Behavioural Brain Research 280 (2015) 149–159

Contents lists available at ScienceDirect

Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr

Research report

3␣-diol administration decreases hippocampal PKA (II) mRNA expression and impairs Morris water maze performance in adult male rats Somayeh Assadian Narenji a,∗ , Nasser Naghdi b , Kayhan Azadmanesh c , Rosita Edalat c a

Department of Biology, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran Department of Physiology and Pharmacology, Pasteur Institute of Iran, Tehran 13164, Iran c Department of Virology, Pasteur Institute of Iran, Tehran 13164, Iran b

h i g h l i g h t s • • • •

We investigated the effect of 3␣-diol on acquisition stage of spatial memory. We examined changes in the level of PKA (II) gene expression. 3␣-diol as metabolites of testosterone impaired spatial memory. 3␣-diol decrease PKA (II) mRNA expression in hippocampus of adult male rats.

a r t i c l e

i n f o

Article history: Received 23 September 2014 Received in revised form 15 November 2014 Accepted 22 November 2014 Available online 28 November 2014 Keywords: 3␣-diol Protein kinase A Hippocampus Spatial memory

a b s t r a c t The effect of testosterone and its metabolites on learning and memory has been the subject of many studies. This study used the Morris water maze task to investigate the effect of intra-hippocampal injection of 3␣-diol (one of the metabolites of testosterone) on acquisition stage of spatial memory in adult male rats. During the experiment we observed that 3␣-diol, significantly impaired Morris water maze performance in treated rat’s compared with controls. Because signaling event mediated by protein kinase A (PKA) especially PKA (II) are critical for many neuronal functions such as learning and memory, the hippocampus was analyzed for mRNA expression of PKA (II) using TaqMan real time RT-PCR. The results indicated that the transcription levels of PKA (II) were significantly decreased in animals treated with 3␣diol compared with controls. Thus, the findings suggest that administration of 3␣-diol in hippocampus of adult male rats impairs memory function, possibly via down-regulation of PKA. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Androgens are lipids, derived from cholesterol, synthesized in the gonads by a series of enzymatic modifications, and reach the brain via the blood circulation. In addition, some neurosteroids can be synthesized directly by neurons and glial cells in the central and peripheral nervous system that have profound their effects on mood and on memory functions [1–4]. Androgens may influence cognitive performance [5]. There are both basic and clinical reports showing that androgens are involved in the modulation of

∗ Corresponding author at: Department of Biology, Tonekabon Branch, Islamic Azad University, Tonekabon 46815/586, Iran. Tel.: +981154271105-9; fax: +981154274409. E-mail addresses: S [email protected], [email protected] (S.A. Narenji). http://dx.doi.org/10.1016/j.bbr.2014.11.038 0166-4328/© 2014 Elsevier B.V. All rights reserved.

learning and memory [5,6]. Changes in gonadal androgen levels over the time of life, in addition to cause the variation in cognitive function, make some type of neurodegenerative disorder such as Alzheimer diseases [6,7]. The hippocampus in the limbic brain is linked with several types of learning and memory function [8]. In most mammals, the hippocampus has a well-documented role in spatial memory acquisition [9]. Also, androgen receptors are densely expressed in rat hippocampal cells [1,10] and much of the work on steroid-induced learning has focused on the effects of androgens in hippocampal spatial memory which indicates a relationship between the androgens and hippocampal cognitive function. However, the literature describing the effects of androgens on spatial memory is complex and contradictory [1,10,11]. Evidence for both positive and negative correlations can be found [8]. Some evidence suggests that androgens can impair memory in animals [12]. It has been shown that injection of testosterone in the CA1

150

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

region of hippocampus impaired spatial memory in adult male rats [1,10,13]. A report also indicated that chronic treatment with androgens impaired spatial learning and retention of spatial information in young and middle-aged animals [14]. In contrast, some studies showed a positive correlation between testosterone and its metabolites and spatial ability [5,15]. For instance, men with lower levels of testosterone due to hypogonadism or aging demonstrate poorer cognitive performance, and these deficits can be reduced through androgen-replacement therapy [16]. Also in animal models, it has been reported that gonadectomy or removal of the primary source of male androgens, the testes, decreases cognitive performance in adult male rats [1,10,11,17]. Thus the mechanisms for androgens’ effects on learning and memory processes are of interest and can be studied more in animal models. The main question in this regard is how androgens exert positive or negative effects on memory? The answer is very complex and ambiguous. One of the complexities in understanding the effects of androgens is the broad spectrum of steroid activity. Because, androgens represent substrates for the synthesis of several biologically active metabolites [6] so that in brain, testosterone is readily metabolized by the 5␣-reductase enzyme to dihydrotestosterone (DHT), which is subsequently converted by the 3␣-hydroxysteroid dehydrogenase enzyme (3␣-HSD) to non-aromatizable metabolite 5␣-androstane-3␣, 17␤-diol (3␣-diol) [5,18]. Since our previous studies showed that intra-hippocampal injection of testosterone can impair the spatial memory [1,10,11], it is likely that this effect is caused by testosterone metabolites such as 3␣-diol. Many studies on the effect of 3␣-diol on hippocampal memory have been made in recent decades. It must be said that some studies have implicated the positive role of 3␣-diol on memory. For example, systemically administration of 3␣-diol to gonadectomized rats enhances cognitive performance in the inhibitory avoidance, place learning and object recognition tasks [19–21]. Further, blocking testosterone metabolism to 3␣-diol with indomethacin decreases cognitive performance and increases anxiety behavior of gonadally intact or DHT-replaced rats [5]. Furthermore, subcutaneous injection of 1 mg/kg 3␣-diol improved performance across inhibitory avoidance and MWM tasks in aged rats [18]. But there is no information about the effect of direct intra-hippocampal injection of 3␣-diol on spatial learning and memory in MWM task. So it would be interesting to study. Another important question is related to the intracellular effects of androgens. It should be noted here that in addition to genomic mode of action of androgens, an increasing body of evidence suggests that androgens can exert rapid, non-genomic effects. This activity typically involves the rapid induction of second messenger signal transduction cascades, including increases in free intracellular calcium, and activation of protein kinase A (PKA), protein kinase C (PKC) and MAPK leading to diverse cellular effects including neuronal plasticity [22,23]. Signaling event mediated by protein kinase A (PKA) is critical for many neuronal functions such as learning and memory [24]. PKA is made up of four subunits: two regulatory subunits that inhibit two catalytic subunits. The catalytic subunits are the active phosphorylating portions of the enzyme. When the level of cAMP rises in the cells, the cAMP binds to the regulatory subunits of PKA, causing them to undergo a conformational change that frees the active catalytic subunits and allows it to phosphorylate its substrates [24,25]. PKA isoforms are classified into type I and II based on the regulatory subunits, with type II, especially II␤, thought to be the dominant isoform in many neurons [24]. In both invertebrates and vertebrates there is ample evidence that PKA plays a key role in the formation of transcription-dependent long-term memory. In various species it has been shown that training procedures induce a prolonged activation of PKA, which is a critical step for the induction of molecular processes of long term memory [26]. A high concentration of

