Mol Cell Biochem (2014) 387:159–170 DOI 10.1007/s11010-013-1881-6
ERK1/2 inhibition enhances apoptosis induced by JAK2 silencing in human gastric cancer SGC7901 cells Cuijuan Qian • Jun Yao • Jiji Wang • Lan Wang • Meng Xue • Tianhua Zhou Weili Liu • Jianmin Si
•
Received: 25 August 2013 / Accepted: 18 October 2013 / Published online: 1 November 2013 Ó Springer Science+Business Media New York 2013
Abstract Recent studies suggest JAK2 signaling may be a therapeutic target for treatment of gastric cancer (GC). However, the exact roles of JAK2 in gastric carcinogenesis are not very clear. Here, we have targeted JAK2 to be silenced by shRNA and investigated the biological functions and related mechanisms of JAK2 in GC cell SGC7901. In this study, JAK2 is commonly highly expressed in GC tissues as compared to their adjacent normal tissues (n = 75, p \ 0.01). Specific down-regulation of JAK2 suppressed cell proliferation and colonyforming units, induced G2/M arrest in SGC7901 cells, but had no significant effect on cell apoptosis in vitro or tumor growth inhibition in vivo. Interestingly, JAK2 silencinginduced activation of ERK1/2, and inactivation of ERK1/2 using the specific ERK inhibitor PD98059 markedly enhanced JAK2 shRNA-induced cell proliferation inhibition, cell cycle arrest and apoptosis. Ultimately,
Cuijuan Qian and Jun Yao contributed equally to this study. C. Qian J. Wang L. Wang M. Xue W. Liu (&) J. Si (&) Institute of Gastroenterology, Sir Run Run Shaw Hospital, Zhejiang University, Hangzhou 310016, Zhejiang, People’s Republic of China e-mail: [email protected] J. Si e-mail: [email protected] J. Yao Institute of Tumor, School of Medicine, Taizhou University, Taizhou, Zhejiang, People’s Republic of China T. Zhou Department of Cell Biology and Program in Molecular Cell Biology, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China
combination of PD98059 and JAK2 shRNA significantly inhibited tumor growth in nude mice. Our results implicate JAK2 silencing-induced cell proliferation inhibition, cell cycle arrest, and ERK1/2 inhibition could enhance apoptosis induced by JAK2 silencing in SGC7901 cells. Keywords cancer
JAK2 ERK1/2 shRNA Gastric
Introduction Although the incidence and mortality rates associated with gastric cancer (GC) have gradually decreased recently, GC remains to be one of significant causes of cancer-related mortality in the world [1]. Improvements in the diagnosis and treatment of GC are largely dependent on a further understanding of gastric carcinogenesis. In recent years, researches on targeted therapy of GC have achieved certain progress. However, the prognosis of advanced GC is still very poor [2]. Janus-associated kinase 2 (JAK2) signaling pathway, one of pro-oncogenic signaling pathways, plays a key role in regulation of cell functions via regulation of genes involved in cell proliferation [3, 4], apoptosis and survival [5], and angiogenesis [6]. JAK2 is strikingly elevated in the majority of cancers in comparison with adjacent benign tissues and associated with cancer growth and metastasis, so drugs that target JAK2 may be useful in the management of a variety of cancers, such as myeloproliferative neoplasms, T cell leukemia, prostate, ovarian, breast, thyroid and colorectal cancer, etc. [7–12]. However, none of these drugs have been undergoing clinical evaluation or approved for treatment of GC. On the other hand, the specificity of JAK2 inhibitors (e.g., AG490, TG101209) has been questioned for a long time [7, 13, 14], so we
123
160
Mol Cell Biochem (2014) 387:159–170
conducted this work to investigate the exact role of JAK2 in GC and provide more basis for rational molecular-targeted therapies. Therefore, to clarify this, we specifically silenced JAK2 by a short-hairpin RNAs (shRNA) in human GC SGC7901 cells to explore the exact effects and mechanisms underlying specific down-regulation of JAK2 in vitro and in vivo. Moreover, there are emerging and conflicting reports about cross-talk between JAK2 and extracellular signalregulated kinase 1 and 2 (ERK1/2) signaling pathways in different cell types [15, 16], but to date, no research has been reported on the relationship of this two important pathways in GC. Therefore, the purpose of this study was further to explore the mechanism of cross-talk between JAK2 and ERK1/2 signaling pathways in GC. In this study, we provide evidence that ERK1/2 activation may be related to evasion of apoptosis in JAK2silenced SGC7901 GC cells and put forward that JAK2 silencing combined with ERK1/2 inhibitors may serve as a new approach to treat GC.
Roche Benchmark XT, containing 75 gastric carcinoma samples. Tumor staging was judged by two senior pathologists using the tumor-node-metastasis classification system according to the protocol of International Union Against Cancer. The DAKO EnVision system (DAKO, Carpinteria, CA) was used for measure the immunohistochemical expression of JAK2. All images (9200) were photographed and analyzed with an Aperio scanner (USC). Both the percentage of positive tumor cells and the intensity of staining were independently assessed by two observers in a semiquantitative fashion. The percentage of positive tumor cells was scored as follows: 0–5 % = 0; 5–25 % = 1; 26–50 % = 2; 51–75 % = 3; [75 % = 4. Intensity of staining was graded as follows: no staining = 0; weakly staining = 1; moderately positive staining = 2; densely staining = 3. Finally, the slide was assigned a total score based on both results which range from 0 to 12. If the relative score of cancer and corresponding normal adjacent tissue is greater than zero, that means positive expression of JAK2.
Materials and methods
Construction of expression vectors and stable transfection of SGC7901 cells
Cell culture and mice The GC cell line SGC7901 (ATCC, Manassas, VA, USA) were cultured in complete RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10 % fetal bovine serum, 100 units/ml penicillin, and 100 lg/ml streptomycin, and incubated at 37 °C with 5 % CO2 and 95 % humidity. 3–4week-old female athymic nude mice were purchased from the Shanghai Laboratory Animal Co. Ltd (Shanghai, China). Reagents and antibodies Dimethyl sulfoxide (DMSO) and 40 ,6-diamidino-2-phenylindole (DAPI) were purchased from Sigma-Aldrich Chemical (St. Louis, MO, USA). The MAPK/ERK pathway inhibitor 2-(2-diamino-3-methoxyphenyl-4H-1-benzopyran4-one (PD98059) was purchased from Beyotime Institute of Biotechnology (Hangzhou, China). Primary antibodies against JAK2, ERK1/2, and phospho-ERK1/2 (Thr202/ Tyr204) were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). Primary antibody against GAPDH was obtained from GoodHere Technology (Hangzhou, China). Anti-rabbit IgG, HRP-linked antibody (7074) was also purchased from Cell Signaling Technology. Tissue array Evaluation of JAK2 expression by immunohistochemistry was done on a tissue array (OD-CT-DgSt m01-014) using
123
The JAK2-shRNA pGPU6/GFP/Neo-JAK2-shRNA and control shRNA expression vector pGPU6/GFP/Neo-shNC have been constructed. Briefly, two oligonucleotides 50 -CA CCGCGAATAAGGTACAGATTTCGTTCAAGAGACG AAATCTGTACCTTATTCGCTTTTTTG-30 and 50 -GATC CAAAAAAGCGAATAAGGTACAGATTTCGTCTCTT GAACGAAATCTGTACCTTATTCGC-30 were annealed and introduced into the pGPU6/GFP/Neo vector and referred to as shJAK2. A scrambled shRNA expression vector was used as the negative control (which was referred to as control shRNA). SGC7901 cells were seeded in 12-well plate for 24 h and transfected with JAK2 shRNA or control shRNA using LipofectamineÒ 2000 reagent (Invitrogen, Carlsbad, USA). Cells were transferred in selection medium containing geneticin (G418; 400 lg/ml) after transfection for 48 h. G418 resistant colonies were selected for another 14 days. After confirming the transfection effect at the mRNA and protein level, the surviving colonies were continuously selected with G418 to generate stable cell lines by expanding culture. Total RNA and quantitative real-time PCR Total RNA were extracted with Trizol Reagent (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instruction, and were quantitated on a NanoDrop 1000 spectrophotometer (Nanodrop, Wilmington, DE, USA). 1 lg of total RNA was reversed using Reverse Transcription System (Promega, Madison, WI, USA). The mRNA expression
Mol Cell Biochem (2014) 387:159–170
levels of JAK2 were determined by quantitative RT-PCR (qPCR) using SYBR Green Master Mix Kit (TaKaRa Schuzo, Tokyo, Japan) in a Lightcycler 480 system (Roche Diagnostics, Brussels, Belgium). GAPDH was used as an internal control, and the mRNA expression levels of JAK2 were evaluated using the 2-DDCT method. The primer pairs were designed as follows, JAK2 (forward: ACACTGGGG AGGTGGTCGCT, reverse: ACGCCGACCAGCACTGTAGC) and GAPDH (forward: TGCACCACCAACTGCT TAGC, reverse: GGCATGGACTGTGGTCATGAG).
