MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 Infection, Genetics and Evolution xxx (2014) xxx–xxx 1
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
2
Short communication
6 4 7
The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus
5 8 9 10 11 12 1 2 4 6 15 16 17 18 19 20 21 22 23 24 25
Q1
Zong-liang Gao 1, Jian-hua Zhou 1, Jie Zhang, Yao-zhong Ding, Yong-sheng Liu ⇑ State Key Laboratory of Veterinary Etiological Biology, National Foot-and-Mouth Disease Reference Laboratory, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, Gansu, PR China
a r t i c l e
i n f o
Article history: Received 10 April 2014 Received in revised form 25 June 2014 Accepted 5 August 2014 Available online xxxx Keywords: FMDV 2A Synonymous codon Cleavage efficiency
a b s t r a c t The 2A region of the foot-and-mouth disease virus (FMDV) polyprotein is 18 amino acids in length, and 2A self-cleavage site (2A/2B) contains a conserved amino acid motif G2A/P2B. To investigate the synonymous codon usage for Glycine at the 2A/2B cleavage site of FMDV, 66 2A/2B1 nucleotide sequences were aligned and found that the synonymous codon usage of G2A is conserved and GGG was the most frequently used. To examine the role of synonymous codons for G2A in self-cleavage efficiency of 2A/2B, recombinant constructs which contains the chloramphenicol acetyltransferase protein (CAT) and enhanced green fluorescent protein (EGFP) linked by the FMDV 2A sequence with four synonymous codons for G2A were produced. The activities of all the F2As based plasmids were determined in CHO cells. The results showed that the synonymous codon usage patterns for G2A at the cleavage site (2A/2B) have no effect on the cleavage efficiency. This suggests that the synonymous codon usage of 2A peptide has no effect on the cleavage efficiency of FMDV 2A element. Ó 2014 Elsevier B.V. All rights reserved.
27 28 29 30 31 32 33 34 35 36 37 38 39 40
41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62
1. Introduction Foot-and-mouth disease is a highly contagious and infectious disease, which can result in severe economic losses in susceptible cloven-hoofed animals (Klein, 2009). Foot-and-mouth disease virus (FMDV) belongs to the Aphthovirus genus of the family Picornaviridae and exists in the form of seven different serotypes: Asia 1, A, O, C, South African Territories 1 (SAT1), SAT2 and SAT3. FMDV possesses a single stranded positive-sense RNA genome which functions as an mRNA and encodes a viral polyprotein. However, the polyprotein is never observed neither in vivo nor in vitro due to ‘primary’ cleavages. The primary cleavages of polyprotein are mediated by the two virus-encoded proteinases (Lpro and 3Cpro) and a short oligopeptide sequence (2A) (Mason et al., 2003). FMDV 2A is an 18-aa peptide characterized by a C-terminal ‘-ExNPG2A/ P2B-’motif, and this peptide along with the first amino acid of the 2B protein (Pro2B) can mediate the cleavage process in the artificial polyprotein systems (Donnelly et al., 1997; Ryan and Drew, 1994). The 2A/2B cleavage event is a modification of the translational machinery by the 2A peptide which allows the release of the protein-2A from the ribosome while permitting the synthesis of the downstream proteins to proceed (Donnelly et al., 1997, 2001). ⇑ Corresponding author. Tel./fax: +86 931 8342771. 1
E-mail address: [email protected] (Y.-s. Liu). The two authors contributed equally to this work.
Meanwhile, the efficiency of this cleavage process is not complete and translation through the 2A coding sequences also leads to a proportion of full-length ORF product being produced (Donnelly et al., 2001; Ma and Mitra, 2002; Ryan and Drew, 1994). The coexpression of proteins linked by 2A peptides is independent of cell types, since the cleavage reaction only depends on eukaryotic ribosome, which is structurally conserved among the eukaryota. It should be noted that the cleavage site (G2A/P2B) of 2A/2B plays a key role in the self-cleavage event (Ryan and Drew, 1994; Sharma et al., 2012). Mutations in these amino acids can reduce or abrogate the cleavage activity (Donnelly et al., 2001; Doronina et al., 2008; Sharma et al., 2012). The cleavage activity was abrogated when ‘‘G2A’’ was mutated to other amino acids (Donnelly et al., 2001; Sharma et al., 2012). Experiments on mutated 2A elements mainly focused on single amino acid mutants and Nterminal extension or deletion (Donnelly et al., 2001; Minskaia et al., 2013; Sharma et al., 2012). Recently, numerous studies reported that the synonymous codon usage bias also plays an important role in the translation of gene (Kramer et al., 2009; Kudla et al., 2009; Tuller et al., 2010; Welch et al., 2009). Even single-nucleotide synonymous mutation can affect gene expression (Hamano et al., 2007; Kimchi-Sarfaty, 2011). The mRNA might contain additional information, beyond the amino acid sequence, that can fine-tune protein folding and translational pausing at a rare codon can also affect protein folding (Komar, 2009). The co-translational cleavage reaction mediated by 2A peptide occurs
http://dx.doi.org/10.1016/j.meegid.2014.08.006 1567-1348/Ó 2014 Elsevier B.V. All rights reserved.
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 2 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105
Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
immediately after polypeptide-chain synthesis at the ribosomal peptidyltransferase center, where the nascent chain is hydrolytically released from tRNA despite of further nonstop codons. Thus, the G2A seems to be the most important amino acid for 2A activity despite of the conserved ‘-ExNPG2A/P2B-’motif, for it locates right upstream of the cleavage site. The conservation of G2A and its specific location contribute to the assumption that the silent mutations of G2A may have influence on the cleavage efficiency of FMDV 2A element. So far, there is no report revealing the effect of synonymous codon usage of G2A on 2A cleavage activity. In this study, the synonymous codon usage of 2A peptide especially the G2A was investigated. By altering the synonymous codons of G2A, we analyzed the role of synonymous codons of G2A in the efficiency of 2A cleavage in an artificial report system, which is composed of the genes of chloramphenicol acetyltransferase protein (CAT) and enhanced green fluorescent protein (EGFP) linked by the 2A sequence plus the first codon of 2B sequence of FMDV.
106
2. Materials and methods
107
2.1. Sequence data and sequence alignment
108
128
A total of 66 complete RNA sequences of FMDV were downloaded from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/Genbank/), including all 7 serotypes: Asia 1, n = 10 sequences; A, n = 17; C, n = 7; O, n = 19; SAT 1, n = 5; SAT 2, n = 4; SAT 3, n = 4 (Table 1). In order to locate the position of the 2A sequence of FMDV polyprotein, multiple sequence alignments were performed with the Clustal W (1.7) method of DNAstar software (7.0) for Windows based on the previous report, and the 2A sequences were extracted from the whole coding sequences with the manual editing (Table 1). In addition, we employed sequence logos method to analyze the amino acid and synonymous codon usages of the key region ‘-ExNPG2A/P2B-’. Sequence logos are a graphical visualization of a nucleic acid or amino acid multiple sequence alignment. Every logo value consists of stacks of symbols, one stack corresponds each position in the target sequence (Crooks et al., 2004; Schneider and Stephens, 1990). To investigate the synonymous codon usage of G2A located in Cterminal of FMDV 2A, the alignment of 66 2A/2B1 sequences were conducted. The codon usage of G within the codon pair ‘G/P’ among the 66 complete genome sequences excluding 2A region were also compared with that of G2A in cleavage site of 2A/2B.
129
2.2. Cell culture and the nucleotide sequence of self-cleavage element
130
CHO cells (ATCC cat. CCL-61) were grown on F-12K Nutrient Mixture supplemented with 10% fetal bovine serum (FBS; GIBCO, USA). The nucleotide sequence of self-cleavage element is ‘gtt ttg aac ttt gac ctg ctc aag ttg gcg gga gac gtg gag tcc aac cct ggg2A ccc2B1’ encoding LLNFDLLKLAGDVESNPG2A/P2B1.
