GENOMICS

l&326-334

(1992)

A ~-CM Genetic Linkage Map of Human Chromosome That Includes 47 Loci SANTOSH K. MISHRA,

CYNTHIA HELMS, DENISE DORSEY, M. ALAN PERMUTT,*

7p

AND HELEN DONIS-KELLER’

Genetics Department and *Metabolism Division of the Department of Internal Medicine, Washington University School of Medicine, St. Louis, Missouri 63110 Received

July 22, 1991

A new high-resolution genetic linkage map for human chromosome 7p has been constructed. The map is composed of 47 loci (54 polymorphic systems), 19 of which are uniquely placed with odds of at least 1OOO:l. Four genes are represented, including glucokinase (GCK, ATP:D-bexose-6-phosphotransferase, EC 2.7.1.2) which was mapped via a (CA), dinucleotide repeat polymorphism. The sex-average map measures 94.4 CM and the male and female maps measure 73.2 and 116.1 CM, respectively. We believe that the genetic map extends nearly the full length of the short arm of chromosome 7 since a centromere marker has been incorporated, and the most distal marker, D7S21, has been cytogenetically localized by in situ hybridization to 7p22-pter. The average marker spacing is 2 CM, and the largest interval between uniquely placed markers is 13 CM (sex-average map). Overall, female recombination was observed to be about 1.5 times that of males, and a statistically significant sex-specific recombination frequency was found for a single interval. The map is based on genotypic data gathered from 40 CEPH reference pedigrees and was constructed using the CRI-MAP program package. The map presented here represents a combined and substantially expanded dataset compared to previously published chromosome 7 maps, and it will serve as a “baseline” genetic map that should prove useful for future efforts to develop a 1-CM map and for construction of a contiguous clonebased physical map for this chromosome. o 1992 Amdemic Press, Inc.

INTRODUCTION

Identification of the chromosomal locations of disease-causing genes has advanced rapidly in recent years due largely to the availability of mapped sets of genetic markers. For example, tumor progression in colon cancer has been documented with the use of RFLP markers (Vogelstein et al., 1988; Kern et al., 1989). Other classical linkage analysis studies of coinheritance of genetic marker alleles with disease phenotype have pointed the way to cloning and characterization of gene candidates. Recent examples include breast cancer (Hall ’ To whom correspondence ment, Washington University Avenue, Box 8232, St. Louis,

should be addressed at Genetics DepartSchool of Medicine, 660 South Euclid MO 63110.

osss-7543/92 $3.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

326

et al., 1990), malignant hyperthermia (McCarthy et al., 1990; MacLennan et al., 1990), and familial hypertrophic cardiomyopathy (Jarcho et al., 1989; Tanigawa et al, 1990). Primary genetic linkage maps have been constructed for each of the human chromosomes that undergo meiotic exchange (e.g., White et al., 1990a; Donis-Keller et al., 1987), and although the human Y chromosome does not have a homolog, exchange with the X chromosome at the pseudoautosomal region provides a map extending approximately 50 CM in males and 13 CM in females (Donis-Keller, unpublished; D. Page, personalcommunication). Maps cannot be independently verified from published data nor can several maps be integrated into a single map since the genotypes from which the maps are constructed are not published and a public respository system similar to the GenBank and EMBL DNA sequencing databases does not yet exist. However, collaborators of the CEPH (Centre d’Etude Polymorphisme Humain, Paris) share a common reference pedigree collection for genotyping markers and, following publication of maps, genotypes are deposited in a database and collaborators are free to use the data to construct maps independently. In addition, “committee maps” based on a subset of the CEPH database have been published by groups of CEPH collaborators for chromosomes 10 and 1 (White et al., 199Ob; Dracopoli et al., 1991). While RFLP probes have been the mainstay of genetic mapping, the discovery of polymorphisms within di-, tri-, and tetranucleotide repeat elements (i.e., simple sequence repeat elements, SSRPs) offers considerable potential for construction of high-resolution maps on the order of a centimorgan. These markers appear to be abundant (Weber and May, 1989; Edwards et al., 1991a,b) and highly informative (Weber, 1990; Litt and Luty, 1989; Edwards et al., 1991a,b), and they can be assayed conveniently by PCR methods. Another advantage of SSRPs is that they are ready-made STSs (sequence-tagged sites, Olson et al., 1989) that can be of use for physical mapping purposes, such as STS content mapping (Barillot et al., 1991; Green and Olson, 1990). SSRPs could mediate important integration functions between genetic and physical maps and lead to unified high-resolution maps for each of the human chromo-

