ARTICLE IN PRESS

JID: PHYMED

[m5G;February 28, 2015;16:12]

Phytomedicine xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Phytomedicine journal homepage: www.elsevier.com/locate/phymed

[6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis Thing-Fong Tzeng, Shorong-Shii Liou, Chia Ju Chang, I-Min Liu∗

Q1

Department of Pharmacy and Graduate Institute of Pharmaceutical Technology, Tajen University, Yanpu Township, Pingtung County, Taiwan, ROC

a r t i c l e

i n f o

Article history: Received 8 July 2014 Revised 12 December 2014 Accepted 9 January 2015 Available online xxx Keywords: [6]-Gingerol Inflammation Lipogenesis Nuclear transcription factor κ B Steatohepatitis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

a b s t r a c t The aim of the study was to investigate the effects of [6]-gingerol ((S)-5-hydroxy-1-(4-hydroxy-3methoxyphenyl)-3-decanone) in experimental models of non-alcoholic steatohepatitis. HepG2 cells were exposed to 500 μmol/l oleic acid (OA) for 24 h and preincubated for an additional 24 h with [6]-gingerol (25, 50 or 100 μmol/l). [6]-Gingerol (100 μmol/l) inhibited OA-induced triglyceride and inflammatory marker accumulation in HepG2 cells. After being fed a high-fat diet (HFD) for 2 weeks, male golden hamsters were dosed orally with [6]-gingerol (25, 50 or 100 mg/kg/day) once daily for 8 weeks while maintained on HFD. [6]Gingerol (100 mg/kg/day) alleviated liver steatosis, inflammation, and reversed plasma markers of metabolic syndrome in HFD-fed hamsters. The expression of inflammatory cytokine genes and nuclear transcription factor-κ B (NF-κ B) were increased in the HFD group; these effects were attenuated by [6]-gingerol. The hepatic mRNA expression of lipogenic genes such as liver X receptor-α , sterol regulating element binding protein-1c and its target genes including acetyl-CoA carboxylase, fatty acid synthase, stearoyl-CoA desaturase 1, and acyl-CoA:diacylglycerol acyltransferase 2 in HFD-fed hamsters was also blocked by [6]-gingerol. [6]-Gingerol may attenuate HFD-induced steatohepatitis by downregulating NF-κ B-mediated inflammatory responses and reducing hepatic lipogenic gene expression. © 2015 Published by Elsevier GmbH.

Abbreviations ACC CD Chol DGAT-2 DMSO ELISA FAS FFA GF HDL-C HFD HOMA-IR IACUC IL Iκ B LDL-C LXR-α MCP-1

∗

acetyl-CoA carboxylase control diet cholesterol acyl-CoA:diacylglycerol acyltransferase 2 dimethyl sulfoxide enzyme-linked immunosorbent assay fatty acid synthase free fatty acid [6]-gingerol high density lipoprotein cholesterol high-fat diet homeostasis model assessment of insulin resistance Institutional Animal Care and Use Committee interleukin α inhibitory kappa B low density lipoprotein cholesterol liver X receptor-α monocyte chemoattractant protein-1

Corresponding author. Tel.: +886 8 7624002x2713; fax: +886 8 7625308. E-mail address: [email protected] (I.-M. Liu).

MTS

3-(4,5-dimethylthiazol-2-yl)-5-(3 carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium NAFLD non-alcoholic fatty liver disease NASH nonalcoholic steatohepatitis NF-κ B nuclear transcription factor-κ B OA oleic acid OD optical density RT-PCR quantitative real-time PCR SCD1 stearoyl-CoA desaturase 1 SEM standard error mean SREBP-1c sterol regulating element binding protein-1c TBST Tris-buffered saline Tween 20 TC total cholesterol TG triglyceride TNF-α tumor necrosis factor-α

20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

Introduction

35

Non-alcoholic fatty liver disease (NAFLD) refers to a wide spectrum of liver diseases ranging from simple fatty liver (steatosis) to nonalcoholic steatohepatitis (NASH) and cirrhosis. NASH pathology is characterized by microvesicular or macrovesicular steatosis, inflammation, hepatocyte degeneration, and sometimes fibrosis (Schuppan and Schattenberg 2013). A variety of liver cells including hepatocytes, hepatic macrophages, and hepatic stellate cells are involved

36

http://dx.doi.org/10.1016/j.phymed.2015.01.015 0944-7113/© 2015 Published by Elsevier GmbH.

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

37 38 39 40 41 42

JID: PHYMED 2

ARTICLE IN PRESS T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

101

in the pathogenesis of NASH (Xu et al. 2010). In particular, inflammatory processes secondary to insulin resistance are regarded as a characteristic finding of NASH (McCullough 2006). Among the inflammatory mediators, chemokines play pivotal roles in the recruitment of various cells, including immune cells, to the sites of inflammation through interactions with chemokine receptors (Braunersreuther et al. 2012). Inflammatory mediators such as tumor necrosis factor-α (TNF-α ) and interleukin (IL)-1β further stimulate hepatocytes and hepatic stellate cells to induce hepatocyte steatosis and fibrosis, respectively. The interactions of cytokines and growth factors with their receptors initiate different signaling pathways, leading to the activation of multiple transcriptional factors, such as nuclear transcription factor-κ B (NF-κ B), which also has a role in liver fibrogenesis (Oakley et al. 2005). Currently, there is no approved therapy for NAFLD, and research efforts to identify effective treatment strategies have been mostly unsuccessful. Nevertheless, therapies targeting the occurrence of inflammation are particularly appealing for this condition. Zingiber zerumbet (L) Smith (Zingiberaceae family), commonly known as the pinecone or shampoo ginger, has gained much interest from scientists all over the world because of its high medicinal values (Yob et al. 2011). It has been an important plant for the traditional Chinese and Indian pharmacopeias and is widely used to relieve muscular aches, rheumatism, pains, coughs, sinusitis, sore throats, diarrhea, cramps, indigestion, loss of appetite, motion sickness, fever, flu, chills and other infectious diseases (Yob et al. 2011). The ethanol extract of Z. zerumbet recently has been found to attenuate fat accumulation in liver, improving insulin resistance, inhibiting inflammation, and repressing hepatic lipogenesis (Chang et al. 2014). [6]-Gingerol ((S)5-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-3-decanone) is an aromatic polyphenol and one of the pungent constituents of Z. zerumbet (Chang et al. 2012). It has an inhibitory effect on xanthine oxidase responsible for generation of reactive oxygen species like superoxide anion (Chang et al. 1994). Mounting evidence suggests that [6]gingerol has varied pharmacological activities including antioxidant, anti-inflammatory, anticancer, analgesic and antiplatelet effects (Guh et al. 1995; Young et al. 2005; Kim et al. 2007). [6]-Gingerol has been shown to block the NF-κ B pathway through suppressing the cytokine-induced oxidative stress (Li et al. 2013). These results may open novel treatment options whereby [6]-gingerol could potentially protect against hepatic inflammation which underlies the pathogenesis of chronic diseases such as insulin resistance, type 2 diabetes mellitus, atherosclerosis, and NAFLD (Hotamisligil 2006). There is strong evidence that the prevalence of NAFLD worldwide has increased substantially over the past decades, in parallel with the global trends in over-nutrition. The high-fat diet (HFD)-induced animal model of NAFLD has been widely used to study disease pathogenesis and to evaluate new treatments (Bhathena et al. 2011). The lipoprotein profiles of hamsters are more similar to humans than to those of mice or rats (de Silva et al. 2004). Therefore, this study was undertaken to determine if [6]-gingerol can prevent the development of steatosis and limit the expression of inflammatory genes in hamsters fed a HFD. Hepatic steatosis in human beings is associated with accumulation of excess oleic acid (OA), a monounsaturated omega-9 fatty acid and the end product of de novo fatty acid synthesis (Araya et al. 2004). Treatment of HepG2 cells, a human hepatoblastoma cell line, with OA induces morphological similarities to steatotic hepatocytes (Janorkar et al. 2009). These effects of [6]-gingerol on NAFLD/NASH were further characterized by OA induced hepatic steatosis in HepG2 cells.