109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127
131 132 133 134
135
2.3. Plasmid constructions
136
Two reporter genes, chloramphenicol acetyltransferase (CAT) and Enhanced Green Fluorescence Protein (EGFP), were introduced into pcDNA3.1(+) plasmid (Invitrogen) and linked by the selfcleavage element (2A). The CAT and EGFP reporter genes were fused with the self-cleavage element in a single open reading frame (CAT-2A/2B1-EGFP) (Fig. 2). The self-cleavage element was added downstream of the CAT gene (deleting the stop codon) to form the CAT-2A/2B1 fragment, and then the EGFP gene was fused into the downstream of the CAT-2A/2B1 fragment to form the CAT2A/2B1-EGFP fragment. Two steps of PCR were required to fuse 2A/
137 138 139 140 141 142 143 144 145
2B1 to CAT. The sequence of oligonucleotides used for step 1 PCR were: 50 -CGGGATTCATGGAGAAAAAAATCAC-30 containing BamHI site for forward primer and 50 -CGTCTCCCGCCAACTTGAGCAGGTCA AAGTTCAAAACCGCCCCGCCCTGCCACT-30 for reverse primer. The pcDNA3.1(+)/CAT (Invitrogen) plasmid was used as template. The step 2 PCR employed the same forward primer and 50 -TCGCCCT TGCTCACCATTGGCCCAGGGTTGGACTCCACGTCTCCCGCCAACTTG-30 as reverse primer. In this step, the step 1 PCR products were used as template. EGFP amplification was performed with the following primers: 50 -ATGGTGAGCAAGGGCGAGGA-30 for forward primer and 50 -GCTCTAGATTACTTGTACAGCTCGTC-30 containing XbaI site for reverse primer and the pEGFP-N1 plasmids was used as template. The PCR products of CAT-2A/2B1-EGFP were digested with BamHI and XbaI restriction enzymes and cloned into pcDNA3.1(+) using BamHI and XbaI restriction sites. The method was applied to for making the other three mutants constructs by mutating the nucleotide C underlined within step 2 reverse primer into A, T or G. Thus, four types of pcDNA3.1(+)-CAT-2A/2B1-EGFP plasmids containing four synonymous codons of G2A were generated, namely, pCAT-2A(GGG)/2B1-EGFP, pCAT-2A(GGC)/2B1-EGFP, pCAT -2A(GGT)/2B1-EGFP and pCAT-2A(GGA)/2B1-EGFP. A positive control plasmid pCAT-2A(P)/2B1-EGFP in which the G2A is replaced by Proline was produced and it was demonstrated to express the uncleaved product CAT-2A/2B1-EGFP (Sharma et al., 2012). Constructs were verified by sequencing. Besides, the plasmids pcDNA3.1(+) and pcDNA3.1(+)/CAT were also used as control.
146
2.4. In vitro translation and Western blot
172
CHO cells were cultured in six well culture cluster plates at 80% confluence. Transient transfections were performed using Lipofectamin™ 2000 (Invitrogen) to introduce the resulting plasmids into CHO cells. Cells were lysed in 200 lL Mamalian Protein Extraction Reagent (ComWin, Beijing) containing 1% PMSF after 24 h post transfection. Cell lysate was centrifuged and the supernatant was collected and subjected to the Western blot analyses. 20 lL of the protein extracts and prestained protein standard Markers were separated using a 12% sodium dodecyl sulfate–polyacrylamide gel and then blotted onto a polyvinylidene fluoride membrane (PVDF). The membranes were processed using diluted (1:10000) Rabbit Anti-CAT Monoclonal Antibody (SIGMA–ALDRICH, Lot No. 010M4805) and Polyclonal Goat Anti-Rabbit Antibody (SIGMA– ALDRICH, Lot No. 111M4750) with a dilution (1:5000) in Phosphate Buffered Saline Tween (PBST)/5% skimmed milk powder. The PVDF membranes were resolved with an enhanced chemiluminescence (ECL) Western blotting detection kit (CoWin Biosicence, Lot No. 2114) according to manufacturer’s instructions. Signals were captured by exposure to Kodak X-ray film. The same membranes were incubated in Stripping Buffer (CoWin Biosicence, Lot No. 0113D) for 20 min to remove the binding antibodies. Then the membranes were processed using diluted (1:5000) Mouse Anti-b-Actin Monoclonal Antibody (TRANSGEN BIOTECH, Lot No. HC-201-01) and Anti-Mouse Antibody (TRANSGEN BIOTECH, Lot No. HS-101-01) with a dilution (1:5000) in Phosphate Buffered Saline Tween (PBST)/5% skimmed milk powder and after which the signals were exposed to Kodak X-ray film according to the methods before. Protein Western blot bands were quantified with Image J software. All experiments including the transfection of the CHO cells and Western blot were performed in triplicate.
173
2.5. Data analysis
203
Two fragments, the cleavaged portion (CAT-2A) uncleaved product (CAT-2A/2B1-EGFP), were detected
and and
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171
174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202
204 205
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
3
Table 1 Genomes examined, serotype accession numbers and F2As sequence.
206 207 208 209
Serotype
Accession No.
Sequences of F2As
Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 A A A A A A A A A A A A A A A A A C C C C C C C O O O O O O O O O O O O O O O O O O O SAT 1 SAT 1 SAT 1 SAT 1 SAT 1 SAT 2 SAT 2 SAT 2 SAT 2 SAT 3 SAT 3 SAT 3 SAT 3
AY304994 DQ989322 AY687334 AY687333 FJ906802 GQ452295 EF149010 AY593800 AY593796 AY593795 EF494487 EF494486 AY593751 AY593789 AY593767 AY593770 AY593782 AY593787 AY593788 AY593803 AY593753 AY593756 AY593757 AY593768 AY593794 AY593771 AY593758 FJ824812 AM409325 DQ409191 AY593809 AY593810 AY593805 AY593806 EF552697 EU400597 EU140964 AF026168 NC_004004 AJ539139 AY593819 AY593835 AY593833 AF511039 EF175732 DQ248888 AJ320488 AJ633821 AH012984 AB079061 AF189157 AY317098 AH012985 AY593838 AY593840 AY593841 AY593842 AY593843 AF540910 AY593847 AY593848 AY593849 AY593850 AY593851 AY593852 AY593853
GTTTTGAACTTTGACCTGCTCAAGTTGGCGGGAGACGTGGAGTCCAACCCTGGG GTATTGAACTTCGACCTGCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG GTACTGAACTTCGACCTGCTCAAGTTGTCAGGAGACGTTGAGTCCAACCCTGGG ATGATGAACTTCGACCTGCTTAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG ACTTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTGGAGTCCAACCCTGGG ACCTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTGGAGTCCAACCCTGGG ATGATGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG GTTTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG ACTTTGAACTTTGACCTGCTCAAGTTGGCGGGAGACGTGGAGTCCAACCCTGGG CTTCTGAACTTTGACCTACTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTCCTGAACTTCGACCTCTCAAGTTGGCGGGAGACGTCGAGTCTAACCCTGGG CTCCTGAACTTCGACCTGCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGG CTCTTGAACTTTGACCTACTTAAGTTGGCGGGTGACGTTGAGTCCAACCCTGGA CTGCTGAACTTTGACCTTCTCAAACTGGCGGGTGACGTTGAGTCCAACCCTGGG TTGTTGAACTTCGATCTGCTTAAGTTGGCTGGAGACGTGGAGTCCAACCCTGGG CTTCTGAACTTTGATCTGCTTAAGTTGGCTGGGGACGTGGAGTCCAACCCTGGA TCTCTGAACTTCGACCTGCTCAAGCTGGCGGGAGACGTTGAGTCCAACCCCGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCTGGGGACGTGGAGTCCAATCCTGGA CTTTTGAACTTTGACCTACTCAAGTTGGCTGGGGACGTGGAGTCCAATCCTGGA CTTTTGAACTTTGACCTGCTCAAGTTGGCTGGGGACGTGGAGTCCAACCCTGGA CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAATCCTGGG CTTTTGAATTTTGACCTGCTCAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCTGGGGACGTCGAGTCCAACCCTGGA TTGCTGAATTTTGACCTACTCAAGTTAGCTGGAGACGTGGAGTCCAACCCTGGG CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAACCCTGGG CTGCTGAACTTTGACCTGCTCAAGTTGGCTGGAGATGTGGAGTCCAACCCTGGG CTGCTGAACTTTGGCCTGCTCAAGTTGGCTGGAGACGTGGAGTCCAACCCTGGG CTGCTGAACTTTGACCTGCTCAAGTTGGCTGGAGATGTGGAGTCCAACCCTGGG CTATCGAACTTTGACCTGCTCAAGTTGGCTGGGGATGTGGAGTCCAACCCTGGA CTGCTAAACTTTGACCTACTCAAGTTGGCTGGAGACGTGGAGTCCAACCCTGGG CTGCTGAACTTTGACCTGCTCAAGTTGGCTGGAGATGTGGAGTCCAACCCTGGG CTGCTGAACTTCGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCCGGG CTTCTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG ACTTTGAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTTTTGAAGTTAGCAGGAGACGTTGAGTCCAACCCCGGA CTTCTGAACTTCGACCTTCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTTCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG ACTTTGAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTGTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGCCCAACCCTGGG CTCGAGCGTCAAAAACCCCTGAAAGTGAGGGCCAAGCTCCCACAGCAGGAGGGG CTTCTGAACTTTGACCTGCTCAAGTTGGCAGGGGACATGGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG CTTCTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTGTGTAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG TTGTGTAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG TTGTGCAACTTCGACCTGTTAATGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTTCGACCTGTTAAAGTTGGCTGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTTCGACCTGTTGAAGTTGGCTGGAGACGTTGAGTCCAACCCCGGG CTGTTCAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTGCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGTTAAAGTTGGCGGGAGACGTTGAGTCTAACCCTGGG TTGTGTAACTTCGACCTGTTAAAGTTGGCTGGAGATGTTGAGTCCAACCCTGGG CTGTGTAACTTCGACCTGTTGAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGTAACTTCGACCTGTTGAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG ATGTGCAACTTCGACCTGTTGAAGTTGGCCGGAGACGTCGAGTCCAACCCTGGG
confirmed. R¼
Cleavage
P CAT-2A=2B1 P CAT-2A=2B1 þP CAT-2A=2B1-EGFP
efficiency
(%)
was
calculated
as:
100% where R value means the efficiency
cleavage mediated by one of the plasmids containing 2A elements; PCAT-2A/2B1 represents the degree of cleavage of CAT-2A/2B1
fragment from the CAT-2A/2B1-EGFP fragment; PCAT-2A/2B1-EGFP represents the degree of non-cleavage of CAT-2A/2B1-EGFP. It should be noted that the three controls have no R value (Fig. 2). The results are assessed according to the ANOVA test based on SPSS. 19 software and there is significant difference when P < 0.05.
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
210 211 212 213 214
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 4
Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
Fig. 1. Graphical representation of alignment of amino acid (top) and nucleotide (bottom) sequences for 66 ‘-ExNPGP-’ motifs using Weblogo. The overall height of the stack indicates the sequence conservation at that position, while the height of symbols within the stack indicates the relative frequency of each amino or nucleic acid at that position.
Fig. 2. pcDNA3.1CAT-2A/2B1-EGFP constructs and the outcomes of translation. Bold area represents 2A sequences and boxed areas represent ORFS encoding CAT or EGFP. All plasmids were based on pcDNA3.1(+) transcription vectors.
215
3. Results
216
By aligning the ‘-ExNPG2A/P2B-’motifs derived from 66 FMDV RNAs using sequence logos, it is clear that the key region peptide has a strong tendency to select the specific motif ‘ESNPG2AP2B’ (Fig. 1). It was also found that the synonymous codon usage of this conserved motif is biased. The amino acids E, S, N tend to use GAG, TCC and ACC respectively. It is interesting to find that the two prolines (Pro) flanking G2A have different codon usage. The first proline located upstream of G2A tends to select CCT, while the other one located downstream of G2A tends to select CCC (Fig. 1). For ‘‘G2A’’, it was found that the synonymous codon GGG is the most conserved in the self-cleavage element of FMDV polyprotein. As for the amino acid ‘‘G’’, the synonymous codon distributions for G2A are GGG (58/66), GGA (8/66), GGC (0/66), GGT (0/66), respectively. It is apparent that the GGG is the dominant (87.9%) synonymous codon in G2A, while the GGG within G/P pairs in the entire coding region (excepting the 2A region) merely account for 28.0%. and GGA accounts for 59.3% (Table 2). As is detected by anti-CAT antibody in Fig. 3A, controls with the empty expression vector pcDNA3.1(+) transfected CHO cell
217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234
produced no translation products and vectors pcDNA3.1(+)/CAT and pcDNA3.1(+)CAT-2A(Proline)/2B-EGFP express [CAT] and [CAT-2A-EGFP]. By comparing the lanes deriving from all 7 plasmids, it can be concluded that the top and bottom lanes detected by anti-CAT antibody refer to the cleavaged fragment [CAT-2A] and uncleaved fragment [CAT-2A/2B1-EGFP], respectively. The results showed that the silent mutations of G2A of 2A did not abrogate the ‘cleavage’ activity and the 2As with four synonymous codons GGG, GGC, GGA, GGT coding C-terminal glycine possess the average ‘cleavage’ efficiency of 88.1%, 87.6%, 88.5%, 87.3%, respectively (Fig. 3B) and all three sets of R values situated between 86% and 89% and the slight difference can be neglected (Table 3). There is also no significant difference (P > 0.05) among the three sets of four R values, indicating that the synonymous codon alterations of G2A have no effect on the cleavage efficiency of FMDV 2A.
235
4. Discussion
251
The synonymous codons distribution of Gly within ‘G2A/P2B’ codon pairs in the entire coding region (excepting the 2A region) was extremely different from that in the ‘G2A/P2B’ codon pairs: the synonymous codon (GGG) for G2A were frequently selected in the codon pair Gly2A/Pro2B, suggesting that the synonymous codon usage bias for Gly2A is sustained under the positive selection during the evolution of FMDV. It is generally stated that the amino acid sequences determine the protein expression and function. However, codon usage is one major factor that can affect translation speed or dynamics (Akashi, 2001; Bulmer, 1991; Novoa and Ribas de Pouplana, 2012). Protein synthesis by ribosomes takes place on a linear substrate with non-uniform speed. Transient pausing of ribosomes can cause various co-translational processes, including protein targeting and folding (Li et al., 2012). Nascent 2A peptides were shown to interact with the ribosomal exit tunnel to dictate the co-translational ‘stop-carry on’ recoding (Sharma et al., 2012). By analyzing the role of mRNA sequence in the synthesis of the protein, it was found that the formation of the local protein structure is influenced by the corresponding nucleotide sequence even the amino acids sequence is retained (Hamano et al., 2007;
252
Table 2 The comparison of total number of synonymous codons distributions between G2A and G within ‘G/P’.
Gly2A Gly
Number of GGA (%)
Number of GGT (%)
Number of GGC (%)
Number of GGG (%)
8 (12.1%) 527 (59.3%)
0 (0%) 37 (4.17%)
0 (0%) 75 (8.44%)
58 (87.9%) 249 (28.0%)
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
236 237 238 239 240 241 242 243 244 245 246 247 248 249 250
253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
5
Fig. 3. (A) Western blot results detected by incubation with anti-CAT and anti-b-actin antibodies. The p, pCAT, pC2AE represent pcDNA3.1(+), pcDNA3.1(+)/CAT, pcDNA3.1(+)CAT-2A(Proline)/2B-EGFP plasmids. GGA, GGT, GGC, GGG represent four pCAT-2A/2B1-EGFP plasmids with corresponding synonymous codon of G2A. M, markers in kDa. Top and bottom refer to the uncleaved product (CAT-2A/2B1-EGFP), and the cleavaged portion (CAT-2A), respectively; (B) gray scale quantification of four pCAT-2A/ 2B1-EGFP plasmids. Average cleavage efficiency (% of releasing CAT-2A/2B1 from CAT-2A/2B1-EGFP) ± one standard deviation is shown.
Table 3 The R value conducted by four plasmids containing 2A with four synonymous codons of G2A. Codon of G2A
R1 (%)
R2 (%)
R3 (%)
GGA GGT GGC GGG
87.2 88.9 88.9 86.5
88.3 86.0 88.7 87.0
89.0 87.9 88.0 88.5
R1, R2, R3 represent three sets of the results of cleavage efficiency and GGA, GGT, GGC, GGG represent the four pCAT-2A/2B1-EGFP plasmids containing the corresponding synonymous codon for G2A.