PKA alters gene expression in the nucleus, and more proteins are synthesized, thereby allowing more synapses to be produced [27]. Thus, the basic purpose of this study was to investigate the effect of 3␣-diol intra-hippocampal administration on acquisition stage of spatial memory using the Morris water maze (MWM) task and PKA (II) mRNA expression in male rat hippocampus using quantitative real-time RT-PCR. Taken together, the goal of this paper is to provide the overview of testosterone metabolites (3␣-diol) effects on cognition, providing some issues for future research. Since the effects of androgens on memory, is complex and contradictory, So one of the challenges today’s researchers, is studies of these hormones in details, to explore different aspects of their behavioral and molecular effects and expand their horizons in this field. The attainment of these assurances, of course, requires careful and deep scientific and laboratory study. 2. Materials and methods All procedures described herein were approved by the Helsinki recommendations and followed the internationally accepted principles for the use of experimental animals. All efforts were made to minimize the number of animals and their suffering. 2.1. Subject Male albino Wistar rats (200–250 g) were obtained from the Pasteur Institute (Tehran, Iran) and housed five per big cage before surgery and individually in small cages after surgery. The animals were maintained at room temperature of 23 ± 2 ◦ C under standard 12:12 h light–dark cycle with lights on at 07:00 A.M. and allowed to adapt to the novel laboratory environment for 1 week. Food and water were available ad libitum. 2.2. Surgery Rats were anesthetized with a mixture of ketamine hydrochloride (Sigma, Germany) and xylazine (respectively, 100 mg/kg and 25 mg/kg, i.p.) and mounted in a stereotaxic frame (Stoelting, USA). Bilateral guide cannulas were inserted into the right and left CA1 and attached to the skull surface using dental cement and jeweler’s screws. Stereotaxic coordinates based on Paxinos and Watson’s atlas of the rat brain [28] was: anterior–posterior (AP), −3.8 mm from bregma; medial–lateral, ± 2.2 mm from midline; and dorsal–ventral, −2.7 mm from the skull surface. After surgery, at least a 7-day recovery period was supposed before any other intervention. 2.3. Microinjection procedure Intra-hippocampal injections were administered through guide cannula (23 gauge) using injection needles (30 gauge) connected by polyethylene tubing to 0.5 ␮l Hamilton micro-syringes. The injection needle was inserted 0.5 mm beyond the tip of the cannula. DMSO (dimethyl sulfoxide) (Daroopakhsh Mf. Co.) (0.5 ␮l) and different doses of 3␣-diol (Sigma, USA) were injected into each side of CA1 region during 2 min and the needles were left in place for an additional 60 s to allow for diffusion of solution away from the needle tip. In all experiments, DMSO was used as vehicle that has no significant effect on learning and memory in MWM [1,7]. Injection was done 25–35 min before training in 4 consecutive days. 2.4. Morris water maze Spatial learning was investigated in 3␣-diol, treated and control rats using the MWM performance test. A dark circular pool 140 cm

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

151

Fig. 2. Gel electrophoresis of extracted RNA.

Fig. 1. Coronal brain section from cannulated and injected rat.

in diameter and 60 cm in height was filled with water (21 ± 1 ◦ C) and a transparent 10 cm × 10 cm platform was submerged 1 cm below the surface of the water. The pool was located in a room used for behavioral studies with a constant environment and visual cues on curtains around the pool. A video camera connected to a tracking system (Ethovison XT, version 7) was mounted above the pool to allow thorough analysis of each trial and calculate the escape latency, traveled distance and swimming speed. Four training trials were conducted each day for 4 consecutive days. At the beginning of each trial, an animal was started at one of four different starting points, in random order (designated north, east, south and west). The rat was carefully placed in the water and positioned to face the wall of the pool; it was allowed to locate the hidden platform, which was situated in the southeast quadrant during all training trials. A maximum time of 90 s was allowed for each trial. If the rat did not locate the platform within the maximum time, it was guided to the platform and allowed to remain there for 20 s. On experimental day 5, the animals underwent a 60 s probe trial to determine the extent to which they had learned the location of the platform. After the probe trial, the platform was elevated above the water surface and placed in different positions (southeast quadrant). This stage assessed visio-motor coordination toward a visible platform. All testing began at 8:00 A.M. Following behavioral testing, the rats were decapitated and the brains were carefully removed. For histological examination of cannulae and needle placement in CA1 area, 100 ␮m thick sections were taken, mounted on slides and cannulae track were examined randomly for rats (Fig. 1). For molecular study, hippocampus structure were dissected from other brains, immediately frozen in liquid nitrogen and stored at −70 ◦ C until further processing. A total of six brains were used for each group in molecular studies. 2.5. Experimental protocol 2.5.1. Experiment 1 The first experimental group consisting of intact (without cannula) and sham-operated rats received bilateral microinjection of 0.5 ␮l vehicle (DMSO) into CA1 region of hippocampus. The aim of this experiment was to compare the effects of intra-hippocampal vehicle injection with intact group of rats on MWM performance. A total of 18 rats were divided into two groups that mentioned above. 2.5.2. Experiment 2 The aim of this experiment was to determine the effect of bilateral pre-training administration of 3␣-diol into CA1 region on