102

Materials and methods

103

Cell cultures

104

Human hepatoma HepG2 cells were obtained from the Bioresource Collection and Research Center (BCRC 60025) of the Food

43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 Q2 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100

105

[m5G;February 28, 2015;16:12]

Industry Research and Development Institute (Hsinchu, Taiwan). The cells were cultured in minimum essential medium containing fetal bovine serum (10% by volume), l -glutamate (2 mmol/l), sodium pyruvate (1 mmol/l), penicillin (100 U/ml), streptomycin (100 μg/ml), and sodium pyruvate (1 mmol/l) at 37 °C in a humidified atmosphere containing 5% CO2 . The cells were grown to 70% confluence and incubated in serumfree medium (starvation) for 24 h before treatments. After 24 h of serum-starvation, cells were treated for 24 h with 25, 50, or 100 μmol/l [6]-gingerol (ࣙ98%; Sigma-Aldrich Co.; Cat. No. G1046) or Bezalip (100 μmol/l; bezafibrate; Roche Molecular Biochemicals, Almere, The Netherlands) before they were exposed to 500 μmol/l OA (Sigma-Aldrich Co., St. Louis, MO; Cat. No. P0500) for another 24 h. [6]-gingerol, Bezalip or OA were dissolved in 0.1% dimethyl sulfoxide (DMSO; Sigma-Aldrich Co.), medium or 0.1% ethanol, respectively, and added to the culture media to the final concentration specified. DMSO at this concentration does not modify the cell viability (data not shown). Cells treated with 0.1% DMSO served as the untreated control. The concentration regime was selected based on the previous report demonstrating that [6]-gingerol protects hepatocellular carcinoma HuH7 cells against IL-1β -induced inflammatory insults (Li et al. 2013). Cell viability was assayed using 3-(4,5-dimethylthiazol-2yl)-5-(3 carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS; Promega, Madison, WI, USA). Subconfluent monolayers of HepG2 cells were stained with Oil-Red-O (Sigma-Aldrich Co.) to determine fat accumulation.

106

Cell viability assay

132

OA-treated HepG2 were seeded at a density of 1 × 105 cells/ml in 96-well plates. The plates were then incubated for 24 h at 37 °F under 5% CO2 . MTS solution (5 mg/ml) was added to each well, and the cells were cultured for another 2 h, after which the optical density was read at 490 nm. The percentage of cell viability was calculated using the following equation: % viability = 100 × (mean absorbance of treated cells/mean absorbance of control).

133

Oil Red O stain

140

OA-induced lipid accumulation in HepG2 cells was evaluated by Oil Red O staining. Briefly, the cells were rinsed with cold phosphate buffered saline and fixed for 30 min in 10% paraformaldehyde. After washing the cells with 60% isopropanol, they were stained for at least 1 h in a freshly diluted Oil Red O solution (6 parts Oil Red O stock solution and 4 parts H2 O; Oil Red O stock solution is 0.5% Oil Red O in isopropanol). The stain was removed, and the cells were washed with 60% isopropanol, after which each group was photographed. The stained lipid droplets were then extracted with isopropanol to be quantified by measuring absorbance at 490 nm.

141

Measurement of cholesterol and triglycerides in HepG2 cells

151

Cells were lysed in 1% Triton X-100 in PBS. The cellular cholesterol (Chol) and triglycerides (TG) levels were measured using enzymatic colorimetric assay kits. EnzyChromTM AF cholesterol assay kit and EnzyChromTM triglyceride assay kit were purchased from BioAssay Systems (CA, USA). Cellular protein concentration was determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories, Japan), using bovine serum albumin as a standard. Cellular Chol and TG were normalized to cellular protein content.

152

Measurement of cytokines in HepG2 cells

160

Cell cultures were centrifuged at 10 ,000 × g for 10 min at 4 °C, and the supernatants were stored at −20 °C before analysis. Secretory levels of inflammatory cytokines, including monocyte chemoattractant

161

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131

134 135 136 137 138 139

142 143 144 145 146 147 148 149 150

153 154 155 156 157 158 159

162 163

JID: PHYMED

ARTICLE IN PRESS

[m5G;February 28, 2015;16:12]

T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

171

protein-1 (MCP-1) (Cat. No. ab100721), TNF-α (Cat. No. ab46070), IL1β (Cat. No. ab100768), and IL-6 (Cat. No. ab100772), in cell-free culture supernatants were determined by commercial enzyme-linked immunosorbent assay (ELISA) (Abcam Inc., Cambridge, MA, USA). The color generated was determined by measuring the optical density (OD) at 450 nm on a spectrophotometric microtiter plate reader (Molecular Devices Corp., Sunnyvale, CA, USA). A standard curve was run on each assay plate using recombinant proteins in serial dilutions.

172

Animal and experimental protocols

173

216

Male Golden Syrian hamsters, 8 weeks old and weighing 90 ± 10 g, were obtained from the National Laboratory Animal Center (Taipei, Taiwan). They were maintained in a temperature-controlled room (25 ± 1 °C) on a 12 h:12 h light-dark cycle (lights on at 06:00 h) in our animal center. Food and water were provided ad libitum. Normal diet (#D12450B, Research Diets, New Brunswick, NJ) containing 811 kcal protein, 2840 kcal carbohydrate, and 405 kcal fat from lard was used as the maintenance and control diet (CD). A purified ingredient HFD containing 811 kcal protein, 1420 kcal carbohydrate, and 1825 kcal fat primarily from lard (#D12451, Research Diets) was used to induce a rapid increase in body weight and obesity (Van Heek et al. 1997). All animal procedures were performed according to the Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health (United States), as well as the guidelines of the Taiwanese Animal Welfare Act. These studies were conducted with the approval of the Institutional Animal Care and Use Committee (IACUC) at Tajen University (approval number, IACUC 102-16; approval date, December 24, 2013). After being fed a HFD for 2 weeks, hamsters received treatment along with consuming the HFD during 8 week treatment period. [6]Gingerol suspended in distilled water was administered to HFD-fed hamsters once daily via oral gavage at doses of 25, 50, or 100 mg/kg in a volume of 2 ml/kg distilled water. The dosage regimen was selected based on a previous report demonstrating that [6]-gingerol was potentially effective in decreasing hyperlipidemia in diabetic db/db mice (Singh et al. 2009). Another group of HFD-fed hamsters was treated orally with Bezalip (10 mg/kg/day) dissolved in distilled water, a dose based on a study indicating that long-term treatment ameliorates hyperlipidemia and fatty liver in a rat model of NAFLD (SchmilovitzWeiss et al. 2013). A third group of HFD-fed and CD-fed hamsters were treated similarly but with the same volume of vehicle (distilled water) as was used to prepare the test compounds solution during the same treatment period. Following the 8-week treatment (total diet-fed period was 10 weeks), animals were weighed, fasted for 12 h, and anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg/kg) and xylazine (20 mg/kg). Blood samples from the inferior vena cava were collected into heparinized syringe (15 U/ml blood). The left lobe of liver was removed, rinsed with physiological saline. One third of the left lobe of liver was used to hepatic lipids and cytokines determination, another part of the left liver was stored immediately at −80 °C in liquid nitrogen until assayed. Right lobe of liver was fixed in 10% neutralized formalin for histology. The liver index was calculated as liver weight divided by body weight.