Western blot analysis Total proteins were extracted using RAPI lysis buffer (1 % Triton X-100, 0.5 % sodium deoxycholate, 0.1 % SDS, 150 mM NaCl, 50 mM Tris/HCl (pH 7.2), 10 mM EDTA), which contained 50 lM leupeptin, 1 mM sodium orthovanadate, 1 mM sodium fluoride, and 1 mM phenylmethylsulphonyl fluoride (PMSF). Lysates were resolved on SDS-PAGE gel and transferred to PVDF membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5 % BSA in TBS-T, and incubated with primary antibody overnight at 4 °C, and then incubated with the secondary antibody. The blots were developed using a Fujifilm LAS-4000 chemiluminescent imaging system (Fujifilm, Tokyo, Japan). Cell proliferation assay Cell proliferation was detected by Cell Titer 96Ò AQueous One Solution Cell Proliferation Assay (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instruction. Briefly, stable transfected cells (2.5 9 103/ well) were seeded into 96-well plates and treated as indicated with or without PD98059 for proper time. Replicates of five were used for each point. After incubation with CellTiter 96 Aqueous One Solution reagent for 2 h, the absorbance was measured at 490 nm (Bio-Rad Systems, Hercules, CA, USA). Cell apoptosis and cell cycle analysis Cell apoptosis were measured using the Annexin V-PE/7AAD Apoptosis Detection Kit (Becton, Dickinson and Company, USA) according to the manufacturer’s instruction. Briefly, stably transfected cells were incubated with or without indicated treatments for the desired time. And attached and floating cells were pooled, pelleted by centrifugation, washed twice with cold PBS, and then resuspended in 19 binding buffer [10 mM hydroxyethyl piperazine ethanesulfonic acid (HEPES), pH 7.4, 140 mM
161
NaOH, and 2.5 mM CaCl2] at a concentration of 1 9 106 cells/ml. 1 9 105 cells were transferred to a 5-ml culture tube, and stained with 5 ll of Annexin V-PE and 5 ll of 7-AAD for 15 min at room temperature in the dark. Finally, 400 ll of 19 binding buffer were added to each tube, and the apoptotic cells were determined using a FACScan flow cytometry (BD, Franklin Lakes, NJ, USA). Meanwhile, the same treated cells were harvested for cell cycle distribution assay using the Cell Cycle Staining Kit (MultiSciences Biotech Co., Ltd., Hangzhou, China). Briefly, cells were stained with 300 ll of DNA staining solution and 3 ll permeabilization solution for 30 min at room temperature in dark, and the cells were then analyzed by a BD FACSCalibur flow-cytometer provided with the MOD-Fit 3.0 software (Verity Software House Increase, Topsham, ME, USA). Nuclear staining assay Cells were cultured on 22 mm 9 22 mm glass coverslips in 6-well plates at a density of 2 9 105 per well, and incubated with or without indicated treatments for the desired time. For nuclear staining assay, cells were fixed with 4 % cold paraformaldehyde (pH 7.4) and stained with 0.5 lg/ml DAPI for 5 min at room temperature. The coverslips were rinsed with PBS and mounted onto slides with a fluorescent mounting medium. Images were acquired with the fluorescence microscope. Cell colony formation assay Cells were plated at a density of 40 cells/cm2 in 6-well plates and incubated for 14 days. The medium were changed every 2 days. Cells were fixed with methanol and stained with 0.1 % crystal violet. Visible colonies containing at least 50 cells were counted. Xenograft tumor model All animal experiments were approved by the Institutional Animal Care and Use Committee of Zhejiang University, and the study was approved by the Ethics Committee of Zhejiang University. SGC7901 cells transfected with JAK2 shRNA or control shRNA (5 9 106 cells) were injected subcutaneously into the flank of 4-week-old female athymic nude mice. When tumors became palpable (-100 mm3) after implantation of tumor cells, animals were randomly assigned to different treatment groups (n = 6 in each group). For PD98059 treatment, animals were injected intraperitoneally with PD98059 (10 mg/kg) once every 3 days for three times in total. Tumor size was assessed every 3 days. Tumor volume was calculated according to the following formula: volume (mm3) = (width2 9 length)/2. The mice were
123
162
Mol Cell Biochem (2014) 387:159–170
Fig. 1 Analysis of JAK2 expression in human gastric carcinomas. Immunohistochemical staining for JAK2 in gastric adenocarcinoma (grades I–III) and their normal counterparts (n = 75) was detected using monoclonal antibody to human JAK2 (1:100 dilution). The brown signals represent positive staining for JAK2 (original
magnifications 9200) (a). The results of immunohistochemical staining for JAK2 were scored and relative expression of JAK2 in 75 primary gastric cancer tissues compared with their pair-matched adjacent non-tumor tissues were illustrated (b). (Color figure online)
euthanized and the tumors were subjected to hematoxylin– eosin (HE) staining.
Results JAK2 is commonly highly expressed in GC tissues
Statistical analysis All data were shown as mean ± SE. v2 test was used to assess the difference between two rates, Student’s t test was applied to analyze the difference between groups, and difference among groups was analyzed by one-way ANOVA and Student–Newman–Keuls (SNK)-q test using a SPSS 16.0 for Windows (SPSS Inc., Chicago, IL, USA). p \ 0.05 was considered statistically significant.
123
Immunohistochemical analyses from gastric tissue array (n = 75) demonstrated that both normal and tumor tissues expressed JAK2, but 50 specimens of gastric carcinoma tissues (50/75, 66.67 %) expressed high levels of JAK2 when compared to their paired corresponding adjacent normal tissues (p \ 0.01) (Fig. 1a, b), suggesting JAK2 may play an important role in gastric carcinogenesis.
Mol Cell Biochem (2014) 387:159–170
163
Fig. 2 Effects of JAK2 down-regulation on cell proliferation of SGC7901 cells. Cells were transfected with a control shRNA or a shRNA directed against JAK2. JAK2 expressions were evaluated by quantitative RT-PCR (a) and Western blot (b). Cell proliferation of SGC7901 cells were evaluated by MTS assay (c). Representative photographs of monolayer colony formation of SGC7901 cells
transfected with JAK2 shRNA and control shRNA (d). The chart represents the mean number of colony-forming units in three independent experiments (e). All data presented are mean ± SE of three independent experiments performed in triplicate. *p \ 0.05, **p \ 0.01 versus control shRNA
Silence of JAK2 by shRNA decreases GC cell proliferation
a time-dependent manner as compared with control shRNA (p \ 0.05). Furthermore, the number of surviving colonies was significantly decreased in JAK2 shRNA-transfected cells as compared with control shRNA (Fig. 2d, e; p \ 0.01).
To evaluate the potential role of JAK2 silencing in cell proliferation, SGC7901 cells were transfected with JAK2specific shRNA vectors (JAK2 shRNA), and the expression of JAK2 shRNA in stably transfected cells was assessed by quantitative RT-PCR and Western blot. As observed, JAK2 shRNA induced a significant decrease in JAK2 mRNA expression (Fig. 2a; p \ 0.01), accompanied with an evident down-regulation of JAK2 protein expression (Fig. 2b). The results confirmed that JAK2 shRNA significantly down-regulated JAK2 expressions in SGC7901 cells as compared with control shRNA. Results of MTS assay were shown in Fig. 2c, shRNAmediated specific JAK2 down-regulation resulted in significant inhibition of cell proliferation of SGC7901 cells in
Silence of JAK2 by shRNA does not affect apoptosis, but induces cell cycle arrest JAK2 inhibition with small molecule inhibitors that target aberrant JAK2 activity has been shown to induce apoptosis in some cell models such as lymphoma and pancreatic cancer cells during early embryonic stem cell neurogenesis [9, 17]. In this study, we tested the effect of specific downregulation of JAK2 with shRNA on SGC7901 cell apoptosis by performing an annexinV-PE/7-amino-actinomycin
123
164
Mol Cell Biochem (2014) 387:159–170
Fig. 3 Effects of down-regulation of JAK2 signaling on cell apoptosis and cell cycle distributions of SGC7901 cells. Flow cytometry analyses of cell apoptosis and cell cycle distributions in SGC7901 cells transfected with JAK2 shRNA were detected. Representative results of cell apoptosis (a) and cell cycle (c) were
showed. Bar graphs demonstrated the percentage of apoptotic rates (b) and cells in G2/M phase (d). All data represent the average of three independent experiments in duplicate. *p \ 0.05 versus control shRNA
D (7-AAD) assay. However, there was no significant difference between JAK2 shRNA and control shRNA groups (Fig. 3a, b; p [ 0.05). In order to gain insights into the mechanism of the antiproliferative activity of JAK2 silencing, flow cytometry analyses were used to determine cell cycle distributions. As shown in Fig. 3c, d, the proportion of G2/M phase in JAK2 shRNA-transfected cells was significantly increased as compared with control shRNA (p \ 0.05), suggesting that JAK2 may be involved in SGC7901 cell proliferation by regulating the cell cycle progression.
(Fig. 5d). In order to explore the possible relationship of JAK2 and ERK1/2 signaling, we next used specific ERK inhibitor to inhibit JAK2 silencing-induced ERK1/2 activation. We have previously reported that incubation with 50 lM PD98059 resulted in maximal inhibition of ERK1/2 phosphorylation in log-phase growing SGC7901 cells [18]. As shown in Fig. 4a, inhibition of ERK1/2 signaling by specific inhibitor PD98059 enhanced JAK2 shRNAinduced cell proliferation inhibition (p \ 0.01), while no statistical difference was found between JAK2 shRNA and PD98059 groups (p [ 0.05). Moreover, JAK2 shRNA combined with PD98059 resulted in significant apoptosis compared to JAK2 shRNA or PD98059 alone (Fig. 4c, d; p \ 0.01). In addition, apoptotic cells show the characteristic morphological changes that include chromatin condensation, nuclear fragmentation, so the apoptosis was also tested using DAPI nuclear staining. We found that the SGC7901 cells exposed
ERK1/2 inhibition enhances JAK2 shRNA-induced cell proliferation inhibition, and causes apoptosis Interestingly, there was an evident activation of ERK1/2 after JAK2 shRNA transfection in SGC7901 cells
123
Mol Cell Biochem (2014) 387:159–170
165
Fig. 4 Effects of JAK2 shRNA and PD98059 combination on cell proliferation and apoptosis of SGC7901 cells. Cell proliferation of indicated treatments was evaluated by MTS (a). DAPI staining of cells were done and then observed under a fluorescence microscope (9100 magnification) (b). Representative results of flow cytometry
analysis for apoptosis were demonstrated (c) and bar graphs depicted the percentage of apoptotic rates (d). All data represent mean ± SE of three independent experiments performed in triplicate. *p \ 0.05, **p \ 0.01 versus control shRNA; #p \ 0.05, ##p \ 0.01 versus JAK2 shRNA alone; $p \ 0.05, $$p \ 0.01 versus PD98059 alone
to JAK2 shRNA alone caused neither chromatin condensation nor nuclear fragmentation as compared with control shRNA, while combination of JAK2 shRNA and PD98059
showed increased chromatin condensation and nuclear fragmentation compared to JAK2 shRNA or PD98059 alone (Fig. 4b).
123
166
Mol Cell Biochem (2014) 387:159–170
Fig. 5 Effects of JAK2 shRNA and PD98059 combination on cell cycle and related gene expression of SGC7901 cells. Representative results of flow cytometry analysis for cell cycle distribution were demonstrated (a). Bar graphs depicted the percentage of cells in G2/ M phases (b) and S phases (c). All data represent mean ± SE of three
independent experiments performed in triplicate. Related gene expression were detected by Western blot (d). *p \ 0.05, **p \ 0.01 versus control shRNA; #p \ 0.05 versus JAK2 shRNA alone; $p \ 0.05 versus PD98059 alone
Inhibition of ERK1/2 enhances JAK2 shRNA-induced cell cycle arrest and regulates downstream gene expression
PD98059 compared to control groups (Fig. 5d). Interestingly, JAK2 shRNA-induced up-regulation of p21WAF1/CIP1 was strikingly increased by combination with PD98059 (Fig. 5d). Meanwhile, Bcl-2 was slightly down-regulated by JAK2 shRNA, while cyclin D1 was significantly down-regulated by JAK2 shRNA (Fig. 5d). Moreover, JAK2 shRNA-induced down-regulation of Bcl-2 and cyclin D1 was strikingly enhanced by combination with PD98059 (Fig. 5d).