CHROMOSOME

somes. More than 150 SSRPs have been reported and their chromosome origins identified, but very few have been genetically mapped. Therefore, it remains to be determined whether SSRPs will tend to cluster in specific regions of the genome, like VNTRs, for example, which seem to be located predominantly near the ends of chromosomes (Nakamura et at., 1989; Richards et al, 1991a,b; Royle et al., 1988). We report here the construction of a new genetic linkage map for the short arm of chromosome 7, which should prove useful for disease gene localization studies, provide a means of rapidly localizing new markers, and assist in the development of a fully integrated genetic and physical map for this chromosome. MATERIALS

AND

METHODS

Genetic markers. All markers used in this study are listed in Table 1. RFLP probes with the CR1 prefix were a gift from Collaborative Research, Inc. (Waltham, MA), and may be purchased from the ATCC (Rockville, MD) or from CR1 directly. Additional details on the characteristics of these markers are given in Donis-Keller et al. (1987), and Barker et al. (1987). The following markers used to obtain genotypic data are available from the ATCC: pJ5.11 (D7SlO), phage 6 (D7Sll), pTM60 (D7S132), pTM102L (D7S135), pTS194 (D7S150), pRM7.4 (D7S370), pTHH28 (D7S371), A-64-EGFR (EGFR), pE7 (EGFR). pMGB7 (D7Z2) can be obtained from Dr. Huntington Willard (Stanford University), and LMS31 (D7S21) can be obtained from Dr. Alec Jeffreys (University of Leicester). PCR markers Mfd20 (D7S435) and GCK are assayed by PCR amplification of genomic DNA using the following primer sequences: Mfd20 (D7S435) 5’ TTAAAATGTTGAAGGCATCTTC 3’, 5’ TTTGAGTAGGTGGCATCTCA 3’ (Weber et al., 1990); GCK No. 9509,5’ TTGGTCAGTGTAGGCTGAACTCATG 3’; and No. 9510,5’ CCCACACCAAAACTGCCTGTATTAG 3’ (Matsutani et al., 1992). The oligonucleotide primers were synthesized with an Applied Biosysterns 380B DNA synthesizer, ethanol-precipitated, and used without further purification. For the GCK marker allele designations Z, Z + 2, etc. (Matsutani et al., 1992), correspond to 195,197 bp, etc., described in this work (see Table 1 and Fig. 1). A CEPH reference genotype for Mfd20 useful for correlating allele designations to untested individuals is given as follows: K1416 = 122,132, K37-04 = 126,126; K137713 = 128,128; K1420-02 = 130,126; K1349-02 = 132,132; K1418-Ol = 134,126. An analogous CEPH reference genotype for GCK alleles l-3 is given in Fig. 1. Allele 4 = 201 bp is demonstrated by CEPH individual K13293-12. The polymorphism information content (PIC) and heterozygosity (HET) computations were performed using a computer program (PIC/HET, R. Weaver, manuscript in preparation) with the PIC formula described in Botstein et al. (1980) and an allele frequency approximation method to calculate HET. Genotypic data from the CEPH primary panel parents (74 total) were used, except individuals K104-02, K1375-01, K13292-01, K1xi%-o1, K13294-01, K13294-02 were not included in the calculations because of interrelatedness. Genotyping. Genomic DNA used for genotyping was purified from lymphoblastoid cell lines grown in our laboratory (CEPH families K102, K104, K884, K13291, K13292, K13293, K13294, K1331, K1332, K1333, K1334, K1340, K1341, K1344, K1345, K1346, K1347, K1349, K1350, K1362) using an automatic extractor (ABI, Foster City, CA) or were obtained from the CEPH. Cell lines were obtained from the NIGMS Mutant Cell Repository (Camden, NJ) or received as gifts from Dr. J. Gusella and Dr. R. White. Genetic markers were first tested against a panel of CEPH parents (80 individuals), and all informative families (i.e., at least one parent heterozygous for the marker) were then genotyped. To facilitate determination of allele assignments, each assay (Southern blot or PCR DNA sequencing gel) contained all available family members. RFLP