217

Determination of metabolic parameters

218

Blood samples were centrifuged at 2000 × g for 10 min at 4 °C. The plasma was removed and placed into aliquots for analyses. Plasma glucose concentration was determined using kits from Cayman Chemical Company (Ann Arbor, MI; Cat. No. 10009582). Plasma insulin concentration was quantified using ELISA kits (LINCO Research, Inc., St. Charles, MO; Cat. #EZRMI-13K). Whole-body insulin sensitivity was estimated using the homeostasis model assessment of insulin resistance (HOMA-IR) according to the formula: insulin

164 165 166 167 168 169 170

174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215

219 220 221 222 223 224 225

3

sensitivity = [fasting plasma glucose (mmol) × fasting plasma insulin (mU/ml)]/22.5 (Matthews et al. 1985). Hamster leptin (Cat. # MBS043292) and adiponectin (Cat. # MBS023583) ELISA kits were purchased from MyBioSource, Inc. (San Diego, CA, USA). Diagnostic kits for determining plasma levels of total cholesterol (TC; Cat. # 10007640) and TG (Cat. # 10010303) were purchased from Cayman Chemical Company. Plasma high density lipoprotein cholesterol (HDL-C) was determined with a kit from Bio-Quant Diagnostics (Cat. # BQ 019CR; San Diego, CA, USA), and plasma low density lipoprotein cholesterol (LDL-C) was determined using an ELISA kit from Antibodies-Online Inc. (Atlanta, GA, USA.; Cat. # ABIN416222). Plasma free fatty acid (FFA) levels were quantified using a kit obtained from Abcam plc (Cambridge, MA, USA; Cat. # ab65341). All experimental assays were carried out according to the manufacturers’ instruction; all samples were analyzed in triplicate.

226

Measurement of hepatic lipids and cytokines

241

Hepatic lipid content was determined from fresh liver samples. Liver (1.25 g) was homogenized with chloroform/methanol (1:2, 3.75 ml) and mixed well with chloroform (1.25 ml) and distilled water (1.25 ml). After centrifuging for 10 min at 1500 × g, the lower clear organic phase was transferred into a new glass tube and then lyophilized. The lyophilized powder was dissolved in chloroform/methanol (1:2) and stored at −20 °C for less than 3 days (Folch et al. 1957). Hepatic TC and TG levels in the lipid extracts were analyzed using the same diagnostic kits used for plasma analysis. For hepatic cytokines measurement, liver samples were homogenized in 10 mmol/l Tris–HCl buffered solution (pH 7.4) containing 2 mol/l NaCl, 1 mmol/l EDTA, 0.01% Tween 80, 1 mmol/l PMSF, and centrifuged at 9000 × g for 30 min at 4 °C. The resultant supernatant was used for cytokine determination using the same diagnostic kits used to measure cytokines in HepG2 cells.

242

Histological analysis of the liver

257

For histopathological analysis, liver specimens fixed in 10% neutral-buffered formalin were embedded in paraffin, sliced at 5μm thickness, and stained with hematoxylin and eosin to evaluate the degree of hepatic steatosis. Liver tissues were scored for hepatic steatosis: 0 (no steatosis), 1 (1–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%) of hepatocytes affected. The tissues were also scored for inflammation: 0 (no inflammation), 1 (mild lobular/portal inflammation), 2 (moderate lobular/portal inflammation), and 3 (severe lobular/portal inflammation) (Kleiner et al. 2005). All slides were scanned at a total magnification of 200× using Image Pro Plus 7.0 software (Media Cybernetics) under a light microscope (Olympus BX51 microscope; Tokyo, Japan).

258

NF-κ B activity measurement

227 228 229 230 231 232 233 234 235 236 237 238 239 240

243 244 245 246 247 248 249 250 251 252 253 254 255 256

259 260 261 262 263 264 265 266 267 268 269 270

Nuclear extracts of liver from the control and HFD animals were prepared using a nuclear extract kit (Active Motif, CA, USA; Cat. No. 40010). NF-κ B activity was measured from nuclear extracts (20 μg) using the TransAM NF-κ B p65 transcription factor assay kit (Active Motif; Cat. No. 40096) according to the manufacturer’s instruction.

271

Western blotting

276

Liver tissues were homogenized in 1 ml ice-cold hypotonic buffer A (10 mmol/l HEPES, 10 mmol/l KCl, 2 mmol/l MgCl2 , 1 mmol/l DTT, 0.1 mmol/l EDTA, 0.1 mmol/l phenylmethylsulfonylfluoride) at pH 7.8. The cells were then lysed with 12.5 μl 10% Nonidet P-40. The homogenate was centrifuged at 800 × g for 5 min at 4 °C, and supernatant containing the cytoplasmic extract was stored frozen at −80 °C. The nuclear pellet was resuspended in 25 μl ice-cold nuclear

277

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

272 273 274 275

278 279 280 281 282 283

JID: PHYMED 4

ARTICLE IN PRESS T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

310

extraction buffer (20 mmol/l HEPES, 0.4 mmol/l NaCl, 1 mmol/l EDTA, 25% glycerol, protease inhibitors 1×). After 30 min of intermittent mixing, the extract was centrifuged at 14000 × g for 10 min at 4 °C, and supernatants containing nuclear extracts were secured. Before immunoblotting, the protein concentration of each tissue was determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories, Japan), with BSA as a standard to ensure equal loading among lanes. Cytosolic (70 μg total protein) and nuclear (50 μg total protein) extracts were separated on a 7.5–15% polyacrilamide gel and transferred electophoretically to nitrocellulose membranes. Membranes were blocked with 5% non-fat dry milk in Tris-buffered saline Tween (20 mmol/l Tris, pH 7.6, 137 mmol/l NaCl, and 0.1% Tween 20) for 3 h at room temperature and incubated overnight at 4 °C with inhibitory kappa B (Iκ Bα , Santa Cruz Biotechnology, Inc.; Cat. No. sc-371) and NF-κ B p65 (Santa Cruz Biotechnology, Inc.; Cat. No. sc-109) primary antibodies. The level of α -tubulin (Santa Cruz Biotechnology Inc.; Cat. No. sc-31779) was estimated for equal loading of sample. Membranes were washed three times with Tris-buffered saline Tween 20 (TBST) and incubated for 1 h at room temperature with appropriate horseradish peroxidase-conjugated secondary antibodies. After three additional TBST washes, the immunoreactive bands were visualized by enhanced chemiluminescence (Amersham Biosciences, Buckinghamshire, UK) according to the manufacturer’s instructions. Band densities were determined using ATTO Densitograph Software (ATTO Corporation, Tokyo, Japan). All experimental sample values were expressed relative to this adjusted mean value. Tissue sections were sampled from four independent experiments.