Here, we examined the effects of PD98059 on JAK2 silencing-induced cell cycle arrest. As shown in Fig. 5a, b, PD98059 significantly enhanced G2/M arrest induced by JAK2 shRNA (p \ 0.01). Moreover, JAK2 shRNA significantly enhanced S arrest induced by PD98059 (Fig. 5c; p \ 0.05). Since Bcl-2, p21WAF1/CIP1 and cyclin D1 are biologically relevant to JAK2 inhibition-induced apoptosis and cell cycle arrest in cancer cells [19, 20], we further focused on their expressions after JAK2 silencing and/or ERK1/2 inhibition in SGC7901 cells. The results demonstrated that the expression of p21WAF1/CIP1 was slightly up-regulated by JAK2 shRNA or
123
Combination of JAK2 shRNA and PD98059 significant inhibits tumor growth in vivo To further confirm the in vivo effects of JAK2 silencing, we established the GC solid tumor subcutaneously in nude mice model. Tumor size was calculated and shown in
Mol Cell Biochem (2014) 387:159–170
167
Fig. 6 Therapeutic effects of treatments on the SGC7901 cell xenografts formation in nude mice. a The figure represents daily surveillance of tumor size during the observation period, and each point represents mean ± SE. *p \ 0.05, **p \ 0.01 versus control shRNA cells; #p \ 0.05, ##p \ 0.01 versus JAK2 shRNA alone; $ p \ 0.05, $$p \ 0.01 versus PD98059 alone. SGC7901 cells stably expressing JAK2 shRNA or control shRNA were injected subcutaneously into the flank of athymic nude mice. On 11th day after
inoculation, mice bearing SGC7901 xenografts (-100 mm3) were injected intraperitoneally with 10 mg/kg PD98059 (PD) once every 3 days for three times in total, as indicated by the arrows. b Representative tumor masses were photographed with an ordinary camera. A ruler was served as a metrics. c Necrosis areas within tumor were shown by H&E staining observed with light microscope (9200 original magnifications)
Fig. 6a (n = 6 in each group). JAK2 shRNA alone had weak antitumor effect in vivo (Fig. 6a; p [ 0.05). However, compared to JAK2 shRNA or PD98059 alone, combination therapy with JAK2 shRNA and PD98059 led to significant antitumor effects in the nude mice (Fig. 6a, b; p \ 0.01). Tumor necrosis was observed under light microscope. Specifically, control shRNA or JAK2 shRNA group did not display evident tumor cell necrosis, and PD98059 group displayed necrosis interspersed with viable tumor cells, whereas JAK2 shRNA plus PD98059 group showed large areas of continuous necrosis within tumors (Fig. 6c). That is, the combination of JAK2 shRNA with PD98059 group displayed more severe necrosis than any other group (Fig. 6c), suggesting this combination may be a novel and effective antitumor treatment against GC in vivo.
but additional efforts are still needed to clarify the precise mechanisms of it. JAK2 kinase is one member of the JAK family and a key mediator of signaling downstream of a variety of growth factor and/or cytokine receptors [22, 23]. JAK2 may serve as a survival factor for myeloproliferative neoplasms [24, 25], and in our present study, JAK2 was upregulated in human GC tissues and cells. JAK2 inhibition may prevent disease progression by restricting hematologic malignant cell phenotypes; However, the exact role of JAK2 signaling in solid cancers is unclear [11]. Our previous study [26] has found that the JAK2 inhibitor AG490 could inhibit the GC cell proliferation, which supports the hypothesis that JAK2 may be an important oncogene in GC by directly or indirectly controlling the proliferation of GC cells. However, effects of specific silencing of JAK2 on GC cells are still unclear, because most current JAK2 inhibitors are multikinase inhibitors, which may reduce their specificity by inhibiting or activating other signaling pathways [13, 27]. Therefore, we carried out JAK2-specific shRNA vectors-mediated loss-of-function studies of JAK2 in SGC7901 GC cells.
Discussion In recent years, numerous genes and signal pathways have been shown to be involved in gastric carcinogenesis [21],
123
168
Apoptosis and its related genes have a profound effect on the malignant phenotype in tumor [28]. Previous reports implied that the decreased cancer cell proliferation mediated by JAK2 inhibition depended on the increased apoptosis and/or cell cycle arrest [7, 29–31]. And control of cell proliferation is important for cancer prevention, since cell proliferation has essential roles in carcinogenesis, not only in the process of initiation but also in the process of progression [32]. However, in this study, our results demonstrate that silencing JAK2 with specific shRNA inhibited cell proliferation, but did not significantly induce apoptosis in SGC7901 cells, suggesting inhibition of cell proliferation in JAK2 shRNA-transfected cells might not be attributed to induction of apoptosis. Moreover, although JAK2 silencing inhibited cell proliferation, the decrease in number of colonies in shJAK2-transfected group (about 50 % decrease) was not completely consistent with the changes in the proliferation in shJAK2-transfected group (10–20 % decrease), suggesting that JAK2 silencing may also affect other malignant properties (e.g., cell adhesion) of SGC7901 cells. Several investigations have revealed that JAK2 exhibits various roles in cell cycle distribution in cancers [33, 34]. In our present study, specific down-regulation JAK2 by shRNA resulted in cell cycle arrest at G2/M phase, accompanied with down-regulation of cyclin D1, one of cell cycle-related regulators [35], providing evidence that the effects of JAK2 silencing on the GC cell proliferation are mainly attributed to G2/M arrest, at least partly, via down-regulation of cyclin D1. Moreover, our present study indicates that inactivation of ERK1/2 by PD98059 enhanced JAK2 shRNA-induced p21WAF1/CIP1 protein expression, leading to down-regulation of cyclin D1 and Bcl-2. Previous studies have shown that p21WAF1/CIP1 is a potent inhibitor of cyclin-dependent kinases and capable of inducing cell cycle arrest and/or apoptosis [36, 37]. Thoennissen et al. [38] reported that JAK2 signaling is involved in the regulation of p21WAF1/CIP1 expression in pancreatic cancer cells. Meanwhile, both Bcl-2 and cyclin D1 genes have been confirmed to be target genes of JAK2 signaling pathway [30]. Apoptosis could be a direct consequence of replication stress induced by cell cycle arrest [39]. Therefore, we speculate that the increased p21WAF1/ CIP1 and decreased cyclin D1 and Bcl-2 expressions may, at least partly, contribute to increased cell cycle arrest or/and apoptosis enhanced by combination of PD98059 and JAK2 shRNA. ERK1/2 is usually considered a pro-survival signaling [40–42] and plays important roles in the cellular response to DNA damage [43]. Besides a central role in the control of cell proliferation and survival, ERK1/2 activity is necessary for cell cycle progression and regulates cell cyclerelated genes [44]. Interestingly, our present study
123
Mol Cell Biochem (2014) 387:159–170
indicates JAK2 silencing induced activation of ERK1/2. A previous study showed that activation of ERK1/2 involves the induction of S phase arrest and cell apoptosis [45]. And it has also been reported that ERK1/2 promoted progression through the G2/M phase of the cell cycle [46]. Not until recently has it been found that small molecule inhibitors of JAK2 may have negative or positive effects on the activation of ERK1/2 [15, 16, 47], suggesting that there may be a feedback loop between JAK2 and ERK1/2. Our present study has shown that the ERK1/2 specific inhibitor PD98059 blocked JAK2 shRNA-induced ERK1/2 activation, and enhanced the cell cycle arrest and induced cell apoptosis in JAK2 shRNA-transfected SGC7901 cells, suggesting that activation of ERK1/2 might protection GC cells from cell proliferation inhibition and cell cycle arrest induced by JAK2 silencing. Moreover, there was a significant antitumor effect with JAK2 shRNA/PD98059 combination after around 32 days of treatment, which means that PD98059 could enhance the anti-tumor activity of JAK2 shRNA in vivo. However, whether the combination is an effective strategy for treatment of GC needs further investigation. Nevertheless, it remains undetermined by what mechanism ERK1/2 signaling is activated in response to JAK2 silencing. A previous study suggests an involvement of the release of cytochrome c into the cytosol in ERK1/2 activation induced by JAK2 inhibitor AG490 in hepatocytes, which are probably generated by translocation of Bim, a BH-3-only member of the Bcl-2 family [15]. Therefore, the signaling mechanism through which ERK1/2 activation is induced by JAK2 silencing needs further investigation. In summary, we have here confirmed that JAK2 expression may be involved in malignant growth and proliferation in GC. Specific silencing of JAK2 significantly inhibited proliferation of GC cell SGC7901 in vitro, at least in part by inducing G2/M arrest rather than cell apoptosis. JAK2 silencing significantly induced ERK1/2 activation, which might protect GC cells from JAK2 silencing-induced biological effects. Ultimately, combination of ERK1/2 inhibitor PD98059 and JAK2 shRNA resulted in suppression of tumor growth in vitro and in vivo by enhancing apoptosis and cell cycle arrest. Taken together, our findings indicate that JAK2 and ERK1/2 combination may be used as a novel effective gene therapeutic strategy in GC. However, further investigation will be designed to elucidate the exact mechanism by which ERK1/2 inhibition affects cell proliferation, apoptosis, and cell cycle in GC cells with JAK2 silencing. Acknowledgments This work was financially supported by the grants from the National Basic Research Program of China (973 Program) (2012CB945004), National Natural Science Foundation of China (Nos. 81071961, 81001113, and 81101838), and Science Foundation of Zhejiang Health Bureau (No. 2012KYB111).
Mol Cell Biochem (2014) 387:159–170 Conflict of interest
All authors declare no conflict of interest.
