach to the long-term management of metastatic colorectal cancer. Oncology, 79, 389–399.
Downloaded by [University of Sussex Library] at 04:57 06 December 2015
12
Q. Mi et al.
Haber, R. S., Rathan, A., & Weiser, K. R. (1998). GLUT1 glucose transporter expression in colorectal carcinoma. Cancer, 83, 34–40. Holyoake, J., Caulfeild, V., Baldwin, S. A., & Sansom, M. S. (2006). Modeling, docking, and simulation of the major facilitator superfamily. Biophysical Journal, 91, L84–L86. Humphrey, W., Dalke, A., & Schulten, K. (1996). VMD: Visual molecular dynamics. Journal of Molecular Graphics, 14, 33–38. Jadvar, H. (2013). Imaging evaluation of prostate cancer with 18 F-fluorodeoxyglucose PET/CT: Utility and limitations. European Journal of Nuclear Medicine and Molecular Imaging, 40, 5–10. Kapoor, R., Spence, A. M., Muzi, M., Graham, M. M., Abbott, G. L., & Krohn, K. A. (1989). Determination of the deoxyglucose and glucose phosphorylation ratio and the lumped constant in rat brain and a transplantable rat glioma. Journal of Neurochemistry, 53, 37–44. Kostova, I. (2006). Platinum complexes as anticancer agents. Recent Patents on Anti-Cancer Drug Discovery, 1, 1–22. Kunkel, M., Reichert, T. E., & Benz, P. (2003). Overexpression of Glut-1 and increased glucose metabolism in tumors are associated with a poor prognosis in patients with oral squamous cell carcinoma. Cancer, 97, 1015–1024. Kurata, T., Oguri, T., Isobe, T., Ishioka, S. I., & Yamakido, M. (1999). Differential expression of facilitative glucose transporter (GLUT) genes in primary lung cancers and their liver metastases. Japanese Journal of Cancer Research, 90, 1238–1243. Li, X. F., Ma, Y., Sun, X., Humm, J. L., Ling, C. C., & O’Donoghue, J. A. (2010). High 18F-FDG uptake in microscopic peritoneal tumors requires physiologic hypoxia. Journal of Nuclear Medicine, 51, 632–638. Liu, P., Lu, Y., Gao, X., Liu, R., Zhang-Negrerie, D., Shi, Y., … Gao, Q. (2013). Highly water-soluble platinum (II) complexes as GLUT substrates for targeted therapy: Improved anticancer efficacy and transporter-mediated cytotoxic properties. Chemical Communications, 49, 2421–2423. Liu, T., Zhang, J., Wang, X., Yang, J., Tang, Z., & Lu, J. (2014). Radiolabeled glucose derivatives for tumor imaging using SPECT and PET. Current Medicinal Chemistry, 21, 24–34. Lu, Y., Gao, X., Wu, M., Zhang-Negrerie, D., & Gao, Q. (2011). Strategies on the development of small molecule anticancer drugs for targeted therapy. Mini-Reviews in Medicinal Chemistry, 11, 611–624. Medina, R. A., & Owen, G. I. (2002). Glucose transporters: Expression, regulation and cancer. Biological Research, 35, 9–26. Mueckler, M., & Makepeace, C. (1997). Identification of an amino acid residue that lies between the exofacial vestibule and exofacial substrate-binding site of the Glut1 sugar permeation pathway. Journal of Biological Chemistry, 272, 30141–30146. Negureanu, L., & Salsbury, F. R., Jr. (2014). Non-specificity and synergy at the binding site of the carboplatin-induced DNA adduct via molecular dynamics simulations of the
MutSα-DNA recognition complex. Journal of Biomolecular Structure & Dynamics, 32, 969–992. Ong, L. C., Jin, Y., Song, I. C., Yu, S., Zhang, K., & Ong, L.-C. (2008). 2-[18F]-2-deoxy-D-glucose (FDG) uptake in human tumor cells is related to the expression of GLUT-1 and hexokinase II. Acta Radiologica, 49, 1145– 1153. Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., … Schulten, K. (2005). Scalable molecular dynamics with NAMD. Journal of Computational Chemistry, 26, 1781–1802. Plathow, C., & Weber, W. A. (2008). Tumor cell metabolism imaging. Journal of Nuclear Medicine, 49, 43S–63S. Raez, L. E., Kobina, S., & Santos, E. S. (2010). Oxaliplatin in first-line therapy for advanced non-small-cell lung cancer. Clinical Lung Cancer, 11, 18–24. Rauter, A. P., Figueiredo, J., Ismael, M., Canda, T., Font, J., & Figueredo, M. (2001). Efficient synthesis of α, β-unsaturated γ-lactones linked to sugars. Tetrahedron: Asymmetry, 12, 1131–1146. Ryckaert, J. P., Ciccotti, G., & Berendsen, H. C. (1977). Numerical integration of the cartesian equations of motion of a system with constraints: Molecular dynamics of nalkanes. Journal of Computational Physics, 23, 327–341. Salas-Burgos, A., Iserovich, P., Zuniga, F., Vera, J. C., & Fischbarg, J. (2004). Predicting the three-dimensional structure of the human facilitative glucose transporter Glut1 by a novel evolutionary homology strategy: Insights on the molecular mechanism of substrate migration, and binding sites for glucose and inhibitory molecules. Biophysical Journal, 87, 2990–2999. Schechter, N. R., Erwin, W. D., Yang, D., Kim, E. E., Munden, R. F., Forster, K., … Podoloff, D. A. (2009). Radiation dosimetry and biodistribution of 99mTc-ethylene dicysteinedeoxyglucose in patients with non-small-cell lung cancer. European Journal of Nuclear Medicine and Molecular Imaging, 36, 1583–1591. Stein, A., & Arnold, D. (2012). Oxaliplatin: A review of approved uses. Expert Opinion on Pharmacotherapy, 13, 125–137. Warburg, O., Wind, F., & Negelein, E. (1927). The metabolism of tumors in the body. The Journal of General Physiology, 8, 519–530. Younes, M., Brown, R. W., Stephenson, M., Gondo, M., & Cagle, P. T. (1997). Overexpression of glut1 and glut3 in stage I nonsmall cell lung carcinoma is associated with poor survival. Cancer, 80, 1046–1051. Zhang, G., Fang, L.-Y., Zhu, L.-Z., Aimiuwu, J. E., Shen, J., Cheng, H., … Wang, P. G. (2005). Syntheses and biological activities of disaccharide daunorubicins. Journal of Medicinal Chemistry, 48, 5269–5278. Zhang, M., Zhang, Z., Blessington, D., Li, H., Busch, T. M., Madrak, V., … Zheng, G. (2003). Pyropheophorbide 2-deoxyglucosamide: A new photosensitizer targeting glucose transporters. Bioconjugate Chemistry, 14, 709–714.