311

Analysis of mRNA expression of hepatic genes

312

To analyze gene expression, total RNA was extracted from 100mg frozen liver samples using Trizol reagent (Invitrogen; Boston, MA, USA). RNA was quantified by A260, and its integrity verified by agarose gel electrophoresis using ethidium bromide for visualization. For the reverse transcriptase reaction, 1 μg of total RNA per sample and 8.5 μg/μl random hexamer primers were heated to 65 °C for 5 min, and then quenched on ice. This mixture was combined with 500 μmol/l each of dATP, dTTP, dCTP, and dGTP, 10 mmol/l DTT, 20 mmol/l Tris–HCl (pH 8.4), 50 mmol/l KCl, 5 mmol/l MgCl2 , 40 U of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen), and 100 U SuperScript III reverse transcriptase (Invitrogen). Samples were treated with DNase (Promega; Madison, WI, USA) for 20 min at 37 °C in a GeneAmp 9700 Thermal Cycler (Applied Biosystems; Foster City, CA, USA) and then held at 4 °C. After aliquots were taken for immediate use in polymerase chain reaction (PCR), the remainder of the cDNA was stored at −20 °C. mRNA expression was measured by quantitative real-time PCR (RT-PCR) in a fluorescent temperature Lightcycler 480 (Roche Diagnostics; Mannheim, Germany). Primers for amplification of each gene are listed in Table 1. The highly specific measurement of mRNA was carried out for MCP-1, TNF-α , IL-1β , IL-6, sterol regulating element binding protein-1c (SREBP-1c), liver X receptor-α (LXRα ), acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoylCoA desaturase 1 (SCD1), acyl-CoA:diacylglycerol acyltransferase 2 (DGAT-2), and β -actin using the LightCycler system (Bio-Rad). Each sample was run and analyzed in duplicate. Primers were designed using Primer Express Software version 2.0 System (Applied Biosystems; Foster City, CA, USA). The PCR reaction was performed using the following cycling protocol: 95 °C for 5 min, 45 cycles of 95 °C for 5 s, 58 °C for 15 s, and 72 °C for 20 s. Dissociation curves were run after amplification to identify the specific PCR products 2001). All mRNA levels were normalized to β -actin mRNA values and the results expressed as fold changes of the threshold cycle (Ct) value relative to controls using the delta–delta Ct method (Livak and Schmittgen 2001). To ensure amplification specificity during RT-PCR, amplified products were subjected to agarose gel electrophoresis to visually confirm the presence of a single amplicon of the expected size.

284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309

313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 Q3 341 342 343 344 345 346 347

[m5G;February 28, 2015;16:12]

Table 1. Sequences of oligonucleotides used as primers. Target gene

Primers

Sequence (5 -3 )

MCP-1

Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer

TCTCTTCCTCCACCACTATGCA GGCTGAGACAGCACGTGGAT CCAGGAGAAAGTCAGCCTCCT TCATACCAGGGCTTGAGCTCA GGTCAAAGGTTTGGAAGCAG TGTGAAATGCCACCTTTTGA AAAAGTCCTGATCCAGTTC GAGATGAGTTGTCATGTCC CGCTACCGTTCCTCTATCAA TTCGCAGGGTCAGGTTCTC CGCTACCGTTCCTCTATCAA TTCGCAGGGTCAGGTTCTC GGACAGAC1GATCGCAGAGAAAG TGGAGAGCCCCACACACA GGAACTGAACGGCATTACTCG CATGCCGTTATCAACTTGTCC CCTTAACCCTGAGATCCCGTAGA AGCCCATAAAAGATTTC1GCAAA CATGAAGACCCTCATCGCCG GTGACAGAGAAGATGTCTTGG TGTGATGGTGGGAATGGGTCAG TTTGATGTCACGCACGAT TTCC

TNF-α IL-1β IL-6 SREBP-1c LXR-α ACC FAS SCD1 DGAT2

β -actin

Statistical analysis

348

Data are expressed as mean ± standard error mean (SEM). Statistical analyses were performed using one-way analysis of variance. Dunnett range post-hoc comparisons were used to determine the source of significant differences, where appropriate. For the histological study, a non-parametric Kruskal–Wallis test was performed and Mann–Whitney’s U test was used to compare data within the groups. The SigmaPlot (Version 11.0) program was used for statistical analysis. Values of p < 0.05 were considered statistically significant.

349

Results

357

Effects of treatment on intracellular lipid accumulation and inflammatory cytokines in OA-treated HepG2 cells

358

HepG2 cells treated for 24 h with OA exhibited significant lipid droplet accumulation compared with untreated cells (Fig. 1A and B). Preincubation of cells with [6]-gingerol significantly reduced OAinduced lipid deposition, and the most effective inhibition of lipid accumulation was observed at a concentration of 100 μmol/l [6]gingerol (Fig. 1B and C). Treatment with OA resulted in an obvious increase in Chol and TG content compared with untreated cells, and this was attenuated significantly by pretreatment with [6]-gingerol (100 μmol/l; Fig. 1C). The deposition of lipid and increases in Chol and TG content in OA-treated HepG2 cells were also abolished by preincubation with Bezalip (Fig. 1A–C). Fig. 1D shows that exposure of HepG2 cells to OA significantly increased the production of MCP-1, TNF-α , IL-1β , and IL-6 relative to non-OA treated cells. Pretreatment with [6]-gingerol (100 μmol/l) for 24 h significantly attenuated the OA-induced production of all these inflammatory cytokines. Bezalip (100 μmol/l) almost eliminated OAevoked production of MCP-1, TNF-α , IL-1β , and IL-6 in HepG2 cells.

360

Effects of treatment on body weight, liver weight index, and plasma biochemical parameters in hamsters

377

At the end of 8 weeks of treatment, high doses of [6]-gingerol (100 mg/kg/day) significantly reduced body weight gain and the liver weight index in HFD-fed hamsters (Table 2). Similar results were seen in HFD-fed hamsters treated with Bezalip (10 mg/kg/day) (Table 2).

379

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

350 351 352 353 354 355 356

359

361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376

378

380 381 382

ARTICLE IN PRESS

JID: PHYMED

[m5G;February 28, 2015;16:12]

T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

5

(A)

(B)

(C)

(D)

Fig. 1. Effects of treatments on OA-induced lipid accumulation and inflammatory cytokine overproduction in HepG2 cells. Cells were exposed to OA (500 μmol/l) for 24 h alone or preincubated with [6]-gingerol (GF) at concentrations of 25 μmol/1 (GF 25), 50 μmol/l (GF 50), or 100 μmol/l (GF 100), or with 100 μmol/l Bezalip. (A) Representative Oil Red O staining of cells with different treatments. Cells were examined by light microscopy at a magnification of 400×. (B) Stained lipid droplets were analyzed by spectrophotometer. (C) Total intracellular Chol and TG were analyzed using an enzymatic colorimetric method. (D) Inflammatory cytokines in cell-free culture supernatants were determined by ELISA. The results are presented as the mean ± SEM of four experiments. a p < 0.05 and b p < 0.01 compared to untreated control values (untreat), respectively. c p < 0.05 and d p < 0.01 compared to the values of OA-treated cells (OA), respectively.

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

ARTICLE IN PRESS

JID: PHYMED 6

[m5G;February 28, 2015;16:12]

T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx Table 2. Effects of treatments on blood biochemistry and hepatic parameters in HFD-fed hamsters.

Final body weight (BW) (g) Liver weight index (%) Plasma glucose (mg/dl) Plasma insulin (mU) HOMA-IR Plasma leptin (pg/ml) Plasma adiponectin (pg/ml) Plasma TC (mg/dl) Plasma TG (mg/dl) Plasma LDL-C (mg/dl) Plasma HDL-C (mg/dl) Plasma FFA (mg/dl) Hepatic TC (μmol/g liver) Hepatic TG (μmol/g liver) Hepatic MCP-1 (pg/mg protein) Hepatic TNF-α (pg/mg protein) Hepatic IL-1β (pg/mg protein) Hepatic IL-6 (pg/mg protein)

CD-fed

HFD-fed

Vehicle

Vehicle

139.83 ± 9.14d 4.91 ± 0.27c 90.38 ± 3.81d 20.57 ± 1.83d 4.62 ± 0.22 308.42 ± 13.64d 128.29 ± 8.75d 108.23 ± 4.17d 91.38 ± 3.18d 48.73 ± 3.04d 49.13 ± 3.41c 28.69 ± 3.12d 10.04 ± 0.98d 8.72 ± 0.78d 33.37 ± 3.14d 72.04 ± 8.23d 23.84 ± 5.01d 54.72 ± 6.23d

195.19 ± 9.92b 5.83 ± 0.31a 153.24 ± 4.61b 41.59 ± 2.46b 15.71 ± 0.17b 428.39 ± 15.83b 78.42 ± 6.23b 262.91 ± 5.23b 160.09 ± 3.27b 191.26 ± 2.64b 26.27 ± 3.71a 57.82 ± 4.20b 19.62 ± 1.23b 17.73 ± 1.54b 82.78 ± 4.26 b 169.35 ± 12.34b 64.04 ± 6.08b 165.28 ± 14.32b