References 1. Shridhar R, Almhanna K, Hoffe SE, Fulp W, Weber J, Chuong MD, Meredith KL (2013) Increased survival associated with surgery and radiation therapy in metastatic gastric cancer: a Surveillance, Epidemiology, and End Results database analysis. Cancer 119(9):1636–1642 2. Smyth EC, Cunningham D (2012) Targeted therapy for gastric cancer. Curr Treat Options Oncol 13(3):377–389 3. Seavey MM, Dobrzanski P (2012) The many faces of Janus kinase. Biochem Pharmacol 83(9):1136–1145 4. Waters MJ, Brooks AJ (2012) Growth hormone and cell growth. Endocr Dev 23:86–95 5. Zhang L, Yang J, Qian J, Li H, Romaguera JE, Kwak LW, Wang M, Yi Q (2012) Role of the microenvironment in mantle cell lymphoma: IL-6 is an important survival factor for the tumor cells. Blood 120(18):3783–3792 6. Zhuang G, Wu X, Jiang Z, Kasman I, Yao J, Guan Y, Oeh J, Modrusan Z, Bais C, Sampath D, Ferrara N (2012) Tumoursecreted miR-9 promotes endothelial cell migration and angiogenesis by activating the JAK-STAT pathway. EMBO J 31(17): 3513–3523 7. Xiong H, Zhang ZG, Tian XQ, Sun DF, Liang QC, Zhang YJ, Lu R, Chen YX, Fang JY (2008) Inhibition of JAK1, 2/STAT3 signaling induces apoptosis, cell cycle arrest, and reduces tumor cell invasion in colorectal cancer cells. Neoplasia 10(3):287–297 8. Hedvat M, Huszar D, Herrmann A, Gozgit JM, Schroeder A, Sheehy A, Buettner R, Proia D, Kowolik CM, Xin H, Armstrong B, Bebernitz G, Weng S, Wang L, Ye M, McEachern K, Chen H, Morosini D, Bell K, Alimzhanov M, Ioannidis S, McCoon P, Cao ZA, Yu H, Jove R, Zinda M (2009) The JAK2 inhibitor AZD1480 potently blocks Stat3 signaling and oncogenesis in solid tumors. Cancer Cell 16(6):487–497 9. Yang J, Ikezoe T, Nishioka C, Furihata M, Yokoyama A (2010) AZ960, a novel Jak2 inhibitor, induces growth arrest and apoptosis in adult T-cell leukemia cells. Mol Cancer Ther 9(12): 3386–3395 10. Couto JP, Almeida A, Daly L, Sobrinho-Simo˜es M, Bromberg JF, Soares P (2012) AZD1480 blocks growth and tumorigenesis of RET-activated thyroid cancer cell lines. PLoS One 7(10):e46869 11. Harry BL, Eckhardt SG, Jimeno A (2012) JAK2 inhibition for the treatment of hematologic and solid malignancies. Expert Opin Investig Drugs 21(5):637–655 12. Lee HJ, Daver N, Kantarjian HM, Verstovsek S, Ravandi F (2013) The role of JAK pathway dysregulation in the pathogenesis and treatment of acute myeloid leukemia. Clin Cancer Res 19(2):327–335 13. Gu Y, Zou Y, Aikawa R, Hayashi D, Kudoh S, Yamauchi T, Uozumi H, Zhu W, Kadowaki T, Yazaki Y, Komuro I (2001) Growth hormone signalling and apoptosis in neonatal rat cardiomyocytes. Mol Cell Biochem 223(1–2):35–46 14. Godeny MD, Sayeski PP (2007) Jak2 tyrosine kinase and cancer: how good cells get HiJAKed. Anticancer Agents Med Chem 7(6):643–650 15. Kwak HB, Sun HM, Ha H, Lee JH, Kim HN, Lee ZH (2008) AG490, a Jak2-specific inhibitor, induces osteoclast survival by activating the Akt and ERK signaling pathways. Mol Cells 26(5): 436–442 16. Derenzini E, Lemoine M, Buglio D, Katayama H, Ji Y, Davis RE, Sen S, Younes A (2011) The JAK inhibitor AZD1480 regulates proliferation and immunity in Hodgkin lymphoma. Blood Cancer J 1(12):e46
169 17. Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M, Donato NJ (2010) Deubiquitinase inhibition by small-molecule WP1130 triggers aggresome formation and tumor cell apoptosis. Cancer Res 70(22):9265–9276 18. Yao J, Qian CJ, Ye B, Zhang X, Liang Y (2012) ERK inhibition enhances TSA-induced gastric cancer cell apoptosis via NF-jBdependent and Notch-independent mechanism. Life Sci 1(5–6):186–193 19. Chen C, Chang YC, Liu CL, Chang KJ, Guo IC (2006) Leptininduced growth of human ZR-75-1 breast cancer cells is associated with up-regulation of cyclin D1 and c-Myc and down-regulation of tumor suppressor p53 and p21WAF1/CIP1. Breast Cancer Res Treat 98(2):121–132 20. Ting CM, Wong CK, Wong RN, Lo KW, Lee AW, Tsao GS, Lung ML, Mak NK (2012) Role of STAT3/5 and Bcl-2/xL in 2-methoxyestradiol-induced endoreduplication of nasopharyngeal carcinoma cells. Mol Carcinog 51(12):963–972 21. Almhanna K (2012) Targeted therapy for gastric adenocarcinoma. Adv Pharmacol 65:437–470 22. Ransohoff RM (1998) Cellular responses to interferons and other cytokines: the JAK-STAT paradigm. N Engl J Med 338(9): 616–618 23. Coelho WS, Sola-Penna M (2013) Serotonin regulates 6-phosphofructo-1-kinase activity in a PLC-PKC-CaMK II- and Janus kinase-dependent signaling pathway. Mol Cell Biochem 372(1–2):211–220 24. Verstovsek S (2009) Therapeutic potential of JAK2 inhibitors. Hematology Am Soc Hematol Educ Program 2009:636–642 25. Scott LM, Rebel VI (2012) JAK2 and genomic instability in the myeloproliferative neoplasms: a case of the chicken or the egg? Am J Hematol 87(11):1028–1036 26. Ding L, Xu Y, Zhang W, Deng Y, Si M, Du Y, Yao H, Liu X, Ke Y, Si J, Zhou T (2010) MiR-375 frequently downregulated in gastric cancer inhibits cell proliferation by targeting JAK2. Cell Res 20(7):784–793 27. Quinta´s-Cardama A, Kantarjian H, Cortes J, Verstovsek S (2011) Janus kinase inhibitors for the treatment of myeloproliferative neoplasias and beyond. Nat Rev Drug Discov 10(2):127–140 28. Lowe SW, Lin AW (2000) Apoptosis in cancer. Carcinogenesis 21(3):485–495 29. Yu RX, Hu XM, Xu SQ, Jiang ZJ, Yang W (2011) Effects of fucoxanthin on proliferation and apoptosis in human gastric adenocarcinoma MGC-803 cells via JAK/STAT signal pathway. Eur J Pharmacol 657(1–3):10–19 30. Um HJ, Min KJ, Kim DE, Kwon TK (2012) Withaferin A inhibits JAK/STAT3 signaling and induces apoptosis of human renal carcinoma Caki cells. Biochem Biophys Res Commun 427(1): 24–29 31. Kim MJ, Nam HJ, Kim HP, Han SW, Im SA, Kim TY, Oh DY, Bang YJ (2013) OPB-31121, a novel small molecular inhibitor, disrupts the JAK2/STAT3 pathway and exhibits an antitumor activity in gastric cancer cells. Cancer Lett 335(1):145–152 32. Gupta SC, Kim JH, Prasad S, Aggarwal BB (2010) Regulation of survival, proliferation, invasion, angiogenesis, and metastasis of tumor cells through modulation of inflammatory pathways by nutraceuticals. Cancer Metastasis Rev 29(3):405–434 33. Park JH, Darvin P, Lim EJ, Joung YH, Hong DY, Park EU, Park SH, Choi SK, Moon ES, Cho BW, Park KD, Lee HK, Kim MJ, Park DS, Chung IM, Yang YM (2012) Hwanggeumchal sorghum induces cell cycle arrest, and suppresses tumor growth and metastasis through Jak2/STAT pathways in breast cancer xenografts. PLoS One 7(7):e40531 34. Sai K, Wang S, Balasubramaniyan V, Conrad C, Lang FF, Aldape K, Szymanski S, Fokt I, Dasgupta A, Madden T, Guan S, Chen Z, Alfred Yung WK, Priebe W, Colman H (2012) Induction of cell-cycle arrest and apoptosis in glioblastoma stem-like cells
123
170
35.
36.
37.
38.
39.
40.
Mol Cell Biochem (2014) 387:159–170 by WP1193, a novel small molecule inhibitor of the JAK2/ STAT3 pathway. J Neurooncol 107(3):487–501 Zhang X, Min KW, Wimalasena J, Baek SJ (2012) Cyclin D1 degradation and p21 induction contribute to growth inhibition of colorectal cancer cells induced by epigallocatechin-3-gallate. J Cancer Res Clin Oncol 138(12):2051–2060 Rosendahl AH, Sun C, Wu D, Andersson R (2012) Polysaccharide-K (PSK) increases p21(WAF/Cip1) and promotes apoptosis in pancreatic cancer cells. Pancreatology 12(6):467–474 Russo A, Esposito D, Catillo M, Pietropaolo C, Crescenzi E, Russo G (2013) Human rpL3 induces G1/S arrest or apoptosis by modulating p21 (waf1/cip1) levels in a p53-independent manner. Cell Cycle 12(1):76–87 Thoennissen NH, Iwanski GB, Doan NB, Okamoto R, Lin P, Abbassi S, Song JH, Yin D, Toh M, Xie WD, Said JW, Koeffler HP (2009) Cucurbitacin B induces apoptosis by inhibition of the JAK/ STAT pathway and potentiates antiproliferative effects of gemcitabine on pancreatic cancer cells. Cancer Res 69(14):5876–5884 Noonan EM, Shah D, Yaffe MB, Lauffenburger DA, Samson LD (2012) O6-Methylguanine DNA lesions induce an intra-S-phase arrest from which cells exit into apoptosis governed by early and late multi-pathway signaling network activation. Integr Biol (Camb) 4(10):1237–1255 McCubrey JA, Steelman LS, Chappell WH, Abrams SL, Wong EW, Chang F, Lehmann B, Terrian DM, Milella M, Tafuri A, Stivala F, Libra M, Basecke J, Evangelisti C, Martelli AM,
123
41. 42.
43. 44.
45.
46.
47.