272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295
Kimchi-Sarfaty, 2011; Komar et al., 1999). Modelling of the 2A sequence showed that the Gly2A/Pro2B may form part of a tightturn immediately downstream of an alpha-helix (Donnelly et al., 2001). As for the synonymous codon usage of G2A, the usage pattern is biased and GGG is the most frequently used. It needs more energy to break the equilibrium of codon and anti-codon bond formed by guanine and cytosine than that by adenine and thymine. The synonymous codon with high pairing energy has a strong ability to bind to the tRNA anti-codon within the ribosome, leading to low translation efficiency of gene (Bush et al., 2003; Cannarozzi et al., 2010; Groeneveld et al., 1995; Hershberg and Petrov, 2008). Naturally, the conserved synonymous codon usage of G2A/ P2B1 leads to the assumption that as a turn point, the synonymous codons of G2A may slightly affect the speed of scanning of ribosome and result in the differences of the cleavage efficiency as a result of a cumulative process. However, the result showed that the cleavage efficiency mediated by 2A with perfect codon GGG at the cleavage site of 2A/2B and the non-perfect ones (GGA, GGT, GGC) is unaffected, which indicate that the synonymous codon usage bias existing in the self-cleavage site of 2A/2B is merely a preference under the positive-selection during evolution of FMDV. The results also indicate that the synonymous codon usage of 2A peptide has no effect on 2A activity despite the presence of biased synonymous codon usage. The results would be beneficial to the application of
2A element, since 2A activity will not be affected regardless of nucleotides sequence changes as long as the amino acids sequence is sustained.
296
Acknowledgements
299
This work was supported by National Natural Science Founda- Q2 tion of China (Nos. 31302100, 31172335 and 31072143), Interna- Q3 tional Science and Technology Cooperation Program of China (Nos. 2010DFA32640 and 2012 DFG31890) and Gansu Provincial Funds for Distinguished Yong Scientists (1111RJDA005).
300
References
305
Akashi, H., 2001. Gene expression and molecular evolution. Curr. Opin. Genet. Dev. 11 (6), 660–666. Bulmer, M., 1991. The selection-mutation-drift theory of synonymous codon usage. Genetics 129 (3), 897–907. Bush, J.A., Kimball, S.R., O’Connor, P.M., Suryawan, A., Orellana, R.A., Nguyen, H.V., Jefferson, L.S., Davis, T.A., 2003. Translational control of protein synthesis in muscle and liver of growth hormone-treated pigs. Endocrinology 144 (4), 1273– 1283. Cannarozzi, G., Schraudolph, N.N., Faty, M., von Rohr, P., Friberg, M.T., Roth, A.C., Gonnet, P., Gonnet, G., Barral, Y., 2010. A role for codon order in translation dynamics. Cell 141 (2), 355–367. Crooks, G.E., Hon, G., Chandonia, J.-M., Brenner, S.E., 2004. WebLogo: a sequence logo generator. Genome Res. 14 (6), 1188–1190. Donnelly, M.L.L., Gani, D., Flint, M., Monaghan, S., Ryan, M.D., 1997. The cleavage activities of aphthovirus and cardiovirus 2A proteins. J. Gen. Virol. 78, 13–21. Donnelly, M.L.L., Hughes, L.E., Luke, G., Mendoza, H., ten Dam, E., Gani, D., Ryan, M.D., 2001. The ‘cleavage’ activities of foot-and-mouth disease virus 2A sitedirected mutants and naturally occurring ‘2A-like’ sequences. J. Gen. Virol. 82, 1027–1041. Doronina, V.A., Wu, C., de Felipe, P., Sachs, M.S., Ryan, M.D., Brown, J.D., 2008. Sitespecific release of nascent chains from ribosomes at a sense codon. Mol. Cell. Biol. 28 (13), 4227–4239. Groeneveld, H., Thimon, K., Van Duin, J., 1995. Translational control of maturationprotein synthesis in phage MS2: a role for the kinetics of RNA folding? RNA 1 (1), 79. Hamano, T., Matsuo, K., Hibi, Y., Victoriano, A.F., Takahashi, N., Mabuchi, Y., Soji, T., Irie, S., Sawanpanyalert, P., Yanai, H., Hara, T., Yamazaki, S., Yamamoto, N., Okamoto, T., 2007. A single-nucleotide synonymous mutation in the gag gene controlling human immunodeficiency virus type 1 virion production. J. Virol. 81 (3), 1528–1533.
306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
297 298
301 302 303 304
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 6 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
Hershberg, R., Petrov, D.A., 2008. Selection on codon bias. Annu. Rev. Genet. 42, 287–299. Kimchi-Sarfaty, C., 2011. A ‘silent’ polymorphism in the MDR1 gene changes substrate specificity (January, pg. 525, 2007). Science 334 (6052), 39. Klein, J., 2009. Understanding the molecular epidemiology of foot-and-mouthdisease virus. Infect. Genet. Evol. 9 (2), 153–161. Komar, A.A., 2009. A pause for thought along the co-translational folding pathway. Trends Biochem. Sci. 34 (1), 16–24. Komar, A.A., Lesnik, T., Reiss, C., 1999. Synonymous codon substitutions affect ribosome traffic and protein folding during in vitro translation. FEBS Lett. 462 (3), 387–391. Kramer, G., Boehringer, D., Ban, N., Bukau, B., 2009. The ribosome as a platform for co-translational processing, folding and targeting of newly synthesized proteins. Nat. Struct. Mol. Biol. 16 (6), 589–597. Kudla, G., Murray, A.W., Tollervey, D., Plotkin, J.B., 2009. Coding-sequence determinants of gene expression in Escherichia coli. Science 324 (5924), 255–258. Li, G.-W., Oh, E., Weissman, J.S., 2012. The anti-Shine-Dalgarno sequence drives translational pausing and codon choice in bacteria. Nature 484 (7395), 538–541. Ma, C., Mitra, A., 2002. Expressing multiple genes in a single open reading frame with the 2A region of foot-and-mouth disease virus as a linker. Mol. Breed. 9 (3), 191–199.
Mason, P.W., Grubman, M.J., Baxt, B., 2003. Molecular basis of pathogenesis of FMDV. Virus Res. 91 (1), 9–32. Minskaia, E., Nicholson, J., Ryan, M.D., 2013. Optimisation of the foot-and-mouth disease virus 2A co-expression system for biomedical applications. BMC Biotechnol. 13 (1), 1–11. Novoa, E.M., Ribas de Pouplana, L., 2012. Speeding with control: codon usage, tRNAs, and ribosomes. Trends Genet. 28 (11), 574–581. Ryan, M.D., Drew, J., 1994. Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. EMBO J. 13 (4), 928–933. Schneider, T.D., Stephens, R.M., 1990. Sequence logos: a new way to display consensus sequences. Nucleic Acids Res. 18 (20), 6097–6100. Sharma, P., Yan, F., Doronina, V.A., Escuin-Ordinas, H., Ryan, M.D., Brown, J.D., 2012. 2A peptides provide distinct solutions to driving stop-carry on translational recoding. Nucleic Acids Res. 40 (7), 3143–3151. Tuller, T., Carmi, A., Vestsigian, K., Navon, S., Dorfan, Y., Zaborske, J., Pan, T., Dahan, O., Furman, I., Pilpel, Y., 2010. An evolutionarily conserved mechanism for controlling the efficiency of protein translation. Cell 141 (2), 344–354. Welch, M., Villalobos, A., Gustafsson, C., Minshull, J., 2009. You’re one in a googol: optimizing genes for protein expression. J. R. Soc. Interface 6 (Suppl. 4), S467–S476.