[6]-Gingerol (mg/kg/day)

Bezalip

25

50

100

10 mg/kg/day

180.74 ± 7.85b 5.62 ± 0.28a 150.02 ± 4.05b 37.31 ± 2.12 b 13.81 ± 0.21b 385.55 ± 16.13b,c 91.10 ± 6.12b,c 200.13 ± 5.01b,c 143.97 ± 3.71b,c 138.98 ± 3.29b,c 33.35 ± 3.54a,c 51.58 ± 4.03b 17.61 ± 1.16b 16.05 ± 1.65b 67.42 ± 5.48 b,c 148.72 ± 15.78 b,c 50.71 ± 3.56b,c 131.25 ± 11.24b,c

167.85 ± 8.53a,c 5.33 ± 0.22 147.40 ± 3.97b 32.83 ± 1.93b,c 11.94 ± 0.28b,c 366.27 ± 14.32a,c 102.48 ± 7.47a,c 181.51 ± 4.72b,c 130.43 ± 4.17a,c 110.32 ± 2.97 b,d 36.46 ± 4.59a,c 46.09 ± 3.62a,c 15.83 ± 1.09b,c 12.55 ± 1.43b,c 52.26 ± 4.33 b,d 134.30 ± 13.72b,c 39.97 ± 4.57b,c 109.08 ± 10.33b,d

157.02 ± 7.13d 5.25 ± 0.24 146.26 ± 4.27b 26.97 ± 2.01a,d 9.63 ± 0.25 b,d 330.56 ± 16.13d 112.73 ± 7.28d 160.46 ± 4.58a,d 118.41 ± 3.82a,d 83.24 ± 3.17a,d 41.35 ± 3.22a,c 39.27 ± 2.72a,d 13.92 ± 1.35a,d 11.21 ± 1.58a,c 43.21± 3.96 a,d 107.19 ± 9.24a,d 35.86 ± 4.49a,d 86.48 ± 9.56a,d

151.28 ± 6.83d 5.18 ± 0.32 144.78 ± 4.83b 25.13 ± 1.87a,d 8.90 ± 0.16 b,d 317.42 ± 17.26d 118.36 ± 6.65d 158.87 ± 4.34a,d 111.89 ± 3.16 a,d 79.11 ± 4.02a,d 42.37 ± 3.67a,c 35.66 ± 3.38a,d 13.22 ± 1.24a,d 10.64 ± 1.38a,c 29.88 ± 3.01d 96.47 ± 8.36a,d 28.68 ± 3.32d 73.89 ± 8.74a,d

The vehicle (distilled water) used to prepare the tested medication solution was given at the same volume. Values (mean ± SEM) were obtained from each group of 8 animals in each group after 8 weeks of the experimental period. a p < 0.05 and b p < 0.01 compared to the values of vehicle-treated CD-fed hamsters in each group, respectively. c p < 0.05 and d p < 0.01 compared to the values of vehicle-treated HFD-fed hamsters in each group, respectively.

391

Treatment of HFD-fed hamsters with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) decreased HOMA-IR and plasma leptin and insulin levels (Table 2). Plasma adiponectin was elevated in HFD-fed hamsters treated with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) (Table 2). Although the higher plasma glucose level in HFD-fed hamster tended to decrease with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) treatment, no significant differences were observed among the groups over the experimental period (Table 2).

392

Effects of treatment on plasma and hepatic lipids in hamsters

393

411

Oral administration of [6]-gingerol at a dose of 25, 50, or 100 mg/kg/day reduced plasma TC levels by 23.9%, 30.9%, and 38.9%, respectively, in HFD-fed hamsters (Table 2). The plasma levels of TG, LDL-C, and FFA in HFD-fed hamsters receiving 100 mg/kg/day [6]-gingerol treatment were decreased by 26.5%, 56.4%, and 32.1% respectively, compared to their vehicle-treated counterparts (Table 2). Plasma TC, TG, LDL-C, and FFA levels were reduced by 39.6%, 30.6%, 58.6%, and 38.3% respectively, in Bezalip (10 mg/kg/day)treated HFD-fed hamsters compared to their vehicle-treated counterparts (Table 2). The plasma HDL-C concentrations in HFDfed hamsters receiving [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) were increased, approaching the levels in the CD-fed group (Table 2). Hepatic TC and TG levels were significantly higher in HFD-fed hamsters compared with hamsters from the CD-fed group, and these were reduced by 29.1% and 36.7%, respectively, in HFD-fed hamsters treated with [6]-gingerol (100 mg/kg/day; Table 2). Bezalip (10 mg/kg/day) treatment also reduced hepatic TC and TG levels to 32.6% and 39.9% of that in vehicle-treated HFD-fed hamsters, respectively (Table 2).

412

Effects of treatment on liver histology

413

Administration of the HFD diet to hamsters resulted in a classical pathophysiological picture of NAFLD, with microvesicular and macrovesicular steatosis and multiple foci of inflammatory cell accumulation in the liver (Fig. 2). Representative histological photomicrographs of liver specimens show the number of macrovascular fat droplets and mild inflammatory foci in the livers of HFD-fed hamsters

383 384 385 386 387 388 389 390

394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410

414 415 416 417 418

were reduced after [6]-gingerol (100 mg/kg/day) treatment. Bezalip (10 mg/kg/day) treatment also improved hepatic steatosis and reduced hepatic inflammation in HFD-fed hamsters (Fig. 2). Histological grading of liver sections confirmed that both Bezalip and [6]-gingerol ameliorated both hepatic steatosis and inflammation (Table 3).

419

Effects of treatment on inflammatory cytokines in hamsters

424

HFD-fed hamsters had greater hepatic concentrations of MCP-1, TNF-α , IL-1β , and IL-6 protein and mRNA compared to the CD-fed group (Tables 2 and 4). Both the protein and mRNA levels of hepatic cytokines in [6]-gingerol (100 mg/kg/day)-treated HFD-fed hamsters were lower than those of vehicle-treated counterparts (Tables 2 and 4). In addition, Bezalip (10 mg/kg/day) treatment also reduced hepatic cytokine protein and mRNA levels to those of CD-fed animals (Tables 2 and 4).

425

Effects of treatment on hepatic expression of Iκ Bα and NF-κ B and NF-κ B binding activity Cytosolic Iκ Bα in the liver of HFD-fed hamsters was reduced to 55.2% of that in the normal group, and [6]-gingerol (100 mg/kg/day) treatment reduced Iκ Bα degradation in a dose-dependent manner (Fig. 3A). Treatment of HFD-fed hamsters with Bezalip (10 mg/kg/day) increased the cytosolic Iκ Bα protein level to 95.2% of that in the CD-fed group (Fig. 3A). The hepatic level of cytosolic NF-κ B p65 protein in HFD-fed hamsters was clearly lower than that of CD-fed hamsters and was upregulated by treatment with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day), which produced increases of 216.2% and 227.9%, respectively (Fig. 3A). The HFD-induced upregulation of nuclear NFκ B p65 protein was reduced by 39.1% and 58.4% relative to that in vehicle-treated HFD-fed hamsters after 8 weeks of treatment with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day), respectively (Fig. 3A). The DNA binding activity of NF-κ B p65 was significantly greater in the livers of HFD-fed hamsters compared to the CD-fed group (Fig. 3B). [6]-Gingerol (100 mg/kg/day)-treated HFD-fed hamsters had 45.3% lower NF-κ B p65 binding activity in liver than that of their vehicletreated counterparts (Fig. 3B). Bezalip suppressed the hepatic NF-κ B

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

420 421 422 423

426 427 428 429 430 431 432

433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454

ARTICLE IN PRESS

JID: PHYMED

[m5G;February 28, 2015;16:12]

T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

7

Fig. 2. Representative images of hematoxylin and eosin-stained livers from CD- or HFD-fed hamsters receiving 8-weeks of treatment. Photomicrographs (original magnification, 400×) are of tissues isolated from (A) vehicle-treated CD-fed hamsters, (B) vehicle-treated HFD-fed hamsters, (C) 25 mg/kg/day, (D) 50 mg/kg/day or (E) 100 mg/kg/day [6]-gingeroltreated HFD-fed hamsters. (F) Another group of HFD-fed hamsters was treated orally with 10 mg/kg/day Bezalip. Arrows and arrow head indicate fat droplets and inflammatory foci, respectively. The severity of hepatic steatosis and inflammation were scored in Table 2.