Franklin RA (2007) Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Biochim Biophys Acta 1773(8):1263–1284 Dhillon AS, Hagan S, Rath O, Kolch W (2007) MAP kinase signalling pathways in cancer. Oncogene 26(22):3279–3290 Kohno M, Tanimura S, Ozaki K (2011) Targeting the extracellular signal-regulated kinase pathway in cancer therapy. Biol Pharm Bull 34(12):1781–1784 Dent P, Yacoub A, Fisher PB, Hagan MP, Grant S (2003) MAPK pathways in radiation responses. Oncogene 22(37):5885–5896 Xu XL, Huang YJ, Wang YQ, Chen XF, Zhang W (2011) 2,3,40 ,5-Tetrahydroxystilbene-2-O-b-D-glucoside inhibits platelet-derived growth factor-induced proliferation of vascular smooth muscle cells by regulating the cell cycle. Clin Exp Pharmacol Physiol 38(5):307–313 Li L, Chen DB, Lin C, Cao K, Wan Y, Zhao XY, Nie CL, Yuan Z, Wei YQ (2013) hPNAS-4 inhibits proliferation through S phase arrest and apoptosis: underlying action mechanism in ovarian cancer cells. Apoptosis 18(4):467–479 Kolb RH, Greer PM, Cao PT, Cowan KH, Yan Y (2012) ERK1/2 signaling plays an important role in topoisomerase II poisoninduced G2/M checkpoint activation. PLoS One 7(11):e50281 Sun Y, Moretti L, Giacalone NJ, Schleicher S, Speirs CK, Carbone DP, Lu B (2011) Inhibition of JAK2 signaling by TG101209 enhances radiotherapy in lung cancer models. J Thorac Oncol 6(4):699–706
ERK1/2 inhibition enhances apoptosis induced by JAK2 silencing in human gastric cancer SGC7901 cells Cuijuan Qian • Jun Yao • Jiji Wang • Lan Wang • Meng Xue • Tianhua Zhou Weili Liu • Jianmin Si
•
Received: 25 August 2013 / Accepted: 18 October 2013 / Published online: 1 November 2013 Ó Springer Science+Business Media New York 2013
Abstract Recent studies suggest JAK2 signaling may be a therapeutic target for treatment of gastric cancer (GC). However, the exact roles of JAK2 in gastric carcinogenesis are not very clear. Here, we have targeted JAK2 to be silenced by shRNA and investigated the biological functions and related mechanisms of JAK2 in GC cell SGC7901. In this study, JAK2 is commonly highly expressed in GC tissues as compared to their adjacent normal tissues (n = 75, p \ 0.01). Specific down-regulation of JAK2 suppressed cell proliferation and colonyforming units, induced G2/M arrest in SGC7901 cells, but had no significant effect on cell apoptosis in vitro or tumor growth inhibition in vivo. Interestingly, JAK2 silencinginduced activation of ERK1/2, and inactivation of ERK1/2 using the specific ERK inhibitor PD98059 markedly enhanced JAK2 shRNA-induced cell proliferation inhibition, cell cycle arrest and apoptosis. Ultimately,
Cuijuan Qian and Jun Yao contributed equally to this study. C. Qian J. Wang L. Wang M. Xue W. Liu (&) J. Si (&) Institute of Gastroenterology, Sir Run Run Shaw Hospital, Zhejiang University, Hangzhou 310016, Zhejiang, People’s Republic of China e-mail: [email protected] J. Si e-mail: [email protected] J. Yao Institute of Tumor, School of Medicine, Taizhou University, Taizhou, Zhejiang, People’s Republic of China T. Zhou Department of Cell Biology and Program in Molecular Cell Biology, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China
combination of PD98059 and JAK2 shRNA significantly inhibited tumor growth in nude mice. Our results implicate JAK2 silencing-induced cell proliferation inhibition, cell cycle arrest, and ERK1/2 inhibition could enhance apoptosis induced by JAK2 silencing in SGC7901 cells. Keywords cancer
JAK2 ERK1/2 shRNA Gastric
Introduction Although the incidence and mortality rates associated with gastric cancer (GC) have gradually decreased recently, GC remains to be one of significant causes of cancer-related mortality in the world [1]. Improvements in the diagnosis and treatment of GC are largely dependent on a further understanding of gastric carcinogenesis. In recent years, researches on targeted therapy of GC have achieved certain progress. However, the prognosis of advanced GC is still very poor [2]. Janus-associated kinase 2 (JAK2) signaling pathway, one of pro-oncogenic signaling pathways, plays a key role in regulation of cell functions via regulation of genes involved in cell proliferation [3, 4], apoptosis and survival [5], and angiogenesis [6]. JAK2 is strikingly elevated in the majority of cancers in comparison with adjacent benign tissues and associated with cancer growth and metastasis, so drugs that target JAK2 may be useful in the management of a variety of cancers, such as myeloproliferative neoplasms, T cell leukemia, prostate, ovarian, breast, thyroid and colorectal cancer, etc. [7–12]. However, none of these drugs have been undergoing clinical evaluation or approved for treatment of GC. On the other hand, the specificity of JAK2 inhibitors (e.g., AG490, TG101209) has been questioned for a long time [7, 13, 14], so we
123
160
Mol Cell Biochem (2014) 387:159–170
conducted this work to investigate the exact role of JAK2 in GC and provide more basis for rational molecular-targeted therapies. Therefore, to clarify this, we specifically silenced JAK2 by a short-hairpin RNAs (shRNA) in human GC SGC7901 cells to explore the exact effects and mechanisms underlying specific down-regulation of JAK2 in vitro and in vivo. Moreover, there are emerging and conflicting reports about cross-talk between JAK2 and extracellular signalregulated kinase 1 and 2 (ERK1/2) signaling pathways in different cell types [15, 16], but to date, no research has been reported on the relationship of this two important pathways in GC. Therefore, the purpose of this study was further to explore the mechanism of cross-talk between JAK2 and ERK1/2 signaling pathways in GC. In this study, we provide evidence that ERK1/2 activation may be related to evasion of apoptosis in JAK2silenced SGC7901 GC cells and put forward that JAK2 silencing combined with ERK1/2 inhibitors may serve as a new approach to treat GC.
Roche Benchmark XT, containing 75 gastric carcinoma samples. Tumor staging was judged by two senior pathologists using the tumor-node-metastasis classification system according to the protocol of International Union Against Cancer. The DAKO EnVision system (DAKO, Carpinteria, CA) was used for measure the immunohistochemical expression of JAK2. All images (9200) were photographed and analyzed with an Aperio scanner (USC). Both the percentage of positive tumor cells and the intensity of staining were independently assessed by two observers in a semiquantitative fashion. The percentage of positive tumor cells was scored as follows: 0–5 % = 0; 5–25 % = 1; 26–50 % = 2; 51–75 % = 3; [75 % = 4. Intensity of staining was graded as follows: no staining = 0; weakly staining = 1; moderately positive staining = 2; densely staining = 3. Finally, the slide was assigned a total score based on both results which range from 0 to 12. If the relative score of cancer and corresponding normal adjacent tissue is greater than zero, that means positive expression of JAK2.
Materials and methods
Construction of expression vectors and stable transfection of SGC7901 cells
Cell culture and mice The GC cell line SGC7901 (ATCC, Manassas, VA, USA) were cultured in complete RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10 % fetal bovine serum, 100 units/ml penicillin, and 100 lg/ml streptomycin, and incubated at 37 °C with 5 % CO2 and 95 % humidity. 3–4week-old female athymic nude mice were purchased from the Shanghai Laboratory Animal Co. Ltd (Shanghai, China). Reagents and antibodies Dimethyl sulfoxide (DMSO) and 40 ,6-diamidino-2-phenylindole (DAPI) were purchased from Sigma-Aldrich Chemical (St. Louis, MO, USA). The MAPK/ERK pathway inhibitor 2-(2-diamino-3-methoxyphenyl-4H-1-benzopyran4-one (PD98059) was purchased from Beyotime Institute of Biotechnology (Hangzhou, China). Primary antibodies against JAK2, ERK1/2, and phospho-ERK1/2 (Thr202/ Tyr204) were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). Primary antibody against GAPDH was obtained from GoodHere Technology (Hangzhou, China). Anti-rabbit IgG, HRP-linked antibody (7074) was also purchased from Cell Signaling Technology. Tissue array Evaluation of JAK2 expression by immunohistochemistry was done on a tissue array (OD-CT-DgSt m01-014) using
123
The JAK2-shRNA pGPU6/GFP/Neo-JAK2-shRNA and control shRNA expression vector pGPU6/GFP/Neo-shNC have been constructed. Briefly, two oligonucleotides 50 -CA CCGCGAATAAGGTACAGATTTCGTTCAAGAGACG AAATCTGTACCTTATTCGCTTTTTTG-30 and 50 -GATC CAAAAAAGCGAATAAGGTACAGATTTCGTCTCTT GAACGAAATCTGTACCTTATTCGC-30 were annealed and introduced into the pGPU6/GFP/Neo vector and referred to as shJAK2. A scrambled shRNA expression vector was used as the negative control (which was referred to as control shRNA). SGC7901 cells were seeded in 12-well plate for 24 h and transfected with JAK2 shRNA or control shRNA using LipofectamineÒ 2000 reagent (Invitrogen, Carlsbad, USA). Cells were transferred in selection medium containing geneticin (G418; 400 lg/ml) after transfection for 48 h. G418 resistant colonies were selected for another 14 days. After confirming the transfection effect at the mRNA and protein level, the surviving colonies were continuously selected with G418 to generate stable cell lines by expanding culture. Total RNA and quantitative real-time PCR Total RNA were extracted with Trizol Reagent (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instruction, and were quantitated on a NanoDrop 1000 spectrophotometer (Nanodrop, Wilmington, DE, USA). 1 lg of total RNA was reversed using Reverse Transcription System (Promega, Madison, WI, USA). The mRNA expression
Mol Cell Biochem (2014) 387:159–170
levels of JAK2 were determined by quantitative RT-PCR (qPCR) using SYBR Green Master Mix Kit (TaKaRa Schuzo, Tokyo, Japan) in a Lightcycler 480 system (Roche Diagnostics, Brussels, Belgium). GAPDH was used as an internal control, and the mRNA expression levels of JAK2 were evaluated using the 2-DDCT method. The primer pairs were designed as follows, JAK2 (forward: ACACTGGGG AGGTGGTCGCT, reverse: ACGCCGACCAGCACTGTAGC) and GAPDH (forward: TGCACCACCAACTGCT TAGC, reverse: GGCATGGACTGTGGTCATGAG).