acquisition stage of spatial memory. A total of 45 rats were used, randomly divided into five groups and received different doses of 3␣-diol (0.2, 1, 3 and 6 ␮g/0.5 ␮l/side) or DMSO as a vehicle. 2.6. RNA extraction Frozen tissues were homogenized by manual mortar and pestle grinding and were used for RNA extraction using QIAzol lysis reagent from QIAGENE (Qiagen, Germany). Total RNA was extracted from the tissue according to the manufacturer’s suggested protocol. Aliquots of the RNA solution were taken for quantification and qualification. RNA integrity was confirmed by inspecting the electrophoretic pattern of 28s and 18s ribosomal RNA in 2% agarose gels (Fig. 2). The purity and yield of total RNA were determined by measuring the absorbance of aliquots at A260 and A280 nm with spectrophotometer (Picodrop Co., UK). The amount of the 260/280 OD ratio of all samples was between 1.8 and 2.2, indicating their high purity. To recover the extracted RNA it was immediately stored at −80 ◦ C. 2.7. cDNA synthesis Extracted RNA was incubated at 75 ◦ C for 5 min and then was immediately cooled on ice for 5 min. cDNA synthesis was carried out in a 20 ␮l reaction volume containing 4 ␮l Revert Aid RT buffer (Fermentas Life Science, Lithuania), 2 ␮l of 10 mM deoxynucleoside triphosphate mixture (dNTPs) (Fermentas Life Science, Lithuania), 0.5 ␮l of 40 U/␮l RNase inhibitor protector (Fermentas Life Science, Lithuania), 1 ␮l of 200 U/␮l RevertedAid RT (Fermentas Life Science, Lithuania), 0.5 ␮l Random Hexamer primer, 9 ␮l injection water, and 3 ␮l of the extracted RNA from tissue. Reaction was performed for 10 min at 25 ◦ C and 60 min at 37 ◦ C and terminated by incubating at 75 ◦ C for 15 min. We did not routinely DNAse-treat our samples as experiments performed in our laboratories showed minimal effects of DNAse treatment, reflecting the minimal presence of contaminating genomic DNA.

2.8. Probe and primer design PCR Primers and TaqMan Probe were designed using Primer Express software (Applied Biosystems, USA). This program selects probe and primer sets with optimized melting temperatures, secondary structure, base composition, and amplicon lengths. These sets are shown in Table 1.

152

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

Table 1 Sequences of PCR primers and probes used in the assays. Gene symbol

Gene name

Primers and TaqMan probes

Sequences 5 → 3

PKA (II)

Protein kinase II

Ywhaz

Tyrosine 3-monooxygenase/tryptophan, 5-monooxygenase activation protein, zeta

CycA

Cyclophilin A

hActB

␤-Actin

F R Probe F R Probe F R Probe F R Probe

GAGGCCGCGGAAGCA TCTGCATCATCTTCTTCTTCATCAG ATAAACCGGTTCACAAGGCGTGCCTC GCT GGG CCG GAG AAC TGT CAC GCA CGA TGA CGT CAAA CAC CAA TCA ACG GTT GCC ATA GCAGC TCG CCA CTT GCT GCA GA C CCC AAG GGC TCT CCA TCA TCA ACC CCA CCG TGT ACT TCA ACA TCAC AGC CAT GTA CGT AGC CAT CCA TCT CCG GAG TCC ATC ACA ATG TGT CCC TGT ATG CCT CTG GTC GTA CCAC

2.9. TaqMan real-time PCR quantification TaqMan real-time quantitative PCR (qPCR) amplification reactions were carried out in an ABI PRISM 7500 fast real-time system (Perkin-Elmer, Applied Biosystems). The TaqMan probe was duallabeled, with a reporter dye, FAM (6-carboxyfluorescein) at the 5 end of the probe and a quencher dye at the 3 end. Real-time PCR was carried out with TaqMan Universal PCR Master Mix (Applied Biosystems). Briefly, a 20 ␮l reaction mixture consists of 10 ␮l TaqMan Universal PCR Master mix (ABI), 1 ␮l of 10 pmol/␮l primers (forward and reverse) and 0.5 ␮l of 10 pmol/␮l TaqMan probe for each of target genes. A master mix was prepared, vortexed and aliquoted (17.5 ␮l) into the wells of a 0.2 ml optical-grade 96-well PCR plate (Applied Biosystem). Then, 2.5 ␮l of cDNA template was added to a final volume of 20 ␮l. All reactions were carried out in duplicate with one blank reaction without cDNA as a negative control. The thermal cycle run methods were: 95 ◦ C for 10 min (Taq activation), 95 ◦ C for 15 s (denaturation) and 60 ◦ C for 1 min (annealing and extension). The fluorescence emission from individual wells at each cycle was monitored in an ABI Detection System. The ABI system measures a fluorescent accumulation of PCR product by continuous monitoring. For every sample, an amplification plot was generated showing the increase in the reporter dye fluorescence with each cycle of PCR. Quantification of input target amount was analyzed by cycle threshold (Ct) value, the point at which the sample PCR amplification plot crosses the threshold. To construct a standard curve, cDNA was synthesized from total RNA and then diluted in four steps with 1/5 dilution. A standard curve of Ct values against the log value of cDNA was generated for both target gene (PKA (II)) and housekeeping genes. All samples and controls were normalized against reference genes (housekeeping genes). Three references gene (Ywhaz, CycA and ␤-actin) were included in each analysis to correct the differences in the inter-assay amplification efficiency and all transcripts were normalized to these genes expression. Quantification was done using the 2−Ct method according to Livak and Schmittgen [29]. The Ct values were calculated for each gene of interest as follows: Ct (gene of interest) − Ct (internal control gene). Relative changes in the expression levels of one specific gene were calculated by subtracting the Ct of the control group (used as the calibrator) from the corresponding experimental groups. Final values of samples are reported as fold difference relative to the expression of the medium control (calculated as 2−Ct ), with the control arbitrarily set to 1. The size of the products was confirmed by 2% agarose gel (Fig. 3). 2.10. Statistical analysis Statistical evaluation was carried out by Kolmogorov–Smirnov test to examine the normal distribution. Data were analyzed by

Fig. 3. Gel electrophoresis of target and housekeeping genes in real time RT-PCR product.