Table 3. Summary of steatosis and inflammation score of CD- or HFD-fed hamsters receiving 8-weeks of treatments. CD-fed

HFD-fed

Vehicle

Vehicle

[6]-Gingerol (mg/kg/day)

Bezalip

25

50

100

(10 mg/kg/day)

Steatosis 0 8 1 0 2 0 3 0 4 0 Inflammation

0 0 4 4 0

0 1 4 3 0

0 2 5 1 0

0 3 5 0 0

0 4 4 0 0

0 1 2 3

0 3 3 2

0 4 3 1

0 5 2 1

0 6 2 0

0 7 1 0

8 0 0 0

There were 8 animals in each group. Data are expressed as the number of hamsters exhibiting the grade of steatosis or inflammation indicated.

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

ARTICLE IN PRESS

JID: PHYMED 8

[m5G;February 28, 2015;16:12]

T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx Table 4. Hepatic mRNA expression of cytokines and lipogenic genes in CD- or HFD-fed hamsters receiving 8-weeks of treatments.

MCP-1 mRNA (relative expression) TNF-α mRNA (relative expression) IL-1β mRNA (relative expression) IL-6 mRNA (relative expression) SREBP-1c (relative expression) LXR-α (relative expression) ACC (relative expression) FAS (relative expression) SCD-1 (relative expression) DGAT-2 (relative expression)

CD-fed

HFD-fed

Vehicle

Vehicle

1.00 ± 0.03d 1.00 ± 0.05d 1.00 ± 0.06d 1.00 ± 0.04d 1.00 ± 0.07d 1.00 ± 0.05d 1.00 ± 0.08d 1.00 ± 0.06d 1.00 ± 0.03d 1.00 ± 0.05d

2.48 ± 0.46b 2.35 ± 0.27b 2.68 ± 0.23b 3.02 ± 0.46b 2.83 ± 0.18b 3.28 ± 0.14b 2.53 ± 0.21b 3.03 ± 0.29b 2.97 ± 0.26b 3.10 ± 0.31b

[6]-Gingerol (mg/kg/day)

Bezalip

25

50

100

10 mg/kg/day

2.02 ± 0.37 b 2.06 ± 0.21b 2.13 ± 0.38b 2.39 ± 0.26b 2.54 ± 0.14b 2.62 ± 0.18b,c 2.03 ± 0.19b,c 2.42 ± 0.33b 2.38 ± 0.17b,c 2.71 ± 0.23b

1.57 ± 0.22a,c 1.86 ± 0.28b,c 1.68 ± 0.17a,c 1.99 ± 0.32b,c 2.26 ± 0.20b,c 2.29 ± 0.12b,c 1.77 ± 0.22b,c 2.18 ± 0.27b,c 1.90 ± 0.23a,c 2.45 ± 0.27b,c

1.29 ± 0.26a,d 1.48 ± 0.25a,d 1.50 ± 0.28a,d 1.58 ± 0.13a,d 1.88 ± 0.23a,d 1.96 ± 0.11a,d 1.52 ± 0.23a,d 1.85 ± 0.16a,d 1.72 ± 0.26a,d 1.87 ± 0.18a,d

1.18 ± 0.32a,d 1.33 ± 0.16a,d 1.20 ± 0.15a,d 1.35 ± 0.17a,d 1.73 ± 0.17a,d 1.82 ± 0.16a,d 1.45 ± 0.12a,d 1.67 ± 0.14a,d 1.54 ± 0.31a,d 1.74 ± 0.22a,d

The vehicle (distilled water) used to prepare the tested medication solution was given at the same volume. Values (mean ± SEM) were obtained from each group of 8 animals in each group after 8 weeks of the experimental period. a p < 0.05 and b p < 0.01 compared to the values of vehicletreated CD-fed hamsters in each group, respectively. c p < 0.05 and d p < 0.01 compared to the values of vehicle-treated HFD-fed hamsters in each group, respectively.

456

p65 binding activity of HFD-fed hamsters by 56.5% relative to that of their untreated counterparts (Fig. 3B).

457

Effects of treatment on hepatic mRNA expression of lipogenic genes

455

478

HFD feeding markedly increased the hepatic mRNA levels of SREBP-1c in hamsters to 2.8-fold that of the CD-fed group (Table 4). [6]-Gingerol (100 mg/kg/day) suppressed the HFD-induced increase in hepatic mRNA levels of SREBP-1c by 33.5% relative to vehicletreated counterparts (Table 4). Hepatic SREBP-1c mRNA levels were significantly reduced (by 38.9%) in Bezalip-treated HFD-fed hamsters compared to their vehicle-treated counterparts (Table 4). HFD caused a 3.3-fold induction of hepatic LXR-α mRNA, and a 2.5-fold induction of hepatic ACC mRNA over those of the CD-fed group (Table 4). The HFD-induced mRNA levels of LXR-α and ACC in liver were reduced significantly (40.2% and 39.9% reduction, respectively) by treatment with [6]-gingerol (100 mg/kg/day) compared to those of vehicle-treated counterparts (Table 4). Administration of Bezalip to HFD-fed hamsters for 8 weeks caused a 55.4% and 57.3% down-regulation of hepatic LXR-α and ACC mRNA levels, respectively, relative to those in vehicle-treated hamsters, respectively (Table 4). Hepatic mRNA levels of FAS, SCD-1, and DGAT-2 in HFD-fed hamsters were clearly higher than those of the CD-fed group and were down-regulated by [6]-gingerol (100 mg/kg/day) treatment (44.9%, 48.1%, and 43.8% decreases, respectively); similar results were obtained in the Bezalip-treated HFD-fed group (Table 4).

479

Discussion

480

Inflammation plays a pivotal role in NAFLD, and an important pharmacological objective in treating this disorder is the direct targeting of inflammatory activation (Braunersreuther et al. 2012). Our data demonstrate that exposure of HepG2 cells to OA results in lipid accumulation and the overproduction of inflammatory cytokines such as MCP-1, TNF-α , IL-1β and IL-6. This is in agreement with a previous study that showed plasma concentrations of FFAs were increased in patients with NAFLD and correlated with the development of more severe liver disease (Nehra et al. 2001). Our study demonstrates that preincubation with [6]-gingerol significantly attenuates the accumulation of lipids and alleviates the overproduction of cellular fatty drops and inflammatory cytokines in HepG2 cells exposed to excess OA. These data indicate that [6]-gingerol might be effective in preventing and reversing lipid accumulation and the inflammatory response, which may accelerate liver injuries in NAFLD/NASH. As [6]-gingerol inhibits the accumulation of lipids in HepG2 cells this may be the primary protective mechanism exerted by the compound which would