327

7p MAP

genotyping by Southern hybridization with 32P-labeled probes was performed as previously described (Donis-Keller et al., 1987). PCR genotyping reactions for the GCK and Mfd20 (D7S435) were performed using 5’-end-labeled primers. One oligonucleotide primer (9510 for GCK or 5’ TTAAAATGTTGAAGGCATCTTC 3’ for Mfd20) was first end-labeled with [y-32P]ATP and T4 polynucleotide kinase (Perkin-Elmer/Cetus). The reaction mixture (50 pM oligo 9510, 250 &i [Y-~*P]ATP, 10 ~1 T4 kinase, in 1X kinase buffer [50 n-&4 Tris-HCl (pH 7.6), 10 n-&f MgCl,, 5 mM DTT, 0.1 mM spermidine-HCl, 0.1 n&f EDTA (pH 8.0)]) was incubated for 45 min at 37”C, the enzyme inactivated by treatment for 10 min at 7O”C, and the incorporation of radioactivity measured by adsorption to DE-81 filters (Sambrook et al., 1989). This reaction mixture was added to the PCR reaction cocktail without further purification. PCR amplification for Mfd20 was performed essentially as reported by Weber et al. (1990). For the GCK polymorphism, PCR reactions were carried out in lo-p1 volumes containing 50 r&4 KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl,, 200 pM dNTPs, 1 pM each oligonucleotide primer, 1 unit Taq polymerase (Amplitaq, Perkin-Elmer/Cetus), and 200 ng genomic DNA. Thirty-five cycles of amplification consisting of l-min denaturation at 94”C, l-min annealing extension at 66”C, and a final elongation for 9 min at 66°C were carried out for each sample using a Perkin-Elmer/Cetus thermocycler. Aliquots of the amplified DNA were electrophoresed on standard 6% denaturing polyacrylamide DNA sequencing gels for 2.5 h. Gels were autoradiographed for l-2 h or overnight in some cases. Molecular length size standards were produced using the DNA sequencing kit and a bacteriophage Ml3 segment cloned into M13mp19 (Sequenase, US Biochem.). Genotypes were independently determined by two scientists reading the X-ray films, and data were entered into linkage files using a Macintosh HyperCard data-entry system (Six-Ponds Software). Additional genotypic data was obtained from the CEPH Genotype Database (release 4). Genetic map construction. New genotypings described in this study, genotypic data previously collected (Donis-Keller et al., 1987), and the CEPH genotype database (release 4) served as the primary data from which the genetic maps were constructed using the program package CRI-MAP (P. Green, in preparation; Lander and Green, 1987). Briefly, the genotypic data are first checked for noninheritance, and corrections are then made and reentered into the genotype files. Two-point linkage analyses are then performed, followed by the options “build” and “flips.” The program option “chrompics” was used for error checking purposes and map construction was repeated. Graphic representations of the final maps were drawn using a computer program, Vertical Mapper (Six-Ponds Software). The significance of differences between male and female recombination was tested using the x2 statistic.

RESULTS Genetic Map Construction Polymorphic loci were selected for the construction of the chromosome 7p map from preliminary two-point linkage analyses with new markers against our genotype database of more than 2000 polymorphic systems or from previously constructed chromosome 7 maps. Using the build option of the CRI-MAP program, we allowed the default value for a pair of loci to serve as the nucleus of the map and to select the order in which loci are tested for placement (i.e., descending order according to informativeness). In addition, we tested several different pairs of loci as nuclei for the map and allowed the default priority list as well as a random list of loci to be tested sequentially for placement in the map. Altogether, 13 build runs were completed using odds for order of at least lOOO:l, which resulted in unique placement of 19

328

MISHRA

ET

AL.

TABLE Genetic Locus

Reg. lot.

Markers

Probe

Incorporated

pA2H3

H

D7SlO

pJ5.11

M

D7Sll

Phage

D7S17

~7-26

X

LMS31 CRI-L390

Hf Bg

D7S57

CRI-L751

M

D7S58

CRI-L819

H

7~22~

6

H

D7S59

CRI-L887

M

D7S62

CRI-L1020

T

H D7S65 D7S66

CRI-P137 CRI-R12

T M

D7S69

CRI-R944

M

D7S74

CRI-S16

M

D7S75

CRI-S17

H

D7S77

CRI-S20

M

D7S81

CRI-S52

T

D7S83

CRI-S60

M

D7S85

CRI-S72

M

D7S86

CRI-S83

M

D7S88

CRI-S102

Chromosome

T

7p Linkage

Allele size (kb)

Enzyme’

D7Sl

D7S21 D7S55

into

1

1 2 3 1 2 1 2 1 2 1 2 1 2 3 1 2 1 2 3 4

Const.