Student’s t-test for comparison between two groups and one-way analysis of variance (ANOVA) followed by Tukey’s test for overall multiple comparisons. All spatial learning data over training day, from hidden and visible platform were analyzed by two-way repeated measures analysis of variance. Molecular analyses were performed with one sample t-test with the calibrator group’s value set to 1. All results have been shown as means ± S.E.M. For all comparisons, p < 0.05 was considered significant.

3. Results 3.1. Experiment 1: the effects of vehicle The results obtained from Intact and vehicle (DMSO) indicate no significant difference in escape latency (F2,80 = 0.211, p = 0.810), traveled distance (F2,80 = 1.197, p = 0.307) and swim speed between groups (F2,80 = 1.838, p = 0.166) (Fig. 4A–C). These results indicated that injection of DMSO had no effect on spatial learning and swimming ability in behavioral studies.

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

153

Fig. 4. (A) Average escape latency, (B) traveled distance and (C) swimming speed in acquisition stage of spatial memory between intact rats and vehicle (DMSO) group. The columns represent the mean ± S.E.M.

3.2. Experiment 2: the effect of 3˛-diol on acquisition of MWM task Figs. 5–7 show results obtained from injection of 3␣-diol and group receiving DMSO. A significant difference was generally found in escape latency (F5,166 = 5.713, p < 0.001) and traveled distance (F5,166 = 5.281, p < 0.001) (Fig. 5A and B) between groups in hidden platform trials (days 1–4) but no significant differences found in swimming speed (F5,166 = 1.825, p = 0.12) (Fig. 5C). The difference in escape latency and traveled distances between days of training were generally significant (Fig. 6A and B). There was a significant interaction between day and dose for escape latency and traveled distance (Fig. 7A and B). Post hoc multiple comparisons showed that 3␣-diol in dose 1, 3 and 6 ␮g had significantly impaired acquisition of spatial learning compared control group. There was no significant difference of performance among the groups on the visible platform day for escape latency (F5,41 = 0.741, p = 0.597) or traveled distance (F5,41 = 1.173, p = 0.339) (Fig. 7A and B). 3.3. Experiment 3: evaluation of PKA (II) gene expression in intact rats after learning than before learning In this study the gene expression in un-training intact group was considered as the calibrator. Statistical analysis was performed

using one sample t-test. Significant increase in the level of PKA (II) gene expression was observed after learning than before learning (p < 0.01) (Fig. 8). Accordingly, learning has increased PKA (II) gene expression (up-regulation) in the rat hippocampus. The columns represent means ± S.E.M.

3.4. Experiment 4: evaluation of PKA (II) gene expression in DMSO (vehicle) rats after learning than before learning In this study the gene expression in un-training DMSO group was considered as the calibrator (Fig. 9). The columns represent means ± S.E.M.

3.5. Experiment 5: evaluation of PKA (II) gene expression in group receiving 3˛-diol in MWM test (MWM test after injection) In this study, the gene expression in training DMSO group was considered as the calibrator. Significant decrease in the level of PKA (II) gene expression was observed (p < 0.001) (Fig. 10). Thus, 3␣-diol has reduced PKA (II) gene expression (down-regulation) in the rat hippocampus.

154

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

Fig. 5. Effect of intra-CA1 administration of 3␣-diol and DMSO on acquisition of spatial memory in MWM task. The columns represent the mean ± S.E.M. of average escape latency (A), traveled distance (B) and swimming speed (C) across all training days (*p < 0.05 and **p < 0.01 indicate significant difference vs. DMSO group).

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

155

Fig. 6. Comparison of learning between 3␣-diol groups and DMSO group. The figure shows that all groups of animals learned how to find hidden platform. Two-way repeated measure analysis of variance shows significant difference in escape latency (A) and traveled distance (B) within groups, Tukey’s post hoc analysis shows significant difference between the first day and the fourth day of training in all groups (*p < 0.05, **p < 0.01, ***p < 0.001).

4. Discussion The results of this study support the hypothesis of an impairment effect of androgenic steroids on spatial memory of hippocampal male rats. The findings of the present study includes: (1) bilaterally pre-training microinjection of 1, 3 and 6 ␮g/0.5 ␮l 3␣diol into CA1 region of the adult male rats impaired acquisition in 5-day protocol of MWM task. (2) There were no differences in the swimming speed of different doses in treated groups. (3) Intrahippocampal microinjection of 3␣-diol had no effect on escape latency, traveled distance and swimming speed to find the visible platform in non-spatial visual discrimination task. DMSO was used as vehicle in other investigations with similar conditions [1,10,11,27]. This finding is in consistent with some other reports that in behavioral studies, DMSO has no significant effect on spatial memory [1,10,11]. The swimming speed in DMSO and 3␣-diol-treated groups indicates that microinjection of 3␣-diol in CA1 area has no effect on locomotors behavior. Due to the possibility that the deficits in learning ability may be caused by difference in visual and motor performance among rats, the visible platform test should also be used [18]. There were no significant differences between the control and experimental groups on the 5th day of training on visible platform. Thus it can be inferred that the observed changes could not be attributed to

alterations of non-mnemonic factors, such as motivation, motor, or sensory processes induced by the treatments and likely result from impaired hippocampal function by 3␣-diol. Results of molecular studies showed that (1) in intact rats, MWM test significantly increased the expression levels of PKA (II) after learning than before learning (up-regulation). (2) In rats receiving vehicle (DMSO), expression of PKA (II) after learning increased, but this increase was not significant. (3) Gene expression of PKA (II) in the trained group receiving the 3␣-diol compared to vehicle (DMSO), showed a significant decrease (down-regulation). In relation to the first result, it should be noted that PKA, is one of the major proteins in the nervous system and its positive role in learning and synaptic plasticity through various pharmacological and genetic pathways have been studied and researched [3,26,27,30]. For example, an activation/phosphorelation of cAMP response element binding protein in mice trained in a spatial reference memory in Morris water maze been observed [31]. Also, another study reported that the radial maze training resulted in a significant increase in PKA activity in hippocampus of rats [32]. Thus, training through various tests, including Morris water maze, can increase the expression of this gene. To explain the role of the solvent it should be mentioned that although DMSO has no significant effect on behavioral studies and is used as a solvent for water-insoluble drugs, but in one study conducted by Lu et al. [33], it was observed that DMSO, inhibit ionic