458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477

481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496

prevent all following inflammatory reactions. To examine this further, we tested the effect of [6]-gingerol on hepatic steatosis and inflammation using an in vivo NAFLD model induced by a HFD in hamsters (Bhathena et al. 2011). We found that [6]-gingerol significantly decreased liver weight index and levels of TG, TC, and FFA in the plasma and livers of HFD-fed hamsters. In addition, [6]-gingerol attenuated the development of HFD-induced hepatic steatosis and injury as assessed by microscopic analysis, suggesting that [6]-gingerol has the beneficial effects of preventing lipid accumulation and reversing disrupted liver structure. Overnutrition-induced chronic inflammation is a key contributor to the pathogenesis of insulin resistance and metabolic syndrome (Lionetti et al. 2009). Therefore, we investigated whether [6]-gingerol could improve fatty liver changes by decreasing inflammatory cytokines in the HFD-induced NAFLD hamsters. Administration of [6]gingerol during NAFLD development significantly attenuated the expression of MCP-1, TNF-α , IL-1β , and IL-6 in the livers of HFD-fed hamsters. These results support the idea that the therapeutic effect of [6]-gingerol on fatty liver may be associated with the regulation of the inflammatory cytokines. Actually, these inflammatory cytokines can induce insulin resistance (Kanda et al. 2006; Schwabe and Brenner 2006; Bhathena et al. 2011). Patients with type 2 diabetes are at a higher risk of NAFLD and other inflammatory processes (Marchesini et al. 2005). HFD-fed hamsters in the present study also showed significant increases in plasma insulin and leptin levels, as well as HOMA-IR, but a remarkable decrease in plasma adiponectin levels. These abnormalities were improved significantly by [6]-gingerol treatment, suggesting that [6]-gingerol may positively influence fatty liver changes in type 2 diabetes and in the insulin-resistant state. An increasing number of studies have demonstrated that the activation of NF-κ B and the subsequent coordinated expression of gene products may play important roles in the pathogenesis of NAFLD (Dela et al. 2005; Videla et al. 2009; Velayudham et al. 2009). The activation of cytosolic NF-κ B is tightly regulated by inhibitory protein Iκ B and involves phosphorylation, ubiquitination, and proteolysis of Iκ B (DiDonato et al. 1997). Degradation of Iκ B allows nuclear translocation of NF-κ B, where it binds to promoter sites for gene transcription (DiDonato et al. 1997). [6]-Gingerol has been reported to exert antiinflammatory activity through inhibiting NF-κ B (Li et al. 2013). The inhibition of NF-κ B by [6]-gingerol might be a critical step in preventing a cascading inflammatory response during NAFLD development. In the present study, [6]-gingerol increased cytoplasmic Iκ B protein levels and significantly inhibited NF-κ B nuclear translocation in livers of HFD-fed hamster. [6]-Gingerol also suppressed the upregulation of nuclear NF-κ B DNA binding activity in the livers of HFD-fed hamster, implying that [6]-gingerol resists the activation of NF-κ B

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542

JID: PHYMED

ARTICLE IN PRESS

[m5G;February 28, 2015;16:12]

T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

9

(A)

(B) Fig. 3. (A) Protein expression of Iκ Bα and NF-κ B p65, and (B) DNA binding activity of NF-κ B p65 in the liver of CD- or HFD-fed hamsters receiving 8-weeks of treatments. HFD-fed hamsters were dosed by oral gavage once per day for eight weeks with 25 mg/kg/day [6]-gingerol (HFD-GF 25), 50 mg/kg/day [6]-gingerol (HFD-GF 50), 100 mg/kg/day [6]-gingerol (HFD-GF 100) or 10 mg/kg/day Bezalip (HFD-Bezalip). CD- (CD-Veh) or HFD-fed hamsters (HFD-Veh) receiving vehicle treatment were given the same volume of vehicle (distilled water) used to prepare the tested medication solution. Similar results were obtained with an additional 4 replications. Data were expressed as the mean with SEM (n = 5 per group) in each column. a p < 0.01 and b p < 0.01 compared to vehicle-treated CD-fed hamsters. c p < 0.05 and d p < 0.01 compared to the values of vehicle-treated HFD-fed hamsters in each group, respectively.

543 544 545 546 547 548 549 550 551 552 553 554 555

induced by HFD. This provides convincing evidence that the antiinflammatory activities of [6]-gingerol are mediated through NF-κ B and that [6]-gingerol protects against NAFLD in an NF-κ B-dependent manner. Chronic hyperinsulinemia promotes hepatic lipogenesis through upregulation of lipogenic transcription factors. One such nuclear transcription factor is LXR-α , which is highly expressed in the liver and acts to enhance transcription of several genes involved in lipogenesis, including SREBP-1c and its target genes ACC, FAS, SCD-1, and DGAT-2 (Browning and Horton 2004). HFD-induced hyperinsulinemia in hamsters was blocked by [6]-gingerol. We postulate that the improvement reduction of liver steatosis in [6]-gingerol-treated HFDfed hamsters was associated with a reduction in expression of genes

involved in lipogenesis. In this study, HFD-fed hamsters had increased levels of LXR-α and SREBP-1c mRNA and their downstream target genes. These alterations were significantly reversed by [6]-gingerol in HFD-fed hamsters. These data suggest that [6]-gingerol also exerts a protective effect on HFD-induced liver steatosis and injury in hamsters through the modulation of lipogenesis genes. Bezalip, a fibric acid derivative, is a commercially available drug for the treatment of hyperlipidemia and is generally effective in lowering elevated plasma TG in coronary heart disease patients (Haim et al. 2006). Although the hepatoprotective effect of [6]-gingerol was less marked than that produced by Bezalip, [6]-gingerol may be a suitable therapeutic adjunct for patients who are particularly sensitive to fibrate-associated side effects (Wu et al. 2009).

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

556 557 558 559 560 561 562 563 564 565 566 567 568

JID: PHYMED 10

ARTICLE IN PRESS T.-F. Tzeng et al. / Phytomedicine xxx (2015) xxx–xxx

569

Conclusion

570

578

These findings provide novel evidence that [6]-gingerol protects against HFD-induced hepatic inflammation and insulin resistance by decreasing the induction of inflammatory cytokines via an NF-κ Bdependent pathway. Consequently, [6]-gingerol suppresses LXR-α , SREBP-1c, and the expression of their downstream target genes, ultimately leading to inhibition of hepatic lipogenesis. These results suggest that [6]-gingerol is a potent food component that protects against HFD-induced hepatic steatosis and related metabolic disorders.

579

Conflicts of interest

580 581

We wish to confirm that there are no known conflicts of interest associated with this publication.

582

Acknowledgments

583 584

The present study was supported by a grant from the National Science Council of Taiwan (grant no. NSC 102-2320-B-127-001-MY3).