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377
No. of Pages 6, Model 5G
26 August 2014 Infection, Genetics and Evolution xxx (2014) xxx–xxx 1
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
2
Short communication
6 4 7
The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus
5 8 9 10 11 12 1 2 4 6 15 16 17 18 19 20 21 22 23 24 25
Q1
Zong-liang Gao 1, Jian-hua Zhou 1, Jie Zhang, Yao-zhong Ding, Yong-sheng Liu ⇑ State Key Laboratory of Veterinary Etiological Biology, National Foot-and-Mouth Disease Reference Laboratory, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, Gansu, PR China
a r t i c l e
i n f o
Article history: Received 10 April 2014 Received in revised form 25 June 2014 Accepted 5 August 2014 Available online xxxx Keywords: FMDV 2A Synonymous codon Cleavage efficiency
a b s t r a c t The 2A region of the foot-and-mouth disease virus (FMDV) polyprotein is 18 amino acids in length, and 2A self-cleavage site (2A/2B) contains a conserved amino acid motif G2A/P2B. To investigate the synonymous codon usage for Glycine at the 2A/2B cleavage site of FMDV, 66 2A/2B1 nucleotide sequences were aligned and found that the synonymous codon usage of G2A is conserved and GGG was the most frequently used. To examine the role of synonymous codons for G2A in self-cleavage efficiency of 2A/2B, recombinant constructs which contains the chloramphenicol acetyltransferase protein (CAT) and enhanced green fluorescent protein (EGFP) linked by the FMDV 2A sequence with four synonymous codons for G2A were produced. The activities of all the F2As based plasmids were determined in CHO cells. The results showed that the synonymous codon usage patterns for G2A at the cleavage site (2A/2B) have no effect on the cleavage efficiency. This suggests that the synonymous codon usage of 2A peptide has no effect on the cleavage efficiency of FMDV 2A element. Ó 2014 Elsevier B.V. All rights reserved.
27 28 29 30 31 32 33 34 35 36 37 38 39 40
41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62
1. Introduction Foot-and-mouth disease is a highly contagious and infectious disease, which can result in severe economic losses in susceptible cloven-hoofed animals (Klein, 2009). Foot-and-mouth disease virus (FMDV) belongs to the Aphthovirus genus of the family Picornaviridae and exists in the form of seven different serotypes: Asia 1, A, O, C, South African Territories 1 (SAT1), SAT2 and SAT3. FMDV possesses a single stranded positive-sense RNA genome which functions as an mRNA and encodes a viral polyprotein. However, the polyprotein is never observed neither in vivo nor in vitro due to ‘primary’ cleavages. The primary cleavages of polyprotein are mediated by the two virus-encoded proteinases (Lpro and 3Cpro) and a short oligopeptide sequence (2A) (Mason et al., 2003). FMDV 2A is an 18-aa peptide characterized by a C-terminal ‘-ExNPG2A/ P2B-’motif, and this peptide along with the first amino acid of the 2B protein (Pro2B) can mediate the cleavage process in the artificial polyprotein systems (Donnelly et al., 1997; Ryan and Drew, 1994). The 2A/2B cleavage event is a modification of the translational machinery by the 2A peptide which allows the release of the protein-2A from the ribosome while permitting the synthesis of the downstream proteins to proceed (Donnelly et al., 1997, 2001). ⇑ Corresponding author. Tel./fax: +86 931 8342771. 1
E-mail address: [email protected] (Y.-s. Liu). The two authors contributed equally to this work.
Meanwhile, the efficiency of this cleavage process is not complete and translation through the 2A coding sequences also leads to a proportion of full-length ORF product being produced (Donnelly et al., 2001; Ma and Mitra, 2002; Ryan and Drew, 1994). The coexpression of proteins linked by 2A peptides is independent of cell types, since the cleavage reaction only depends on eukaryotic ribosome, which is structurally conserved among the eukaryota. It should be noted that the cleavage site (G2A/P2B) of 2A/2B plays a key role in the self-cleavage event (Ryan and Drew, 1994; Sharma et al., 2012). Mutations in these amino acids can reduce or abrogate the cleavage activity (Donnelly et al., 2001; Doronina et al., 2008; Sharma et al., 2012). The cleavage activity was abrogated when ‘‘G2A’’ was mutated to other amino acids (Donnelly et al., 2001; Sharma et al., 2012). Experiments on mutated 2A elements mainly focused on single amino acid mutants and Nterminal extension or deletion (Donnelly et al., 2001; Minskaia et al., 2013; Sharma et al., 2012). Recently, numerous studies reported that the synonymous codon usage bias also plays an important role in the translation of gene (Kramer et al., 2009; Kudla et al., 2009; Tuller et al., 2010; Welch et al., 2009). Even single-nucleotide synonymous mutation can affect gene expression (Hamano et al., 2007; Kimchi-Sarfaty, 2011). The mRNA might contain additional information, beyond the amino acid sequence, that can fine-tune protein folding and translational pausing at a rare codon can also affect protein folding (Komar, 2009). The co-translational cleavage reaction mediated by 2A peptide occurs
http://dx.doi.org/10.1016/j.meegid.2014.08.006 1567-1348/Ó 2014 Elsevier B.V. All rights reserved.
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 2 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105
Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
immediately after polypeptide-chain synthesis at the ribosomal peptidyltransferase center, where the nascent chain is hydrolytically released from tRNA despite of further nonstop codons. Thus, the G2A seems to be the most important amino acid for 2A activity despite of the conserved ‘-ExNPG2A/P2B-’motif, for it locates right upstream of the cleavage site. The conservation of G2A and its specific location contribute to the assumption that the silent mutations of G2A may have influence on the cleavage efficiency of FMDV 2A element. So far, there is no report revealing the effect of synonymous codon usage of G2A on 2A cleavage activity. In this study, the synonymous codon usage of 2A peptide especially the G2A was investigated. By altering the synonymous codons of G2A, we analyzed the role of synonymous codons of G2A in the efficiency of 2A cleavage in an artificial report system, which is composed of the genes of chloramphenicol acetyltransferase protein (CAT) and enhanced green fluorescent protein (EGFP) linked by the 2A sequence plus the first codon of 2B sequence of FMDV.
106
2. Materials and methods
107
2.1. Sequence data and sequence alignment
108
128
A total of 66 complete RNA sequences of FMDV were downloaded from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/Genbank/), including all 7 serotypes: Asia 1, n = 10 sequences; A, n = 17; C, n = 7; O, n = 19; SAT 1, n = 5; SAT 2, n = 4; SAT 3, n = 4 (Table 1). In order to locate the position of the 2A sequence of FMDV polyprotein, multiple sequence alignments were performed with the Clustal W (1.7) method of DNAstar software (7.0) for Windows based on the previous report, and the 2A sequences were extracted from the whole coding sequences with the manual editing (Table 1). In addition, we employed sequence logos method to analyze the amino acid and synonymous codon usages of the key region ‘-ExNPG2A/P2B-’. Sequence logos are a graphical visualization of a nucleic acid or amino acid multiple sequence alignment. Every logo value consists of stacks of symbols, one stack corresponds each position in the target sequence (Crooks et al., 2004; Schneider and Stephens, 1990). To investigate the synonymous codon usage of G2A located in Cterminal of FMDV 2A, the alignment of 66 2A/2B1 sequences were conducted. The codon usage of G within the codon pair ‘G/P’ among the 66 complete genome sequences excluding 2A region were also compared with that of G2A in cleavage site of 2A/2B.
129
2.2. Cell culture and the nucleotide sequence of self-cleavage element
130
CHO cells (ATCC cat. CCL-61) were grown on F-12K Nutrient Mixture supplemented with 10% fetal bovine serum (FBS; GIBCO, USA). The nucleotide sequence of self-cleavage element is ‘gtt ttg aac ttt gac ctg ctc aag ttg gcg gga gac gtg gag tcc aac cct ggg2A ccc2B1’ encoding LLNFDLLKLAGDVESNPG2A/P2B1.