156

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

Fig. 7. Comparison of escape latency (A) and traveled distance (B) during same training days within different groups. The figures show the escape latency and traveled distance were significantly increased in 3␣-diol groups at days of training compared with control group (*p < 0.05, **p < 0.01). In visible platform test there were no significant differences in escape latency and traveled distance.

currents and calcium influx through NMDA and AMPA receptors in hippocampal neurons. However, very few studies have been conducted in this area and this can be an interesting topic for further study. Anyway, it seems unlikely that this property of DMSO can be effective on the actual effect of the 3␣-diol on spatial memory. Because in the current study DMSO was used as the calibrator and 3␣-diol effect on PKA gene expression was measured relative to the calibrator. Our finding based on the 3␣-diol role in impairing memory processing, taken with other previous studies showing conflicting effects of androgens on cognition, suggests that cognitive-hormone interactions are quite complex. In several studies, androgens impaired learning and memory [1,10,11,13]. For example

pre-training administration of testosterone increased escape latency and traveled distance as compared to intact or DMSO administered counterparts in MWM test [1]. Bilateral injection of 20 ␮g testosterone or 55 ␮g T-BSA into the CA1 area significantly decreases step-through latency in passive avoidance conditioning test in rats via genomic and non-genomic pathway [10]. Injection of testosterone enanthate into the basolateral nucleus of the amygdale impaired spatial memory of adult male rats in MWM test [34]. But other studies reported that androgens such as testosterone enhanced spatial memory [5,15]. In rodents, gonadectomy decreases cognitive performance of male rats and testosterone replacement to rats restores performance in the inhibitory avoidance, object recognition and conditioned contextual fear task [35].

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

Fig. 8. Evaluation of PKA (II) gene expression in intact rats after learning than before learning. Significant increase in the level of PKA (II) gene expression was observed after learning than before learning (p < 0.01). The columns represent means ± S.E.M. (intact non-training group as a calibrator).

Fig. 9. Evaluation of PKA (II) gene expression in DMSO (vehicle) rats after learning than before learning. In rats receiving vehicle (DMSO), expression of PKA (II) after learning increased, but this increase was not significant. The columns represent means ± S.E.M. (DMSO non-training group as a calibrator).

Fig. 10. Evaluation of PKA (II) gene expression in group receiving 3␣-diol in MWM test. Significant decrease in the level of PKA (II) gene expression was observed (p < 0.001). The columns represent means ± S.E.M. (DMSO training group as a calibrator).

Another study shows that intra-peritoneal administration of testosterone undecanoate (2 mg/kg) during pregnancy period improves the spatial memory by protein synthesis in temporal and frontal lobes of the brain in offspring male and female rats [9]. Also, administration of testosterone or DHT to gonadectomized male rats

157

results in a significant increase in synaptic spine density on CA1 pyramidal cells [36]. Our previous study revealed that testosterone via both genomic and non-genomic pathways impaired long-term memory [10]. Therefore, to further understand the effects of testosterone, we decided to study the effects of its metabolite (3␣-diol) in behavioral and molecular level (gene expression of PKA). This study has provided acceptable preliminary evidence to show impairment effect of 3␣-diol on spatial memory. As we know, androgens exert their effects on memory through genomic and non-genomic pathways. Besides the genomic pathway typically takes at least more than half an hour involves in long-term effects of androgens, many neurosteroids, induce nongenomic effects, manifested within seconds to few minutes and involve in modulation of neurotransmitter receptors and ion channels, ranging from activation of G-protein coupled membrane receptors such as NMDA Receptors or sex hormone-binding globulin receptors, direct modulation of voltage and gated ion-channels and transporters or stimulation of different protein kinases such as CaMKII, PKA and MAPK [10,11,22,37,38]. It has become widely accepted that the formation of long-term memory (LTM) requires an activation of transcription and the denovo synthesis of certain proteins [39]. Biochemical and genetic studies in the past have indicated the involvement of various kinases in the signaling network responsible for certain changes in the synaptic efficiency, learning and memory in the mammalian brain [3]. Amongst these kinases, PKA can be noted [26,27,40,41]. The cAMP-dependent protein kinase (PKA) is known to play a critical role in both transcription-independent short-term memory and transcriptiondependent long-term memory [25,26,30,42,43]. PKA is a ubiquitous serine/threonine protein kinase present in a variety of tissues. PKA isoforms are classified into type I and II based on the regulatory subunits, with type II, especially II␤, thought to be the dominant isoform in many neurons [44,45]. PKA type II beta is the predominant PKA isoform and principal mediator of cAMP action in the central nervous system [46]. Studies have shown that interaction of PKA (II) with main neurotransmitter and receptors is effective in memory process. It has been demonstrated that in the hippocampus, the schaffer collateral axons from CA3 field use glutamate as their transmitters. We know, glutamate, via two important receptors in postsynaptic area known as AMPA and NMDA receptors plays a key role in long-term memory formation [9]. Besides, PKA can phosphorylate AMPA and NMDA glutamate receptors to modulate synaptic plasticity [24]. In excitatory synapses, AMPA and NMDA glutamate receptors are linked to signaling proteins that may play important roles in synaptic plasticity underlying learning and memory. Phosphorylation of AMPAR–GluR1 subunits by the PKA helps stabilize AMPARs recruited during LTP. In contrast, induction of long-term depression (LTD) leads to dephosphorylation of PKA-phosphorylated GluR1 receptors [47]. If one considers LTP as a synaptic mechanism for maintaining a coherent spatial map over time, defects in LTP should interfere with spatial memory [27,48]. Furthermore, it has been suggested that an increase in cAMP/PKA concentration, activates mitogen-activated protein kinase (MAPK/ERK) that in turn activates several signaling cascades that end with distinct neurotransmitter release, gene transcription and protein synthesis, leading to memory formation [49,50]. According to the above and since LTP in area CA1 as an in vitro model for long-term memory, plays a critical role in memory storage [42], so we can understand the importance of this PKA in learning and memory system. Conversely, a decrease in the expression of this kinase impairs memory formation. For example, post-training intra-hippocampal infusion of a PKA (II) inhibitor impairs spatial memory retention in rats [27]. Also, following the reduction of hippocampal PKA activity with using transgenic approach in mice, L-LTP and spatial memory was