585

References

586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625

Araya, J., Rodrigo, R., Videla, L.A., Thielemann, L., Orellana, M., Pettinelli, P., Poniachik, J., 2004. Increase in long-chain polyunsaturated fatty acid n-6/n-3 ratio in relation to hepatic steatosis in patients with non-alcoholic fatty liver disease. Clin. Sci. 106, 635–643. Bhathena, J., Kulamarva, A., Martoni, C., Urbanska, A.M., Malhotra, M., Paul, A., Prakash, S., 2011. Diet-induced metabolic hamster model of nonalcoholic fatty liver disease. Diabetes, Metab. Syndr. Obes. 4, 195–203. Braunersreuther, V., Viviani, G.L., Mach, F., Montecucco, F., 2012. Role of cytokines and chemokines in non-alcoholic fatty liver disease. World J. Gastroenterol. 18, 727–735. Browning, J.D., Horton, J.D., 2004. Molecular mediators of hepatic steatosis and liver injury. J. Clin. Invest. 114, 147–152. Chang, C.J., Liou, S.S., Tzeng, T.F., Liu, I.M., 2014. The ethanol extract of Zingiber zerumbet Smith attenuates non-alcoholic fatty liver disease in hamsters fed on high-fat diet. Food Chem. Toxicol. 65, 33–42. Chang, C.J., Tzeng, T.F., Liou, S.S., Chang, Y.S., Liu, I.M., 2012. Absence of genotoxic and mutagenic effects of Zingiber zerumbet (L.) Smith (Zingiberaceae) extract. Evidence-Based Complementary Altern. Med. 2012, 406296. Chang, W.S., Chang, Y.H., Lu, F.J., Chiang, H.C., 1994. Inhibitory effects of phenolics on xanthine oxidase. Anticancer Res. 14, 501–506. de Silva, P.P., Davis, P.J., Cheema, S.K., 2004. Hyperlipidaemic effect of fish oil in Bio F1B hamsters. Br. J. Nutr. 91, 341–349. Dela Peña, A., Leclercq, I., Field, J., George, J., Jones, B., Farrell, G., 2005. NF-kappaB activation, rather than TNF, mediates hepatic inflammation in a murine dietary model of steatohepatitis. Gastroenterology 129, 1663–1674. DiDonato, J.A., Hayakawa, M., Rothwarf, D.M., Zandi, E., Karin, M., 1997. A cytokineresponsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388, 548–554. Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–506. Guh, J.H., Ko, F.N., Jong, T.T., Teng, C.M., 1995. Antiplatelet effect of gingerol isolated from Zingiber officinale. J. Pharm. Pharmacol. 47, 329–332. Haim, M., Benderly, M., Boyko, V., Goldenberg, I., Tanne, D., Battler, A., Goldbourt, U, Behar, S., Bezafibrate Infarction Prevention (BIP) Study Group, 2006. Decrease in triglyceride level by bezafibrate is related to reduction of recurrent coronary events: a Bezafibrate Infarction Prevention substudy. Coron. Artery Dis. 17, 455–461. Janorkar, A.V., King, K.R., Megeed, Z., Yarmush, M.L., 2009. Development of an in vitro cell culture model of hepatic steatosis using hepatocyte-derived reporter cells. Biotechnol. Bioeng. 102, 1466–1474.

571 572 573 574 575 576 577

[m5G;February 28, 2015;16:12]

Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K., Kitazawa, R., Miyachi, H., Maeda, S., Egashira, K., Kasuga, M., 2006. MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity. J. Clin. Invest. 116, 1494–1505. Kim, J.K., Kim, Y., Na, K.M., Surh, Y.J., Kim, T.Y., 2007. [6]-Gingerol prevents UVBinduced ROS production and COX-2 expression in vitro and in vivo. Free Radic. Res. 41, 603–614. Kleiner, D.E., Brunt, E.M., Van Natta, M., Behling, C., Contos, M.J., Cummings, O.W., Ferrell, L.D., Liu, Y.C., Torbenson, M.S., Unalp-Arida, A., Yeh, M., McCullough, A.J., Sanyal, A.J., 2005. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 41, 1313–1321. Li, X.H., McGrath, K.C., Tran, V.H., Li, Y.M., Duke, C.C., Roufogalis, B.D., Heather, A.K., 2013. Attenuation of proinflammatory responses by S-[6]-gingerol via inhibition of ROS/NF-kappa B/COX2 activation in HuH7 cells. Evidence-Based Complementary Altern. Med. 2013, 146142. Lionetti, L., Mollica, M.P., Lombardi, A., Cavaliere, G., Gifuni, G., Barletta, A., 2009. From chronic overnutrition to insulin resistance: the role of fat-storing capacity and inflammation. Nutr., Metab., Cardiovasc. Dis. 19, 146–152. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−CT method. Methods 25, 402–408. Marchesini, G., Marzocchi, R., Agostini, F., Bugianesi, E., 2005. Nonalcoholic fatty liver disease and the metabolic syndrome. Curr. Opin. Lipidol. 16, 421–427. Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher, D.F., Turner, R.C., 1985. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28, 412–419. McCullough, A.J., 2006. Pathophysiology of nonalcoholic steatohepatitis. J. Clin. Gastroenterol. 40 (Suppl 1), S17–S29. Nehra, V., Angulo, P., Buchman, A.L., Lindor, K.D., 2001. Nutritional and metabolic considerations in the etiology of nonalcoholic steatohepatitis. Dig. Dis. Sci. 46, 2347–2352. Oakley, F., Mann, J., Nailard, S., Smart, D.E., Mungalsingh, N., Constandinou, C., Ali, S., Wilson, S.J., Millward-Sadler, H., Iredale, J.P., Mann, D.A., 2005. Nuclear factorkappaB1 (p50) limits the inflammatory and fibrogenic responses to chronic injury. Am. J. Pathol. 166, 695–708. Schmilovitz-Weiss, H., Hochhauser, E., Cohen, M., Chepurko, Y., Yitzhaki, S., Grossman, E., Leibowitz, A., Ackerman, Z., Ben-Ari, Z., 2013. Rosiglitazone and bezafibrate modulate gene expression in a rat model of non-alcoholic fatty liver disease–a historical prospective. Lipids Health Dis. 12, 41. Schuppan, D., Schattenberg, J.M. , 2013. Non-alcoholic steatohepatitis: pathogenesis and novel therapeutic approaches. J. Gastroenterol. Hepatol. 28 (Suppl 1), 68–76. Schwabe, R.F., Brenner, D.A., 2006. Mechanisms of liver injury. I. TNF-alpha induced liver injury: role of IKK, JNK, and ROS pathways. Am. J. Physiol.: Gastrointest. Liver Physiol. 290, G583–G589. Singh, A.B., Akanksha, Singh, N., Maurya, R., Srivastava, A.K., 2009. Anti-hyperglycaemic, lipid lowering and anti-oxidant properties of [6]-gingerol in db/db mice. Int. J. Med. Med. Sci. 1, 536–544. Van Heek, M., Compton, D.S., France, C.F., Tedesco, R.P., Fawzi, A.B., Graziano, M.P., Sybertz, E.J., Strader, C.D., Davis Jr., H.R., 1997. Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J. Clin. Invest. 99, 385–390. Velayudham, A., Dolganiuc, A., Ellis, M., Petrasek, J., Kodys, K., Mandrekar, P., Szabo, G., 2009. VSL#3 probiotic treatment attenuates fibrosis without changes in steatohepatitis in a diet-induced nonalcoholic steatohepatitis model in mice. Hepatology 49, 989–997. Videla, L.A., Tapia, G., Rodrigo, R., Pettinelli, P., Haim, D., Santibanez, C., Araya, A.V., Smok, G., Csendes, A., Gutierrez, L., Rojas, J., Castillo, J., Korn, O., Maluenda, F., Díaz, J.C., Rencoret, G., Poniachik, J., 2009. Liver NF-kappaB and AP-1 DNA binding in obese patients. Obesity 17, 973–979. Wu, J., Song, Y., Li, H., Chen, J., 2009. Rhabdomyolysis associated with fibrate therapy: review of 76 published cases and a new case report. Eur. J. Clin. Pharmacol. 65, 1169–1174. Xu, Z.J., Fan, J.G., Ding, X.D., Qiao, L., Wang, G.L., 2010. Characterization of high-fat, diet-induced, non-alcoholic steatohepatitis with fibrosis in rats. Dig. Dis. Sci. 55, 931–940. Yob, N.J., Jofrry, S.M., Affandi, M.M., The, L.K., Salleh, M.Z., Zakaria, Z.A., 2011. Zingiber zerumbet (L.) Smith: a review of its ethnomedicinal, chemical, and pharmacological uses. Evidence-Based Complementary Altern. Med. 2011, 543216. Young, H.Y., Luo, Y.L., Cheng, H.Y., Hsieh, W.C., Liao, J.C., Peng, W.H., 2005. Analgesic and anti-inflammatory activities of [6]-gingerol. J. Ethnopharmacol. 96, 207–210.

Please cite this article as: T.-F. Tzeng et al., [6]-Gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis, Phytomedicine (2015), http://dx.doi.org/10.1016/j.phymed.2015.01.015

626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695

Q4