109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127
131 132 133 134
135
2.3. Plasmid constructions
136
Two reporter genes, chloramphenicol acetyltransferase (CAT) and Enhanced Green Fluorescence Protein (EGFP), were introduced into pcDNA3.1(+) plasmid (Invitrogen) and linked by the selfcleavage element (2A). The CAT and EGFP reporter genes were fused with the self-cleavage element in a single open reading frame (CAT-2A/2B1-EGFP) (Fig. 2). The self-cleavage element was added downstream of the CAT gene (deleting the stop codon) to form the CAT-2A/2B1 fragment, and then the EGFP gene was fused into the downstream of the CAT-2A/2B1 fragment to form the CAT2A/2B1-EGFP fragment. Two steps of PCR were required to fuse 2A/
137 138 139 140 141 142 143 144 145
2B1 to CAT. The sequence of oligonucleotides used for step 1 PCR were: 50 -CGGGATTCATGGAGAAAAAAATCAC-30 containing BamHI site for forward primer and 50 -CGTCTCCCGCCAACTTGAGCAGGTCA AAGTTCAAAACCGCCCCGCCCTGCCACT-30 for reverse primer. The pcDNA3.1(+)/CAT (Invitrogen) plasmid was used as template. The step 2 PCR employed the same forward primer and 50 -TCGCCCT TGCTCACCATTGGCCCAGGGTTGGACTCCACGTCTCCCGCCAACTTG-30 as reverse primer. In this step, the step 1 PCR products were used as template. EGFP amplification was performed with the following primers: 50 -ATGGTGAGCAAGGGCGAGGA-30 for forward primer and 50 -GCTCTAGATTACTTGTACAGCTCGTC-30 containing XbaI site for reverse primer and the pEGFP-N1 plasmids was used as template. The PCR products of CAT-2A/2B1-EGFP were digested with BamHI and XbaI restriction enzymes and cloned into pcDNA3.1(+) using BamHI and XbaI restriction sites. The method was applied to for making the other three mutants constructs by mutating the nucleotide C underlined within step 2 reverse primer into A, T or G. Thus, four types of pcDNA3.1(+)-CAT-2A/2B1-EGFP plasmids containing four synonymous codons of G2A were generated, namely, pCAT-2A(GGG)/2B1-EGFP, pCAT-2A(GGC)/2B1-EGFP, pCAT -2A(GGT)/2B1-EGFP and pCAT-2A(GGA)/2B1-EGFP. A positive control plasmid pCAT-2A(P)/2B1-EGFP in which the G2A is replaced by Proline was produced and it was demonstrated to express the uncleaved product CAT-2A/2B1-EGFP (Sharma et al., 2012). Constructs were verified by sequencing. Besides, the plasmids pcDNA3.1(+) and pcDNA3.1(+)/CAT were also used as control.
146
2.4. In vitro translation and Western blot
172
CHO cells were cultured in six well culture cluster plates at 80% confluence. Transient transfections were performed using Lipofectamin™ 2000 (Invitrogen) to introduce the resulting plasmids into CHO cells. Cells were lysed in 200 lL Mamalian Protein Extraction Reagent (ComWin, Beijing) containing 1% PMSF after 24 h post transfection. Cell lysate was centrifuged and the supernatant was collected and subjected to the Western blot analyses. 20 lL of the protein extracts and prestained protein standard Markers were separated using a 12% sodium dodecyl sulfate–polyacrylamide gel and then blotted onto a polyvinylidene fluoride membrane (PVDF). The membranes were processed using diluted (1:10000) Rabbit Anti-CAT Monoclonal Antibody (SIGMA–ALDRICH, Lot No. 010M4805) and Polyclonal Goat Anti-Rabbit Antibody (SIGMA– ALDRICH, Lot No. 111M4750) with a dilution (1:5000) in Phosphate Buffered Saline Tween (PBST)/5% skimmed milk powder. The PVDF membranes were resolved with an enhanced chemiluminescence (ECL) Western blotting detection kit (CoWin Biosicence, Lot No. 2114) according to manufacturer’s instructions. Signals were captured by exposure to Kodak X-ray film. The same membranes were incubated in Stripping Buffer (CoWin Biosicence, Lot No. 0113D) for 20 min to remove the binding antibodies. Then the membranes were processed using diluted (1:5000) Mouse Anti-b-Actin Monoclonal Antibody (TRANSGEN BIOTECH, Lot No. HC-201-01) and Anti-Mouse Antibody (TRANSGEN BIOTECH, Lot No. HS-101-01) with a dilution (1:5000) in Phosphate Buffered Saline Tween (PBST)/5% skimmed milk powder and after which the signals were exposed to Kodak X-ray film according to the methods before. Protein Western blot bands were quantified with Image J software. All experiments including the transfection of the CHO cells and Western blot were performed in triplicate.
173
2.5. Data analysis
203
Two fragments, the cleavaged portion (CAT-2A) uncleaved product (CAT-2A/2B1-EGFP), were detected
and and
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171
174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202
204 205
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
3
Table 1 Genomes examined, serotype accession numbers and F2As sequence.
206 207 208 209
Serotype
Accession No.
Sequences of F2As
Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 Asia 1 A A A A A A A A A A A A A A A A A C C C C C C C O O O O O O O O O O O O O O O O O O O SAT 1 SAT 1 SAT 1 SAT 1 SAT 1 SAT 2 SAT 2 SAT 2 SAT 2 SAT 3 SAT 3 SAT 3 SAT 3
AY304994 DQ989322 AY687334 AY687333 FJ906802 GQ452295 EF149010 AY593800 AY593796 AY593795 EF494487 EF494486 AY593751 AY593789 AY593767 AY593770 AY593782 AY593787 AY593788 AY593803 AY593753 AY593756 AY593757 AY593768 AY593794 AY593771 AY593758 FJ824812 AM409325 DQ409191 AY593809 AY593810 AY593805 AY593806 EF552697 EU400597 EU140964 AF026168 NC_004004 AJ539139 AY593819 AY593835 AY593833 AF511039 EF175732 DQ248888 AJ320488 AJ633821 AH012984 AB079061 AF189157 AY317098 AH012985 AY593838 AY593840 AY593841 AY593842 AY593843 AF540910 AY593847 AY593848 AY593849 AY593850 AY593851 AY593852 AY593853
GTTTTGAACTTTGACCTGCTCAAGTTGGCGGGAGACGTGGAGTCCAACCCTGGG GTATTGAACTTCGACCTGCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG GTACTGAACTTCGACCTGCTCAAGTTGTCAGGAGACGTTGAGTCCAACCCTGGG ATGATGAACTTCGACCTGCTTAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG ACTTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTGGAGTCCAACCCTGGG ACCTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTGGAGTCCAACCCTGGG ATGATGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG GTTTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG ACTTTGAACTTTGACCTGCTCAAGTTGGCGGGAGACGTGGAGTCCAACCCTGGG CTTCTGAACTTTGACCTACTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTCCTGAACTTCGACCTCTCAAGTTGGCGGGAGACGTCGAGTCTAACCCTGGG CTCCTGAACTTCGACCTGCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGG CTCTTGAACTTTGACCTACTTAAGTTGGCGGGTGACGTTGAGTCCAACCCTGGA CTGCTGAACTTTGACCTTCTCAAACTGGCGGGTGACGTTGAGTCCAACCCTGGG TTGTTGAACTTCGATCTGCTTAAGTTGGCTGGAGACGTGGAGTCCAACCCTGGG CTTCTGAACTTTGATCTGCTTAAGTTGGCTGGGGACGTGGAGTCCAACCCTGGA TCTCTGAACTTCGACCTGCTCAAGCTGGCGGGAGACGTTGAGTCCAACCCCGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCTGGGGACGTGGAGTCCAATCCTGGA CTTTTGAACTTTGACCTACTCAAGTTGGCTGGGGACGTGGAGTCCAATCCTGGA CTTTTGAACTTTGACCTGCTCAAGTTGGCTGGGGACGTGGAGTCCAACCCTGGA CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAATCCTGGG CTTTTGAATTTTGACCTGCTCAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCTGGGGACGTCGAGTCCAACCCTGGA TTGCTGAATTTTGACCTACTCAAGTTAGCTGGAGACGTGGAGTCCAACCCTGGG CTTTTGAACTTTGACCTACTCAAGTTGGCGGGCGACGTTGAGTCCAACCCTGGG CTGCTGAACTTTGACCTGCTCAAGTTGGCTGGAGATGTGGAGTCCAACCCTGGG CTGCTGAACTTTGGCCTGCTCAAGTTGGCTGGAGACGTGGAGTCCAACCCTGGG CTGCTGAACTTTGACCTGCTCAAGTTGGCTGGAGATGTGGAGTCCAACCCTGGG CTATCGAACTTTGACCTGCTCAAGTTGGCTGGGGATGTGGAGTCCAACCCTGGA CTGCTAAACTTTGACCTACTCAAGTTGGCTGGAGACGTGGAGTCCAACCCTGGG CTGCTGAACTTTGACCTGCTCAAGTTGGCTGGAGATGTGGAGTCCAACCCTGGG CTGCTGAACTTCGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCCGGG CTTCTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG ACTTTGAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTTTTGAAGTTAGCAGGAGACGTTGAGTCCAACCCCGGA CTTCTGAACTTCGACCTTCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG CTTCTGAACTTCGACCTTCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG ACTTTGAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTGTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGCCCAACCCTGGG CTCGAGCGTCAAAAACCCCTGAAAGTGAGGGCCAAGCTCCCACAGCAGGAGGGG CTTCTGAACTTTGACCTGCTCAAGTTGGCAGGGGACATGGAGTCCAACCCTGGG CTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGATGTTGAGTCCAACCCTGGG CTTCTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGG CTGTGTAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG TTGTGTAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG TTGTGCAACTTCGACCTGTTAATGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTTCGACCTGTTAAAGTTGGCTGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTTCGACCTGTTGAAGTTGGCTGGAGACGTTGAGTCCAACCCCGGG CTGTTCAACTTCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGCAACTGCGACCTGTTAAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTTTTGAACTTTGACCTGTTAAAGTTGGCGGGAGACGTTGAGTCTAACCCTGGG TTGTGTAACTTCGACCTGTTAAAGTTGGCTGGAGATGTTGAGTCCAACCCTGGG CTGTGTAACTTCGACCTGTTGAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG CTGTGTAACTTCGACCTGTTGAAGTTGGCCGGAGACGTTGAGTCCAACCCTGGG ATGTGCAACTTCGACCTGTTGAAGTTGGCCGGAGACGTCGAGTCCAACCCTGGG
confirmed. R¼
Cleavage
P CAT-2A=2B1 P CAT-2A=2B1 þP CAT-2A=2B1-EGFP
efficiency
(%)
was
calculated
as:
100% where R value means the efficiency
cleavage mediated by one of the plasmids containing 2A elements; PCAT-2A/2B1 represents the degree of cleavage of CAT-2A/2B1
fragment from the CAT-2A/2B1-EGFP fragment; PCAT-2A/2B1-EGFP represents the degree of non-cleavage of CAT-2A/2B1-EGFP. It should be noted that the three controls have no R value (Fig. 2). The results are assessed according to the ANOVA test based on SPSS. 19 software and there is significant difference when P < 0.05.
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
210 211 212 213 214
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 4
Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
Fig. 1. Graphical representation of alignment of amino acid (top) and nucleotide (bottom) sequences for 66 ‘-ExNPGP-’ motifs using Weblogo. The overall height of the stack indicates the sequence conservation at that position, while the height of symbols within the stack indicates the relative frequency of each amino or nucleic acid at that position.
Fig. 2. pcDNA3.1CAT-2A/2B1-EGFP constructs and the outcomes of translation. Bold area represents 2A sequences and boxed areas represent ORFS encoding CAT or EGFP. All plasmids were based on pcDNA3.1(+) transcription vectors.
215
3. Results
216
By aligning the ‘-ExNPG2A/P2B-’motifs derived from 66 FMDV RNAs using sequence logos, it is clear that the key region peptide has a strong tendency to select the specific motif ‘ESNPG2AP2B’ (Fig. 1). It was also found that the synonymous codon usage of this conserved motif is biased. The amino acids E, S, N tend to use GAG, TCC and ACC respectively. It is interesting to find that the two prolines (Pro) flanking G2A have different codon usage. The first proline located upstream of G2A tends to select CCT, while the other one located downstream of G2A tends to select CCC (Fig. 1). For ‘‘G2A’’, it was found that the synonymous codon GGG is the most conserved in the self-cleavage element of FMDV polyprotein. As for the amino acid ‘‘G’’, the synonymous codon distributions for G2A are GGG (58/66), GGA (8/66), GGC (0/66), GGT (0/66), respectively. It is apparent that the GGG is the dominant (87.9%) synonymous codon in G2A, while the GGG within G/P pairs in the entire coding region (excepting the 2A region) merely account for 28.0%. and GGA accounts for 59.3% (Table 2). As is detected by anti-CAT antibody in Fig. 3A, controls with the empty expression vector pcDNA3.1(+) transfected CHO cell
217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234
produced no translation products and vectors pcDNA3.1(+)/CAT and pcDNA3.1(+)CAT-2A(Proline)/2B-EGFP express [CAT] and [CAT-2A-EGFP]. By comparing the lanes deriving from all 7 plasmids, it can be concluded that the top and bottom lanes detected by anti-CAT antibody refer to the cleavaged fragment [CAT-2A] and uncleaved fragment [CAT-2A/2B1-EGFP], respectively. The results showed that the silent mutations of G2A of 2A did not abrogate the ‘cleavage’ activity and the 2As with four synonymous codons GGG, GGC, GGA, GGT coding C-terminal glycine possess the average ‘cleavage’ efficiency of 88.1%, 87.6%, 88.5%, 87.3%, respectively (Fig. 3B) and all three sets of R values situated between 86% and 89% and the slight difference can be neglected (Table 3). There is also no significant difference (P > 0.05) among the three sets of four R values, indicating that the synonymous codon alterations of G2A have no effect on the cleavage efficiency of FMDV 2A.
235
4. Discussion
251
The synonymous codons distribution of Gly within ‘G2A/P2B’ codon pairs in the entire coding region (excepting the 2A region) was extremely different from that in the ‘G2A/P2B’ codon pairs: the synonymous codon (GGG) for G2A were frequently selected in the codon pair Gly2A/Pro2B, suggesting that the synonymous codon usage bias for Gly2A is sustained under the positive selection during the evolution of FMDV. It is generally stated that the amino acid sequences determine the protein expression and function. However, codon usage is one major factor that can affect translation speed or dynamics (Akashi, 2001; Bulmer, 1991; Novoa and Ribas de Pouplana, 2012). Protein synthesis by ribosomes takes place on a linear substrate with non-uniform speed. Transient pausing of ribosomes can cause various co-translational processes, including protein targeting and folding (Li et al., 2012). Nascent 2A peptides were shown to interact with the ribosomal exit tunnel to dictate the co-translational ‘stop-carry on’ recoding (Sharma et al., 2012). By analyzing the role of mRNA sequence in the synthesis of the protein, it was found that the formation of the local protein structure is influenced by the corresponding nucleotide sequence even the amino acids sequence is retained (Hamano et al., 2007;
252
Table 2 The comparison of total number of synonymous codons distributions between G2A and G within ‘G/P’.
Gly2A Gly
Number of GGA (%)
Number of GGT (%)
Number of GGC (%)
Number of GGG (%)
8 (12.1%) 527 (59.3%)
0 (0%) 37 (4.17%)
0 (0%) 75 (8.44%)
58 (87.9%) 249 (28.0%)
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
236 237 238 239 240 241 242 243 244 245 246 247 248 249 250
253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
5
Fig. 3. (A) Western blot results detected by incubation with anti-CAT and anti-b-actin antibodies. The p, pCAT, pC2AE represent pcDNA3.1(+), pcDNA3.1(+)/CAT, pcDNA3.1(+)CAT-2A(Proline)/2B-EGFP plasmids. GGA, GGT, GGC, GGG represent four pCAT-2A/2B1-EGFP plasmids with corresponding synonymous codon of G2A. M, markers in kDa. Top and bottom refer to the uncleaved product (CAT-2A/2B1-EGFP), and the cleavaged portion (CAT-2A), respectively; (B) gray scale quantification of four pCAT-2A/ 2B1-EGFP plasmids. Average cleavage efficiency (% of releasing CAT-2A/2B1 from CAT-2A/2B1-EGFP) ± one standard deviation is shown.