158

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159

significantly decreased in area CA1 [42]. Therefore, in the current study, improved spatial memory in intact and DMSO trained rats with up-regulation of PKA (II) gene expression and impaired spatial memory with down-regulation of this gene in receiving 3␣-diol trained rats demonstrate that PKA plays a critical role in the hippocampus in initiating the molecular events leading to the changes in neuronal activity into long-term memory. This could explain the effect of 3␣-diol on CA1 hippocampal spatial memory in this study. Another explanation in understanding of 3␣-diol effects is that 3␣-diol can modulate the action of GABAA receptors in the brain [51–54]. All hippocampal sub-regions are rich in GABAA receptors and it has been proved that allopregnanolone as a neurosteroid can inhibit neural activity in CA1 area of the hippocampus [55]. Studies show that acute treatment with neurosteroids that have GABAmodulatory effects impairs learning and memory [56]. In contrast, steroids that act as GABAA receptor antagonists enhance learning and memory [3,57]. 3␣-diol acts like the analogous metabolites of progesterone and corticosterone such as allopregnanolone, to enhance GABA benzodiazepine regulated chloride channel function [51,54]. About the possible relationship between PKA and GABA receptors can be said that a number of biochemical approaches demonstrated that some GABARs can be phosphorylated and modulated by PKA. In general, phosphorylation of Ser/Thr residues on GABAR subunits by PKA is believed to decrease GABAR function. Studies have shown that activation of intracellular PKA alters synaptic GABAR function and decreased inhibitory Postsynaptic potential (mIPSC) amplitudes in CA1 pyramidal cells [58]. Thus it can be concluded that the inhibition of PKA, with 3␣-diol, enhances the activity of GABA release and increases its inhibitory effect on the postsynaptic terminal. Furthermore, some studies suggest that while T and DHT bind with high affinity to androgen receptors, 3␣-diol shows a high affinity for estrogen receptors (ERs) especially ER␤ [11] and capable of eliciting estrogen receptor-dependent responses [51]. Previous studies have shown that intra-hippocampal injection of estradiol impaired spatial learning in rats in Morris water maze test. This effect may be the result of activation of ER␤. There is evidence that ER␤ inhibits the transcription process [59]. Therefore, it is likely that the 3␣-diol by binding to ER␤ and down-regulation of PKA (II) gene expression, impaired cognitive performance. Also, steroid hormones modulate the memory processes perhaps by their relationship with other neurotransmitter systems, such as acetylcholine, dopamine, noradrenaline and glutamate, and by their relationship with the cerebral regions that participate in these phenomena [11]. Based on the evidences, testosterone and its metabolites, 3␣-diol, can reduce acetylcholine release in the hippocampus via positive modulating hippocampal GABAergic interneurons that is proven to induce memory impairment [11,60]. Many studies have also shown that NMDA receptors are critical for synaptic plasticity and long-term memory [1,6,61]. Testosterone by acting as non-selective sigma (␴) antagonist may produce a tonic damping of the function of sigma receptors and consequently a decrease in NMDA receptor function [11]. As mentioned above, the function of these receptors can be regulated by PKA. Therefore, these facts may be a good and reliable proof for the effects of 3␣-diol (as one metabolites of testosterone) on spatial memory.

5. Conclusion The results of this study showed that 3␣-diol as a metabolites of testosterone, impaired spatial memory and decrease PKA (II) mRNA expression in hippocampus of adult male rats. Taken together, these data suggest that PKA (II) may be a molecular switch for effects of 3␣-diol on the hippocampus tissue. It should be noted that we are still in the early stages of the investigation.