Western blot analysis Total proteins were extracted using RAPI lysis buffer (1 % Triton X-100, 0.5 % sodium deoxycholate, 0.1 % SDS, 150 mM NaCl, 50 mM Tris/HCl (pH 7.2), 10 mM EDTA), which contained 50 lM leupeptin, 1 mM sodium orthovanadate, 1 mM sodium fluoride, and 1 mM phenylmethylsulphonyl fluoride (PMSF). Lysates were resolved on SDS-PAGE gel and transferred to PVDF membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5 % BSA in TBS-T, and incubated with primary antibody overnight at 4 °C, and then incubated with the secondary antibody. The blots were developed using a Fujifilm LAS-4000 chemiluminescent imaging system (Fujifilm, Tokyo, Japan). Cell proliferation assay Cell proliferation was detected by Cell Titer 96Ò AQueous One Solution Cell Proliferation Assay (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instruction. Briefly, stable transfected cells (2.5 9 103/ well) were seeded into 96-well plates and treated as indicated with or without PD98059 for proper time. Replicates of five were used for each point. After incubation with CellTiter 96 Aqueous One Solution reagent for 2 h, the absorbance was measured at 490 nm (Bio-Rad Systems, Hercules, CA, USA). Cell apoptosis and cell cycle analysis Cell apoptosis were measured using the Annexin V-PE/7AAD Apoptosis Detection Kit (Becton, Dickinson and Company, USA) according to the manufacturer’s instruction. Briefly, stably transfected cells were incubated with or without indicated treatments for the desired time. And attached and floating cells were pooled, pelleted by centrifugation, washed twice with cold PBS, and then resuspended in 19 binding buffer [10 mM hydroxyethyl piperazine ethanesulfonic acid (HEPES), pH 7.4, 140 mM
161
NaOH, and 2.5 mM CaCl2] at a concentration of 1 9 106 cells/ml. 1 9 105 cells were transferred to a 5-ml culture tube, and stained with 5 ll of Annexin V-PE and 5 ll of 7-AAD for 15 min at room temperature in the dark. Finally, 400 ll of 19 binding buffer were added to each tube, and the apoptotic cells were determined using a FACScan flow cytometry (BD, Franklin Lakes, NJ, USA). Meanwhile, the same treated cells were harvested for cell cycle distribution assay using the Cell Cycle Staining Kit (MultiSciences Biotech Co., Ltd., Hangzhou, China). Briefly, cells were stained with 300 ll of DNA staining solution and 3 ll permeabilization solution for 30 min at room temperature in dark, and the cells were then analyzed by a BD FACSCalibur flow-cytometer provided with the MOD-Fit 3.0 software (Verity Software House Increase, Topsham, ME, USA). Nuclear staining assay Cells were cultured on 22 mm 9 22 mm glass coverslips in 6-well plates at a density of 2 9 105 per well, and incubated with or without indicated treatments for the desired time. For nuclear staining assay, cells were fixed with 4 % cold paraformaldehyde (pH 7.4) and stained with 0.5 lg/ml DAPI for 5 min at room temperature. The coverslips were rinsed with PBS and mounted onto slides with a fluorescent mounting medium. Images were acquired with the fluorescence microscope. Cell colony formation assay Cells were plated at a density of 40 cells/cm2 in 6-well plates and incubated for 14 days. The medium were changed every 2 days. Cells were fixed with methanol and stained with 0.1 % crystal violet. Visible colonies containing at least 50 cells were counted. Xenograft tumor model All animal experiments were approved by the Institutional Animal Care and Use Committee of Zhejiang University, and the study was approved by the Ethics Committee of Zhejiang University. SGC7901 cells transfected with JAK2 shRNA or control shRNA (5 9 106 cells) were injected subcutaneously into the flank of 4-week-old female athymic nude mice. When tumors became palpable (-100 mm3) after implantation of tumor cells, animals were randomly assigned to different treatment groups (n = 6 in each group). For PD98059 treatment, animals were injected intraperitoneally with PD98059 (10 mg/kg) once every 3 days for three times in total. Tumor size was assessed every 3 days. Tumor volume was calculated according to the following formula: volume (mm3) = (width2 9 length)/2. The mice were
123
162
Mol Cell Biochem (2014) 387:159–170
Fig. 1 Analysis of JAK2 expression in human gastric carcinomas. Immunohistochemical staining for JAK2 in gastric adenocarcinoma (grades I–III) and their normal counterparts (n = 75) was detected using monoclonal antibody to human JAK2 (1:100 dilution). The brown signals represent positive staining for JAK2 (original
magnifications 9200) (a). The results of immunohistochemical staining for JAK2 were scored and relative expression of JAK2 in 75 primary gastric cancer tissues compared with their pair-matched adjacent non-tumor tissues were illustrated (b). (Color figure online)
euthanized and the tumors were subjected to hematoxylin– eosin (HE) staining.
Results JAK2 is commonly highly expressed in GC tissues
Statistical analysis All data were shown as mean ± SE. v2 test was used to assess the difference between two rates, Student’s t test was applied to analyze the difference between groups, and difference among groups was analyzed by one-way ANOVA and Student–Newman–Keuls (SNK)-q test using a SPSS 16.0 for Windows (SPSS Inc., Chicago, IL, USA). p \ 0.05 was considered statistically significant.
123
Immunohistochemical analyses from gastric tissue array (n = 75) demonstrated that both normal and tumor tissues expressed JAK2, but 50 specimens of gastric carcinoma tissues (50/75, 66.67 %) expressed high levels of JAK2 when compared to their paired corresponding adjacent normal tissues (p \ 0.01) (Fig. 1a, b), suggesting JAK2 may play an important role in gastric carcinogenesis.
Mol Cell Biochem (2014) 387:159–170
163
Fig. 2 Effects of JAK2 down-regulation on cell proliferation of SGC7901 cells. Cells were transfected with a control shRNA or a shRNA directed against JAK2. JAK2 expressions were evaluated by quantitative RT-PCR (a) and Western blot (b). Cell proliferation of SGC7901 cells were evaluated by MTS assay (c). Representative photographs of monolayer colony formation of SGC7901 cells
transfected with JAK2 shRNA and control shRNA (d). The chart represents the mean number of colony-forming units in three independent experiments (e). All data presented are mean ± SE of three independent experiments performed in triplicate. *p \ 0.05, **p \ 0.01 versus control shRNA
Silence of JAK2 by shRNA decreases GC cell proliferation
a time-dependent manner as compared with control shRNA (p \ 0.05). Furthermore, the number of surviving colonies was significantly decreased in JAK2 shRNA-transfected cells as compared with control shRNA (Fig. 2d, e; p \ 0.01).
To evaluate the potential role of JAK2 silencing in cell proliferation, SGC7901 cells were transfected with JAK2specific shRNA vectors (JAK2 shRNA), and the expression of JAK2 shRNA in stably transfected cells was assessed by quantitative RT-PCR and Western blot. As observed, JAK2 shRNA induced a significant decrease in JAK2 mRNA expression (Fig. 2a; p \ 0.01), accompanied with an evident down-regulation of JAK2 protein expression (Fig. 2b). The results confirmed that JAK2 shRNA significantly down-regulated JAK2 expressions in SGC7901 cells as compared with control shRNA. Results of MTS assay were shown in Fig. 2c, shRNAmediated specific JAK2 down-regulation resulted in significant inhibition of cell proliferation of SGC7901 cells in
Silence of JAK2 by shRNA does not affect apoptosis, but induces cell cycle arrest JAK2 inhibition with small molecule inhibitors that target aberrant JAK2 activity has been shown to induce apoptosis in some cell models such as lymphoma and pancreatic cancer cells during early embryonic stem cell neurogenesis [9, 17]. In this study, we tested the effect of specific downregulation of JAK2 with shRNA on SGC7901 cell apoptosis by performing an annexinV-PE/7-amino-actinomycin
123
164
Mol Cell Biochem (2014) 387:159–170
Fig. 3 Effects of down-regulation of JAK2 signaling on cell apoptosis and cell cycle distributions of SGC7901 cells. Flow cytometry analyses of cell apoptosis and cell cycle distributions in SGC7901 cells transfected with JAK2 shRNA were detected. Representative results of cell apoptosis (a) and cell cycle (c) were
showed. Bar graphs demonstrated the percentage of apoptotic rates (b) and cells in G2/M phase (d). All data represent the average of three independent experiments in duplicate. *p \ 0.05 versus control shRNA
D (7-AAD) assay. However, there was no significant difference between JAK2 shRNA and control shRNA groups (Fig. 3a, b; p [ 0.05). In order to gain insights into the mechanism of the antiproliferative activity of JAK2 silencing, flow cytometry analyses were used to determine cell cycle distributions. As shown in Fig. 3c, d, the proportion of G2/M phase in JAK2 shRNA-transfected cells was significantly increased as compared with control shRNA (p \ 0.05), suggesting that JAK2 may be involved in SGC7901 cell proliferation by regulating the cell cycle progression.
(Fig. 5d). In order to explore the possible relationship of JAK2 and ERK1/2 signaling, we next used specific ERK inhibitor to inhibit JAK2 silencing-induced ERK1/2 activation. We have previously reported that incubation with 50 lM PD98059 resulted in maximal inhibition of ERK1/2 phosphorylation in log-phase growing SGC7901 cells [18]. As shown in Fig. 4a, inhibition of ERK1/2 signaling by specific inhibitor PD98059 enhanced JAK2 shRNAinduced cell proliferation inhibition (p \ 0.01), while no statistical difference was found between JAK2 shRNA and PD98059 groups (p [ 0.05). Moreover, JAK2 shRNA combined with PD98059 resulted in significant apoptosis compared to JAK2 shRNA or PD98059 alone (Fig. 4c, d; p \ 0.01). In addition, apoptotic cells show the characteristic morphological changes that include chromatin condensation, nuclear fragmentation, so the apoptosis was also tested using DAPI nuclear staining. We found that the SGC7901 cells exposed
ERK1/2 inhibition enhances JAK2 shRNA-induced cell proliferation inhibition, and causes apoptosis Interestingly, there was an evident activation of ERK1/2 after JAK2 shRNA transfection in SGC7901 cells
123
Mol Cell Biochem (2014) 387:159–170
165
Fig. 4 Effects of JAK2 shRNA and PD98059 combination on cell proliferation and apoptosis of SGC7901 cells. Cell proliferation of indicated treatments was evaluated by MTS (a). DAPI staining of cells were done and then observed under a fluorescence microscope (9100 magnification) (b). Representative results of flow cytometry
analysis for apoptosis were demonstrated (c) and bar graphs depicted the percentage of apoptotic rates (d). All data represent mean ± SE of three independent experiments performed in triplicate. *p \ 0.05, **p \ 0.01 versus control shRNA; #p \ 0.05, ##p \ 0.01 versus JAK2 shRNA alone; $p \ 0.05, $$p \ 0.01 versus PD98059 alone
to JAK2 shRNA alone caused neither chromatin condensation nor nuclear fragmentation as compared with control shRNA, while combination of JAK2 shRNA and PD98059
showed increased chromatin condensation and nuclear fragmentation compared to JAK2 shRNA or PD98059 alone (Fig. 4b).
123
166
Mol Cell Biochem (2014) 387:159–170
Fig. 5 Effects of JAK2 shRNA and PD98059 combination on cell cycle and related gene expression of SGC7901 cells. Representative results of flow cytometry analysis for cell cycle distribution were demonstrated (a). Bar graphs depicted the percentage of cells in G2/ M phases (b) and S phases (c). All data represent mean ± SE of three
independent experiments performed in triplicate. Related gene expression were detected by Western blot (d). *p \ 0.05, **p \ 0.01 versus control shRNA; #p \ 0.05 versus JAK2 shRNA alone; $p \ 0.05 versus PD98059 alone
Inhibition of ERK1/2 enhances JAK2 shRNA-induced cell cycle arrest and regulates downstream gene expression
PD98059 compared to control groups (Fig. 5d). Interestingly, JAK2 shRNA-induced up-regulation of p21WAF1/CIP1 was strikingly increased by combination with PD98059 (Fig. 5d). Meanwhile, Bcl-2 was slightly down-regulated by JAK2 shRNA, while cyclin D1 was significantly down-regulated by JAK2 shRNA (Fig. 5d). Moreover, JAK2 shRNA-induced down-regulation of Bcl-2 and cyclin D1 was strikingly enhanced by combination with PD98059 (Fig. 5d).