Table 3 The R value conducted by four plasmids containing 2A with four synonymous codons of G2A. Codon of G2A
R1 (%)
R2 (%)
R3 (%)
GGA GGT GGC GGG
87.2 88.9 88.9 86.5
88.3 86.0 88.7 87.0
89.0 87.9 88.0 88.5
R1, R2, R3 represent three sets of the results of cleavage efficiency and GGA, GGT, GGC, GGG represent the four pCAT-2A/2B1-EGFP plasmids containing the corresponding synonymous codon for G2A.
272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295
Kimchi-Sarfaty, 2011; Komar et al., 1999). Modelling of the 2A sequence showed that the Gly2A/Pro2B may form part of a tightturn immediately downstream of an alpha-helix (Donnelly et al., 2001). As for the synonymous codon usage of G2A, the usage pattern is biased and GGG is the most frequently used. It needs more energy to break the equilibrium of codon and anti-codon bond formed by guanine and cytosine than that by adenine and thymine. The synonymous codon with high pairing energy has a strong ability to bind to the tRNA anti-codon within the ribosome, leading to low translation efficiency of gene (Bush et al., 2003; Cannarozzi et al., 2010; Groeneveld et al., 1995; Hershberg and Petrov, 2008). Naturally, the conserved synonymous codon usage of G2A/ P2B1 leads to the assumption that as a turn point, the synonymous codons of G2A may slightly affect the speed of scanning of ribosome and result in the differences of the cleavage efficiency as a result of a cumulative process. However, the result showed that the cleavage efficiency mediated by 2A with perfect codon GGG at the cleavage site of 2A/2B and the non-perfect ones (GGA, GGT, GGC) is unaffected, which indicate that the synonymous codon usage bias existing in the self-cleavage site of 2A/2B is merely a preference under the positive-selection during evolution of FMDV. The results also indicate that the synonymous codon usage of 2A peptide has no effect on 2A activity despite the presence of biased synonymous codon usage. The results would be beneficial to the application of
2A element, since 2A activity will not be affected regardless of nucleotides sequence changes as long as the amino acids sequence is sustained.
296
Acknowledgements
299
This work was supported by National Natural Science Founda- Q2 tion of China (Nos. 31302100, 31172335 and 31072143), Interna- Q3 tional Science and Technology Cooperation Program of China (Nos. 2010DFA32640 and 2012 DFG31890) and Gansu Provincial Funds for Distinguished Yong Scientists (1111RJDA005).
300
References
305
Akashi, H., 2001. Gene expression and molecular evolution. Curr. Opin. Genet. Dev. 11 (6), 660–666. Bulmer, M., 1991. The selection-mutation-drift theory of synonymous codon usage. Genetics 129 (3), 897–907. Bush, J.A., Kimball, S.R., O’Connor, P.M., Suryawan, A., Orellana, R.A., Nguyen, H.V., Jefferson, L.S., Davis, T.A., 2003. Translational control of protein synthesis in muscle and liver of growth hormone-treated pigs. Endocrinology 144 (4), 1273– 1283. Cannarozzi, G., Schraudolph, N.N., Faty, M., von Rohr, P., Friberg, M.T., Roth, A.C., Gonnet, P., Gonnet, G., Barral, Y., 2010. A role for codon order in translation dynamics. Cell 141 (2), 355–367. Crooks, G.E., Hon, G., Chandonia, J.-M., Brenner, S.E., 2004. WebLogo: a sequence logo generator. Genome Res. 14 (6), 1188–1190. Donnelly, M.L.L., Gani, D., Flint, M., Monaghan, S., Ryan, M.D., 1997. The cleavage activities of aphthovirus and cardiovirus 2A proteins. J. Gen. Virol. 78, 13–21. Donnelly, M.L.L., Hughes, L.E., Luke, G., Mendoza, H., ten Dam, E., Gani, D., Ryan, M.D., 2001. The ‘cleavage’ activities of foot-and-mouth disease virus 2A sitedirected mutants and naturally occurring ‘2A-like’ sequences. J. Gen. Virol. 82, 1027–1041. Doronina, V.A., Wu, C., de Felipe, P., Sachs, M.S., Ryan, M.D., Brown, J.D., 2008. Sitespecific release of nascent chains from ribosomes at a sense codon. Mol. Cell. Biol. 28 (13), 4227–4239. Groeneveld, H., Thimon, K., Van Duin, J., 1995. Translational control of maturationprotein synthesis in phage MS2: a role for the kinetics of RNA folding? RNA 1 (1), 79. Hamano, T., Matsuo, K., Hibi, Y., Victoriano, A.F., Takahashi, N., Mabuchi, Y., Soji, T., Irie, S., Sawanpanyalert, P., Yanai, H., Hara, T., Yamazaki, S., Yamamoto, N., Okamoto, T., 2007. A single-nucleotide synonymous mutation in the gag gene controlling human immunodeficiency virus type 1 virion production. J. Virol. 81 (3), 1528–1533.
306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
297 298
301 302 303 304
MEEGID 2049
No. of Pages 6, Model 5G
26 August 2014 6 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
Z.-l. Gao et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx
Hershberg, R., Petrov, D.A., 2008. Selection on codon bias. Annu. Rev. Genet. 42, 287–299. Kimchi-Sarfaty, C., 2011. A ‘silent’ polymorphism in the MDR1 gene changes substrate specificity (January, pg. 525, 2007). Science 334 (6052), 39. Klein, J., 2009. Understanding the molecular epidemiology of foot-and-mouthdisease virus. Infect. Genet. Evol. 9 (2), 153–161. Komar, A.A., 2009. A pause for thought along the co-translational folding pathway. Trends Biochem. Sci. 34 (1), 16–24. Komar, A.A., Lesnik, T., Reiss, C., 1999. Synonymous codon substitutions affect ribosome traffic and protein folding during in vitro translation. FEBS Lett. 462 (3), 387–391. Kramer, G., Boehringer, D., Ban, N., Bukau, B., 2009. The ribosome as a platform for co-translational processing, folding and targeting of newly synthesized proteins. Nat. Struct. Mol. Biol. 16 (6), 589–597. Kudla, G., Murray, A.W., Tollervey, D., Plotkin, J.B., 2009. Coding-sequence determinants of gene expression in Escherichia coli. Science 324 (5924), 255–258. Li, G.-W., Oh, E., Weissman, J.S., 2012. The anti-Shine-Dalgarno sequence drives translational pausing and codon choice in bacteria. Nature 484 (7395), 538–541. Ma, C., Mitra, A., 2002. Expressing multiple genes in a single open reading frame with the 2A region of foot-and-mouth disease virus as a linker. Mol. Breed. 9 (3), 191–199.
Mason, P.W., Grubman, M.J., Baxt, B., 2003. Molecular basis of pathogenesis of FMDV. Virus Res. 91 (1), 9–32. Minskaia, E., Nicholson, J., Ryan, M.D., 2013. Optimisation of the foot-and-mouth disease virus 2A co-expression system for biomedical applications. BMC Biotechnol. 13 (1), 1–11. Novoa, E.M., Ribas de Pouplana, L., 2012. Speeding with control: codon usage, tRNAs, and ribosomes. Trends Genet. 28 (11), 574–581. Ryan, M.D., Drew, J., 1994. Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. EMBO J. 13 (4), 928–933. Schneider, T.D., Stephens, R.M., 1990. Sequence logos: a new way to display consensus sequences. Nucleic Acids Res. 18 (20), 6097–6100. Sharma, P., Yan, F., Doronina, V.A., Escuin-Ordinas, H., Ryan, M.D., Brown, J.D., 2012. 2A peptides provide distinct solutions to driving stop-carry on translational recoding. Nucleic Acids Res. 40 (7), 3143–3151. Tuller, T., Carmi, A., Vestsigian, K., Navon, S., Dorfan, Y., Zaborske, J., Pan, T., Dahan, O., Furman, I., Pilpel, Y., 2010. An evolutionarily conserved mechanism for controlling the efficiency of protein translation. Cell 141 (2), 344–354. Welch, M., Villalobos, A., Gustafsson, C., Minshull, J., 2009. You’re one in a googol: optimizing genes for protein expression. J. R. Soc. Interface 6 (Suppl. 4), S467–S476.
Please cite this article in press as: Gao, Z.-l., et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.08.006
357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377