We study in this area will continue and in future studies we will try to determine the effects of 3␣-diol on other protein kinase gene expression such as CaMKII, MAPK/ERK and PKC in the brain, as well as other key enzymes, its target Receptors and ion channels, for more detailed understanding the actions of this androgen on spatial learning and memory. Acknowledgements We wish to thank department of physiology and pharmacology of Pasteur Institute and Tonekabon Branch of Islamic Azad University, IRAN for supporting this research by a grant. References [1] Emamian SH, Naghdi N, Sepehri H, Jahanshahi M, Sadeghi Y, Choopani S. Learning impairment caused by intra-CA1 microinjection of testosterone increases the number of astrocytes. Behav Brain Res 2010;208:30–7. [2] Hojo Y, Murakami G, Mukai H, Higo SH, Hatanaka Y, Ogiue-Ikeda M, et al. Estrogen synthesis in the brain-role in synaptic plasticity and memory. Mol Cell Endocrinol 2008;290:31–43. [3] Birzniece V, Bäckström T, Johansson IM, Lindblad C, Lundgren P, Löfgren M, et al. Neuroactive steroid effects on cognitive functions with a focus on the serotonin and GABA systems. Brain Res Rev 2006;51:212–39. [4] Coates JM, Gurnell M, Sarnyai Z. From molecule to market: steroid hormones and financial risk-taking. Phil Trans R Soc B 2010;365:331–43. [5] Frye CA, Edinger KL, Seliga AM, Wawrzycki JM. 5␣-Reduced androgens may have actions in the hippocampus to enhance cognitive performance of male rats. Psychoneuroendocrinology 2004;29:1019–27. [6] Maclusky NJ, Hajszan T, Prange-kiel J, Leranth C. Androgen modulation of hippocampal synaptic plasticity. Neuroscience 2006;138:957–65. [7] Moffat SD, Zonderman AB, Metter EJ, Kawas C, Blackman MR, Harman SM, et al. Free testosterone and risk for Alzheimer disease in older men. Neurology 2004;62:188–93. [8] Magnusson K, Hånell A, Bazov I, Clausen F, Zhou Q, Nyberg F. Nandrolone decanoate administration elevates hippocampal prodynorphin mRNA expression and impairs Morris water maze performance in male rats. Neurosci Lett 2009;467:189–93. [9] Gurzu C, Artenie V, Hritcu L, Ciobica A. Prenatal testosterone improves the spatial learning and memory by protein synthesis in different lobes of the brain in the male and female rat. Cent Eur J Biol 2008;3:39–47. [10] Naghdi N, Asadollahi A. Genomic and nongenomic effects of intrahippocampal microinjection of testosterone on long-term memory in male adult rats. Behav Brain Res 2004;153:1–6. [11] Harooni HE, Naghdi N, Sepehri H, Haeri-Rohani A. Intra hippocampal injection of testosterone impaired acquisition, consolidation and retrieval of inhibitory avoidance learning and memory in adult male rats. Behav Brain Res 2008;188:71–7. [12] Brosens JJ, Tullet J, Varshochi R, Lam EW. Steroid receptor action. Best Pract Res Clin Obstet Gynaecol 2004;18:265–83. [13] Hampson E. Spatial cognition in humans: possible modulation by androgens and esterogens. J Psychiatry Neurosci 1995;20:397–404. [14] Ogiue-Ikeda M, Tanabe N, Mukai H, Hojo Y, Murakami G, Tsurugizawa T, et al. Rapid modulation of synaptic plasticity by estrogens as well as endocrine disrupters in hippocampal neuron. Brain Res Rev 2008;57:363–75. [15] Osborne DM, Edinger K, Frye CA. Chronic administration of androgens with actions at estrogen receptor beta have anti-anxiety and cognitive-enhancing effects in male rats. Age 2009;31:191–8. [16] Lund BC, Bever-Stille KA, Perry PJ. Testosterone and andropause: the feasibility of testosterone replacement therapy in older men. Pharmacotherapy 1999;19:951–6. [17] Vazquez-Pereyara F, Rivas-Arancibia S, Loaeza-Del Castillo A, Schneider Rivas S. Modulation of short term and long term memory by steroid sexual hormones. Life Sci 1995;56:255–60. [18] Frye CA, Edinger KL, Lephart ED, Walf AA. 3␣-Androstanediol, but not testosterone, attenuates age-related decrements in cognitive, anxiety, and depressive behavior of male rats. Aging Neurosci 2010;2:1–21. [19] Frye CA, Lacey EH. Posttraining androgens enhancement of cognitive performance is temporally distinct from androgens increases in affective behavior. Cogn Affect Behav Neurosci 2001;1:172–82. [20] Frye CA, Park D, Tanaka M, Rosellini R, Svare B. The testosterone metabolite and neurosteroid 3␣-androstanediol may mediate the effects of testosterone on conditioned place preference. Psychoneuroendocrinology 2001;26:731–50. [21] Edinger KL, Lee B, Frye CA. Mnemonic effects of testosterone and its 5␣-reduced metabolites in the conditioned fear and inhibitory avoidance tasks. Pharmacol Biochem Behav 2003;78:559–68. [22] Li J, Al-Azzawi F. Mechanism of androgen receptor action. Maturitas 2009;63:142–8. [23] Durdiakova J, Ostatnikova D, Celec P. Testosterone and its metabolites – modulators of brain functions. Acta Neurobiol Exp 2011;71:434–54. [24] Zhong H, Sia GM, Sato TR, Gray NW, Mao T, Khuchua Z, et al. Subcellular dynamics of type II PKA in neurons. Neuron 2009;62:363–74.