Here, we examined the effects of PD98059 on JAK2 silencing-induced cell cycle arrest. As shown in Fig. 5a, b, PD98059 significantly enhanced G2/M arrest induced by JAK2 shRNA (p \ 0.01). Moreover, JAK2 shRNA significantly enhanced S arrest induced by PD98059 (Fig. 5c; p \ 0.05). Since Bcl-2, p21WAF1/CIP1 and cyclin D1 are biologically relevant to JAK2 inhibition-induced apoptosis and cell cycle arrest in cancer cells [19, 20], we further focused on their expressions after JAK2 silencing and/or ERK1/2 inhibition in SGC7901 cells. The results demonstrated that the expression of p21WAF1/CIP1 was slightly up-regulated by JAK2 shRNA or
123
Combination of JAK2 shRNA and PD98059 significant inhibits tumor growth in vivo To further confirm the in vivo effects of JAK2 silencing, we established the GC solid tumor subcutaneously in nude mice model. Tumor size was calculated and shown in
Mol Cell Biochem (2014) 387:159–170
167
Fig. 6 Therapeutic effects of treatments on the SGC7901 cell xenografts formation in nude mice. a The figure represents daily surveillance of tumor size during the observation period, and each point represents mean ± SE. *p \ 0.05, **p \ 0.01 versus control shRNA cells; #p \ 0.05, ##p \ 0.01 versus JAK2 shRNA alone; $ p \ 0.05, $$p \ 0.01 versus PD98059 alone. SGC7901 cells stably expressing JAK2 shRNA or control shRNA were injected subcutaneously into the flank of athymic nude mice. On 11th day after
inoculation, mice bearing SGC7901 xenografts (-100 mm3) were injected intraperitoneally with 10 mg/kg PD98059 (PD) once every 3 days for three times in total, as indicated by the arrows. b Representative tumor masses were photographed with an ordinary camera. A ruler was served as a metrics. c Necrosis areas within tumor were shown by H&E staining observed with light microscope (9200 original magnifications)
Fig. 6a (n = 6 in each group). JAK2 shRNA alone had weak antitumor effect in vivo (Fig. 6a; p [ 0.05). However, compared to JAK2 shRNA or PD98059 alone, combination therapy with JAK2 shRNA and PD98059 led to significant antitumor effects in the nude mice (Fig. 6a, b; p \ 0.01). Tumor necrosis was observed under light microscope. Specifically, control shRNA or JAK2 shRNA group did not display evident tumor cell necrosis, and PD98059 group displayed necrosis interspersed with viable tumor cells, whereas JAK2 shRNA plus PD98059 group showed large areas of continuous necrosis within tumors (Fig. 6c). That is, the combination of JAK2 shRNA with PD98059 group displayed more severe necrosis than any other group (Fig. 6c), suggesting this combination may be a novel and effective antitumor treatment against GC in vivo.
but additional efforts are still needed to clarify the precise mechanisms of it. JAK2 kinase is one member of the JAK family and a key mediator of signaling downstream of a variety of growth factor and/or cytokine receptors [22, 23]. JAK2 may serve as a survival factor for myeloproliferative neoplasms [24, 25], and in our present study, JAK2 was upregulated in human GC tissues and cells. JAK2 inhibition may prevent disease progression by restricting hematologic malignant cell phenotypes; However, the exact role of JAK2 signaling in solid cancers is unclear [11]. Our previous study [26] has found that the JAK2 inhibitor AG490 could inhibit the GC cell proliferation, which supports the hypothesis that JAK2 may be an important oncogene in GC by directly or indirectly controlling the proliferation of GC cells. However, effects of specific silencing of JAK2 on GC cells are still unclear, because most current JAK2 inhibitors are multikinase inhibitors, which may reduce their specificity by inhibiting or activating other signaling pathways [13, 27]. Therefore, we carried out JAK2-specific shRNA vectors-mediated loss-of-function studies of JAK2 in SGC7901 GC cells.
Discussion In recent years, numerous genes and signal pathways have been shown to be involved in gastric carcinogenesis [21],
123
168
Apoptosis and its related genes have a profound effect on the malignant phenotype in tumor [28]. Previous reports implied that the decreased cancer cell proliferation mediated by JAK2 inhibition depended on the increased apoptosis and/or cell cycle arrest [7, 29–31]. And control of cell proliferation is important for cancer prevention, since cell proliferation has essential roles in carcinogenesis, not only in the process of initiation but also in the process of progression [32]. However, in this study, our results demonstrate that silencing JAK2 with specific shRNA inhibited cell proliferation, but did not significantly induce apoptosis in SGC7901 cells, suggesting inhibition of cell proliferation in JAK2 shRNA-transfected cells might not be attributed to induction of apoptosis. Moreover, although JAK2 silencing inhibited cell proliferation, the decrease in number of colonies in shJAK2-transfected group (about 50 % decrease) was not completely consistent with the changes in the proliferation in shJAK2-transfected group (10–20 % decrease), suggesting that JAK2 silencing may also affect other malignant properties (e.g., cell adhesion) of SGC7901 cells. Several investigations have revealed that JAK2 exhibits various roles in cell cycle distribution in cancers [33, 34]. In our present study, specific down-regulation JAK2 by shRNA resulted in cell cycle arrest at G2/M phase, accompanied with down-regulation of cyclin D1, one of cell cycle-related regulators [35], providing evidence that the effects of JAK2 silencing on the GC cell proliferation are mainly attributed to G2/M arrest, at least partly, via down-regulation of cyclin D1. Moreover, our present study indicates that inactivation of ERK1/2 by PD98059 enhanced JAK2 shRNA-induced p21WAF1/CIP1 protein expression, leading to down-regulation of cyclin D1 and Bcl-2. Previous studies have shown that p21WAF1/CIP1 is a potent inhibitor of cyclin-dependent kinases and capable of inducing cell cycle arrest and/or apoptosis [36, 37]. Thoennissen et al. [38] reported that JAK2 signaling is involved in the regulation of p21WAF1/CIP1 expression in pancreatic cancer cells. Meanwhile, both Bcl-2 and cyclin D1 genes have been confirmed to be target genes of JAK2 signaling pathway [30]. Apoptosis could be a direct consequence of replication stress induced by cell cycle arrest [39]. Therefore, we speculate that the increased p21WAF1/ CIP1 and decreased cyclin D1 and Bcl-2 expressions may, at least partly, contribute to increased cell cycle arrest or/and apoptosis enhanced by combination of PD98059 and JAK2 shRNA. ERK1/2 is usually considered a pro-survival signaling [40–42] and plays important roles in the cellular response to DNA damage [43]. Besides a central role in the control of cell proliferation and survival, ERK1/2 activity is necessary for cell cycle progression and regulates cell cyclerelated genes [44]. Interestingly, our present study
123
Mol Cell Biochem (2014) 387:159–170
indicates JAK2 silencing induced activation of ERK1/2. A previous study showed that activation of ERK1/2 involves the induction of S phase arrest and cell apoptosis [45]. And it has also been reported that ERK1/2 promoted progression through the G2/M phase of the cell cycle [46]. Not until recently has it been found that small molecule inhibitors of JAK2 may have negative or positive effects on the activation of ERK1/2 [15, 16, 47], suggesting that there may be a feedback loop between JAK2 and ERK1/2. Our present study has shown that the ERK1/2 specific inhibitor PD98059 blocked JAK2 shRNA-induced ERK1/2 activation, and enhanced the cell cycle arrest and induced cell apoptosis in JAK2 shRNA-transfected SGC7901 cells, suggesting that activation of ERK1/2 might protection GC cells from cell proliferation inhibition and cell cycle arrest induced by JAK2 silencing. Moreover, there was a significant antitumor effect with JAK2 shRNA/PD98059 combination after around 32 days of treatment, which means that PD98059 could enhance the anti-tumor activity of JAK2 shRNA in vivo. However, whether the combination is an effective strategy for treatment of GC needs further investigation. Nevertheless, it remains undetermined by what mechanism ERK1/2 signaling is activated in response to JAK2 silencing. A previous study suggests an involvement of the release of cytochrome c into the cytosol in ERK1/2 activation induced by JAK2 inhibitor AG490 in hepatocytes, which are probably generated by translocation of Bim, a BH-3-only member of the Bcl-2 family [15]. Therefore, the signaling mechanism through which ERK1/2 activation is induced by JAK2 silencing needs further investigation. In summary, we have here confirmed that JAK2 expression may be involved in malignant growth and proliferation in GC. Specific silencing of JAK2 significantly inhibited proliferation of GC cell SGC7901 in vitro, at least in part by inducing G2/M arrest rather than cell apoptosis. JAK2 silencing significantly induced ERK1/2 activation, which might protect GC cells from JAK2 silencing-induced biological effects. Ultimately, combination of ERK1/2 inhibitor PD98059 and JAK2 shRNA resulted in suppression of tumor growth in vitro and in vivo by enhancing apoptosis and cell cycle arrest. Taken together, our findings indicate that JAK2 and ERK1/2 combination may be used as a novel effective gene therapeutic strategy in GC. However, further investigation will be designed to elucidate the exact mechanism by which ERK1/2 inhibition affects cell proliferation, apoptosis, and cell cycle in GC cells with JAK2 silencing. Acknowledgments This work was financially supported by the grants from the National Basic Research Program of China (973 Program) (2012CB945004), National Natural Science Foundation of China (Nos. 81071961, 81001113, and 81101838), and Science Foundation of Zhejiang Health Bureau (No. 2012KYB111).
Mol Cell Biochem (2014) 387:159–170 Conflict of interest
All authors declare no conflict of interest.
References 1. Shridhar R, Almhanna K, Hoffe SE, Fulp W, Weber J, Chuong MD, Meredith KL (2013) Increased survival associated with surgery and radiation therapy in metastatic gastric cancer: a Surveillance, Epidemiology, and End Results database analysis. Cancer 119(9):1636–1642 2. Smyth EC, Cunningham D (2012) Targeted therapy for gastric cancer. Curr Treat Options Oncol 13(3):377–389 3. Seavey MM, Dobrzanski P (2012) The many faces of Janus kinase. Biochem Pharmacol 83(9):1136–1145 4. Waters MJ, Brooks AJ (2012) Growth hormone and cell growth. Endocr Dev 23:86–95 5. Zhang L, Yang J, Qian J, Li H, Romaguera JE, Kwak LW, Wang M, Yi Q (2012) Role of the microenvironment in mantle cell lymphoma: IL-6 is an important survival factor for the tumor cells. Blood 120(18):3783–3792 6. Zhuang G, Wu X, Jiang Z, Kasman I, Yao J, Guan Y, Oeh J, Modrusan Z, Bais C, Sampath D, Ferrara N (2012) Tumoursecreted miR-9 promotes endothelial cell migration and angiogenesis by activating the JAK-STAT pathway. EMBO J 31(17): 3513–3523 7. Xiong H, Zhang ZG, Tian XQ, Sun DF, Liang QC, Zhang YJ, Lu R, Chen YX, Fang JY (2008) Inhibition of JAK1, 2/STAT3 signaling induces apoptosis, cell cycle arrest, and reduces tumor cell invasion in colorectal cancer cells. Neoplasia 10(3):287–297 8. Hedvat M, Huszar D, Herrmann A, Gozgit JM, Schroeder A, Sheehy A, Buettner R, Proia D, Kowolik CM, Xin H, Armstrong B, Bebernitz G, Weng S, Wang L, Ye M, McEachern K, Chen H, Morosini D, Bell K, Alimzhanov M, Ioannidis S, McCoon P, Cao ZA, Yu H, Jove R, Zinda M (2009) The JAK2 inhibitor AZD1480 potently blocks Stat3 signaling and oncogenesis in solid tumors. Cancer Cell 16(6):487–497 9. Yang J, Ikezoe T, Nishioka C, Furihata M, Yokoyama A (2010) AZ960, a novel Jak2 inhibitor, induces growth arrest and apoptosis in adult T-cell leukemia cells. Mol Cancer Ther 9(12): 3386–3395 10. Couto JP, Almeida A, Daly L, Sobrinho-Simo˜es M, Bromberg JF, Soares P (2012) AZD1480 blocks growth and tumorigenesis of RET-activated thyroid cancer cell lines. PLoS One 7(10):e46869 11. Harry BL, Eckhardt SG, Jimeno A (2012) JAK2 inhibition for the treatment of hematologic and solid malignancies. Expert Opin Investig Drugs 21(5):637–655 12. Lee HJ, Daver N, Kantarjian HM, Verstovsek S, Ravandi F (2013) The role of JAK pathway dysregulation in the pathogenesis and treatment of acute myeloid leukemia. Clin Cancer Res 19(2):327–335 13. Gu Y, Zou Y, Aikawa R, Hayashi D, Kudoh S, Yamauchi T, Uozumi H, Zhu W, Kadowaki T, Yazaki Y, Komuro I (2001) Growth hormone signalling and apoptosis in neonatal rat cardiomyocytes. Mol Cell Biochem 223(1–2):35–46 14. Godeny MD, Sayeski PP (2007) Jak2 tyrosine kinase and cancer: how good cells get HiJAKed. Anticancer Agents Med Chem 7(6):643–650 15. Kwak HB, Sun HM, Ha H, Lee JH, Kim HN, Lee ZH (2008) AG490, a Jak2-specific inhibitor, induces osteoclast survival by activating the Akt and ERK signaling pathways. Mol Cells 26(5): 436–442 16. Derenzini E, Lemoine M, Buglio D, Katayama H, Ji Y, Davis RE, Sen S, Younes A (2011) The JAK inhibitor AZD1480 regulates proliferation and immunity in Hodgkin lymphoma. Blood Cancer J 1(12):e46
169 17. Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M, Donato NJ (2010) Deubiquitinase inhibition by small-molecule WP1130 triggers aggresome formation and tumor cell apoptosis. Cancer Res 70(22):9265–9276 18. Yao J, Qian CJ, Ye B, Zhang X, Liang Y (2012) ERK inhibition enhances TSA-induced gastric cancer cell apoptosis via NF-jBdependent and Notch-independent mechanism. Life Sci 1(5–6):186–193 19. Chen C, Chang YC, Liu CL, Chang KJ, Guo IC (2006) Leptininduced growth of human ZR-75-1 breast cancer cells is associated with up-regulation of cyclin D1 and c-Myc and down-regulation of tumor suppressor p53 and p21WAF1/CIP1. Breast Cancer Res Treat 98(2):121–132 20. Ting CM, Wong CK, Wong RN, Lo KW, Lee AW, Tsao GS, Lung ML, Mak NK (2012) Role of STAT3/5 and Bcl-2/xL in 2-methoxyestradiol-induced endoreduplication of nasopharyngeal carcinoma cells. Mol Carcinog 51(12):963–972 21. Almhanna K (2012) Targeted therapy for gastric adenocarcinoma. Adv Pharmacol 65:437–470 22. Ransohoff RM (1998) Cellular responses to interferons and other cytokines: the JAK-STAT paradigm. N Engl J Med 338(9): 616–618 23. Coelho WS, Sola-Penna M (2013) Serotonin regulates 6-phosphofructo-1-kinase activity in a PLC-PKC-CaMK II- and Janus kinase-dependent signaling pathway. Mol Cell Biochem 372(1–2):211–220 24. Verstovsek S (2009) Therapeutic potential of JAK2 inhibitors. Hematology Am Soc Hematol Educ Program 2009:636–642 25. Scott LM, Rebel VI (2012) JAK2 and genomic instability in the myeloproliferative neoplasms: a case of the chicken or the egg? Am J Hematol 87(11):1028–1036 26. Ding L, Xu Y, Zhang W, Deng Y, Si M, Du Y, Yao H, Liu X, Ke Y, Si J, Zhou T (2010) MiR-375 frequently downregulated in gastric cancer inhibits cell proliferation by targeting JAK2. Cell Res 20(7):784–793 27. Quinta´s-Cardama A, Kantarjian H, Cortes J, Verstovsek S (2011) Janus kinase inhibitors for the treatment of myeloproliferative neoplasias and beyond. Nat Rev Drug Discov 10(2):127–140 28. Lowe SW, Lin AW (2000) Apoptosis in cancer. Carcinogenesis 21(3):485–495 29. Yu RX, Hu XM, Xu SQ, Jiang ZJ, Yang W (2011) Effects of fucoxanthin on proliferation and apoptosis in human gastric adenocarcinoma MGC-803 cells via JAK/STAT signal pathway. Eur J Pharmacol 657(1–3):10–19 30. Um HJ, Min KJ, Kim DE, Kwon TK (2012) Withaferin A inhibits JAK/STAT3 signaling and induces apoptosis of human renal carcinoma Caki cells. Biochem Biophys Res Commun 427(1): 24–29 31. Kim MJ, Nam HJ, Kim HP, Han SW, Im SA, Kim TY, Oh DY, Bang YJ (2013) OPB-31121, a novel small molecular inhibitor, disrupts the JAK2/STAT3 pathway and exhibits an antitumor activity in gastric cancer cells. Cancer Lett 335(1):145–152 32. Gupta SC, Kim JH, Prasad S, Aggarwal BB (2010) Regulation of survival, proliferation, invasion, angiogenesis, and metastasis of tumor cells through modulation of inflammatory pathways by nutraceuticals. Cancer Metastasis Rev 29(3):405–434 33. Park JH, Darvin P, Lim EJ, Joung YH, Hong DY, Park EU, Park SH, Choi SK, Moon ES, Cho BW, Park KD, Lee HK, Kim MJ, Park DS, Chung IM, Yang YM (2012) Hwanggeumchal sorghum induces cell cycle arrest, and suppresses tumor growth and metastasis through Jak2/STAT pathways in breast cancer xenografts. PLoS One 7(7):e40531 34. Sai K, Wang S, Balasubramaniyan V, Conrad C, Lang FF, Aldape K, Szymanski S, Fokt I, Dasgupta A, Madden T, Guan S, Chen Z, Alfred Yung WK, Priebe W, Colman H (2012) Induction of cell-cycle arrest and apoptosis in glioblastoma stem-like cells
123
170
35.
36.
37.
38.
39.
40.
Mol Cell Biochem (2014) 387:159–170 by WP1193, a novel small molecule inhibitor of the JAK2/ STAT3 pathway. J Neurooncol 107(3):487–501 Zhang X, Min KW, Wimalasena J, Baek SJ (2012) Cyclin D1 degradation and p21 induction contribute to growth inhibition of colorectal cancer cells induced by epigallocatechin-3-gallate. J Cancer Res Clin Oncol 138(12):2051–2060 Rosendahl AH, Sun C, Wu D, Andersson R (2012) Polysaccharide-K (PSK) increases p21(WAF/Cip1) and promotes apoptosis in pancreatic cancer cells. Pancreatology 12(6):467–474 Russo A, Esposito D, Catillo M, Pietropaolo C, Crescenzi E, Russo G (2013) Human rpL3 induces G1/S arrest or apoptosis by modulating p21 (waf1/cip1) levels in a p53-independent manner. Cell Cycle 12(1):76–87 Thoennissen NH, Iwanski GB, Doan NB, Okamoto R, Lin P, Abbassi S, Song JH, Yin D, Toh M, Xie WD, Said JW, Koeffler HP (2009) Cucurbitacin B induces apoptosis by inhibition of the JAK/ STAT pathway and potentiates antiproliferative effects of gemcitabine on pancreatic cancer cells. Cancer Res 69(14):5876–5884 Noonan EM, Shah D, Yaffe MB, Lauffenburger DA, Samson LD (2012) O6-Methylguanine DNA lesions induce an intra-S-phase arrest from which cells exit into apoptosis governed by early and late multi-pathway signaling network activation. Integr Biol (Camb) 4(10):1237–1255 McCubrey JA, Steelman LS, Chappell WH, Abrams SL, Wong EW, Chang F, Lehmann B, Terrian DM, Milella M, Tafuri A, Stivala F, Libra M, Basecke J, Evangelisti C, Martelli AM,
123
41. 42.
43. 44.
45.
46.
47.
Franklin RA (2007) Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Biochim Biophys Acta 1773(8):1263–1284 Dhillon AS, Hagan S, Rath O, Kolch W (2007) MAP kinase signalling pathways in cancer. Oncogene 26(22):3279–3290 Kohno M, Tanimura S, Ozaki K (2011) Targeting the extracellular signal-regulated kinase pathway in cancer therapy. Biol Pharm Bull 34(12):1781–1784 Dent P, Yacoub A, Fisher PB, Hagan MP, Grant S (2003) MAPK pathways in radiation responses. Oncogene 22(37):5885–5896 Xu XL, Huang YJ, Wang YQ, Chen XF, Zhang W (2011) 2,3,40 ,5-Tetrahydroxystilbene-2-O-b-D-glucoside inhibits platelet-derived growth factor-induced proliferation of vascular smooth muscle cells by regulating the cell cycle. Clin Exp Pharmacol Physiol 38(5):307–313 Li L, Chen DB, Lin C, Cao K, Wan Y, Zhao XY, Nie CL, Yuan Z, Wei YQ (2013) hPNAS-4 inhibits proliferation through S phase arrest and apoptosis: underlying action mechanism in ovarian cancer cells. Apoptosis 18(4):467–479 Kolb RH, Greer PM, Cao PT, Cowan KH, Yan Y (2012) ERK1/2 signaling plays an important role in topoisomerase II poisoninduced G2/M checkpoint activation. PLoS One 7(11):e50281 Sun Y, Moretti L, Giacalone NJ, Schleicher S, Speirs CK, Carbone DP, Lu B (2011) Inhibition of JAK2 signaling by TG101209 enhances radiotherapy in lung cancer models. J Thorac Oncol 6(4):699–706