S.A. Narenji et al. / Behavioural Brain Research 280 (2015) 149–159 [25] Kandel ER. The molecular biology of memory: cAMP, PKA, CRE, CREB-1, CREB-2 and CPEB. Mol Brain 2012;5:1–12. [26] Michel M, Kemenes I, Müller U, Kemenes G. Different phases of long-term memory requires distinct temporal patterns of PKA activity after single-trial classical conditioning. Learn Mem 2008;15:694–702. [27] Sharifzadeh M, Sharifzadeh K, Naghdi N, Ghahremani MH, Roghani A. Posttraining intrahippocampal infusion of a protein kinase AII inhibitor impairs spatial memory retention in rats. J Neurosci Res 2005;79:392–400. [28] Paxinos G, Watson C. The rat brain in stereotaxic coordinates. 2nd ed. New York: Academic Press; 1986. [29] Livak KJ, Schmiigen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2−Ct method. Methods 2001;25:402–8. [30] Guerra GP, Mello CF, Bochi GV, Pazini AM, Fachinetto R, Dutra RC, et al. Hippocampal PKA/CREB pathway is involved in the improvement of memory induced by spermidine in rats. Neurobiol Learn Mem 2011;96:324–32. [31] Porte Y, Buhot MC, Mons NE. Spatial memory in the Morris water maze and activation of cyclic AMP response element-binding (CREB) protein within the mouse hippocampus. Learn Mem 2008;15:885–94. [32] Mizuno M, Yamada K, Maekawa N, Saito K, Seishima M, Nabeshima T. CREB phosphorylation as a molecular marker of memory processing in the hippocampus for spatial learning. Behav Brain Res 2002;133:135–41. [33] Lu C, Mattson MP. Dimethyl sulfoxide suppresses NMDA- and AMPA-induced ion currents and calcium influx and protects against excitotoxic death in hippocampal neurons. Exp Neurol 2001;170:180–5. [34] Naghdi N, Oryan S, Etemadi R. The study of spatial memory in adult male rats with injection of testosterone enanthate and flutamide into the basolateral nucleus of the amygdale in Morris water maze. Brain Res 2003;972:1–8. [35] Edinger KL, Frye CA. Androgens effects to enhance learning may be mediated in part through actions at estrogen receptor-␤ in the hippocampus. Neurobiol Learn Mem 2007;87:78–85. [36] Leranth C, petnehazy O, MacLusky NJ. Gonadal hormones affect spine synaptic density in the CA1 hippocampal subfield of male rats. J Neurosci 2003;23:1588–92. [37] Debonnel G, Bergeron R, Montigny CD. Potentiation by dehydroepiandrosterone of the neonatal response to N-methyl-d-aspartate in CA3 region of the rat dorsal hippocampus: an effect mediated via sigma receptors. J Endocrinol 1996;150:33–42. [38] Michels G, Hoppe UC. Rapid actions of androgens. Front Neuroendocrinol 2008;29:182–98. [39] Balschun D, Wolfer DP, Gass P, Mantamadiotis T, Welzl H, Schütz G, et al. Does cAMP response element-binding protein have a pivotal role in hippocampal synaptic plasticity and hippocampus-dependent memory? J Neurosci 2003;23:6304–14. [40] Najafi S, Payandemehr B, Tabrizian K, Shariatpanahi M, Nassireslami E, Azami K, et al. The role of nitric oxide in the PKA inhibitor induced spatial memory deficits in rat: involvement of choline acetyltransferase. Eur J Pharmacol 2013;714:1–3. [41] Dubnau J, Chiang AS, Tully T. Neural substrates of memory: from synapse to system. J Neurobiol 2003;54:238–53. [42] Abel T, Nguyen PV, Barad M, Deuel TA, Kandel ER, Bourtchouladze R. Genetic demonstration of a role for PKA in the late phase of LTP and in hippocampusbased long-term memory. Cell 1997;88:615–26. [43] Isiegas C, Park A, Kandel ER, Abel T, Lattal KM. Transgenic inhibition of neuronal protein kinase A activity facilitates fear extinction. J Neurosci 2006;26:12700–7.

159

[44] Brandon EP, Logue SF, Adams MR, Qi M, Sullivan SP, Matsumoto AM, et al. Defective motor behavior and neural gene expression in RIIbeta-protein kinase A mutant mice. J Neurosci 1998;18:3639–49. [45] Ventra C, Porcellini A, Feliciello A, Gallo A, Paolillo M, Mele E, et al. The differential response of protein kinase A to cyclic AMP in discrete brain areas correlates with the abundance of regulatory subunit II. J Neurochem 1996;66: 1752–61. [46] Glantz SB, Amat JA, Rubin CS. cAMP signaling in neurons: patterns of neuronal expression and intracellular localization for a novel protein, AKAP150 that anchors the regulatory subunit of cAMP-dependent protein kinase. Mol Biol Cell 1992;3:1215–28. [47] DellAcqua ML, Gorski JA, Horne EA, Gibson ES, Gomez LL. Regulation of neuronal PKA signaling through AKAP targeting dynamics. Eur J Cell Biol 2006;85:627–33. [48] Baulieu EE, Robel P. Neurosteroids: a new brain function? J Steroid Biochem Mol Biol 1990;37:395–403. [49] Lee JL, Everitt BJ, Thomas KL. Independent cellular processes for hippocampal memory consolidation and reconsolidation. Science 2004;304:839–43. [50] Lynch MA. Long-term potentiation and memory. Physiol Rev 2004;84: 87–136. [51] Genazzani AR, Pluchino N, Freschi L, Ninni F, Luisi M. Androgens and the brain. Maturitas 2007;57:27–30. [52] Pak TR, Chung WC, Lund TD, Hinds LR, Clay CM, Handa RJ. The androgen metabolite, 5 alpha-androstane-3beta, 17beta-diol, is a potent modulator of estrogen receptor-beta1-mediated gene transcription in neuronal cells. Endocrinology 2005;146:147–55. [53] Pettersson H, Lundqvist J, Oliw E, Norlin M. CYP7B1-mediated metabolism of 5-androstane-3,17-diol (3-adiol): a novel pathway for potential regulation of the cellular levels of androgens and neurosteroids. Biochim Biophys Acta 2009;1791:1206–15. [54] Frye CA, Van Keuren KR, Erskine MS. Behavioral effects of 3␣ androstanediol. I. Modulation of sexual receptivity and promotion of GABA-stimulated chloride flux. Behav Brain Res 1996;79:109–18. [55] Landgren S, Wang MD, Backstrom T, Johansson S. Interaction between 3 alphahydroxyl-5 alpha-pregnan-20-one and carbachol in the control of neuronal excitability in hippocampal slices of female rats in defined phases of the oestrus. Acta Physiol Scand 1998;162:77–88. [56] Mathews DB, Morrow AL, Tokunaga S, McDaniel JR. Acute ethanol administration and acute allopregnanolone administration impair spatial memory in the Morris water task. Alcohol Clin Exp Res 2002;26:1747–51. [57] Vallee M, Mayo W, Koob GF, Le Moal M. Neurosteroids in learning and memory processes. Int Rev Neurobiol 2001;46:273–320. [58] Poisbeau P, Cheney MC, Browning MD, Mody I. Modulation of synaptic GABAA receptor function by PKA and PKC in adult hippocampal neurons. J Neurosci 1999;19:674–83. [59] Moradpour F, Naghdi N, Fathollahi Y. Effect of intra-CA1 injection of estrogen on spatial memory and learning in rats. Physiol Pharmacol 2008;12: 159–69. [60] Moor E, DeBoer P, Westerink BH. GABA receptors and benzodiazepine binding sites modulate hippocampal acetylcholine release in vivo. Eur J Pharmacol 1998;359:119–26. [61] Santos SD, Carvalho AL, Calderia MV, Duarte CB. Regulation of AMPA receptors and synaptic plasticity. Neuroscience 2009;158:105–25.