= = = = = = = = =

7.4 2.8 1.6 5.8 5.5 9.8 7.8 2.5 2.0 NA = 15.0 = 9.4 = 3.2 = 3.1 = 3.7

Al A2 A3 A4 A6 A7

= = = = = = = = = = = =

Bl B2 1 2 Al A2 Bl B2 B3

= = = = = = = = =

Al A2 Bl B2 1 2 3 Al A2 Bl B2 1 2 1 2 1 2 1 2 1 2 1 2 3

= = = = = = = = = = = = = = = = = = = = = = = =

8.8 5.2, 12.0 9.7 7.6 13.0 3.2, 6.3, 9.0 6.3, 9.0, 6.3, 2.1 6.0 3.3, 3.7 2.7, 8.2 8.0 1.8 1.2 1.8, 1.2 6.0 4.7 4.0 3.0 5.2 4.5 4.0 12.5 11.8 8.2 7.6 4.7 4.1 8.2 6.7 7.2 5.7 5.1 3.8 6.0 3.9, 3.8 3.0 3.3

4.3, 2.4, 1.7, 0.6 NA 5.5,

3.5 1.9 1.3,

2.7, 1.9, 1.5, 0.75 8.4,

2.2 1.7 0.85

2.2

4.2

3.7 4.0

2.1 4.0 2.1 6.3 3.2

5.0, 1.9 1.5

18, 8, 2, 1.4 0.9

3.0 2.2 1.0 0.7, 0.6

1.4 2.8, 2.6 1.8, 1.5 1.0 3.3

1.0

2.1 2.3, 1.9 1.3

Map

Freq

%*

HET (PIG)

IM

11 03 86 38 62 23 77 62 38 NA 89 11 31 57 12

25 (0.23)

96

46 (0.36) 33 (0.29) 47

245

NA 20 (0.18) 62 (0.49)

571 60

46 54 12 27 60 01 04 46 30 14 01 05

39 (0.37) 50 (0.55)

138

67 (0.61)

257

29 71 32 68 17 83 67 25 08

42 (0.33) 45 (0.34) 29 (0.40)

135

06 94 24 76 26 06 14 78 22 54 46 83 17 75 25 60 40 07 93 32 68 72 26 02

45 (0.65)

139

48 (0.51)

170

56 (0.57)

130

40 (0.28) 59 (0.36) 54 (0.37) 22 (0.18) 55 (0.36) 47 (0.33)

161

187 177

249

311

142 102

96 303 55 186 78

CHROMOSOME

TABLE Reg. lot.

Locus

Probe CRI-S127

D7S89

Enzyme’ H

M

D7S92

CRI-S139

T

CRI-S155

T

D7SlOO

CRI-S166

T

D7S102

CRI-S187

M

D7S103

CRI-S193

T

D7S105

CRI-S195

T

D7S108

CRI-S202

P

D7S109

CRI-S207

H

D7SllO

CRI-S224

T

D7S96

7~12’

D7S112

7p15.2-p21e

CRI-S244

T

D7S132

7p15.1-p15.3’

pTM60

T

D7S135

7pl5.1-pter’

pTM102L

T

D7S149

7pl5.1-pter’

pTS93

P

D7S150

7pl5.1-pter’

pTS194

T

D7S369

pADJ641

T

D7S370

pRM7.4

M

D7S371

pTHH28

M

D7S395

pHHH232

Pv

D7S435

Mfd20

PCR

pMGB7 A-64EGFR

Hae

D7Z2 EGFR

ceng 7p12-p13

fsh

P erbB GCK

l-Continued Allele size (kb) 1 2 3 1 2 3

= = = = = =

Al = 6.6 A2 Bl B2 B3 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 3 4 5 6

= = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =

1 2 1 2 1 2 1 2 1 2 3 4

= = = = = = = = = = = =

P PCR

Const.

19.0 11.0 6.0 6.8 1.5 4.0, 1.8 47

5.3, 1.3 4.6 3.6 5.4 9.3 5.0, 4.3 8.5 5.9 9.3 6.5 5.6 4.0, 1.6 13 11.5 9.7 6.8 9.6 6.4 8.6 6.5, 3.0 6.0 4.3, 1.5 5.3 5.0 12.0 8.5 4.4 4.2 1.8 1.5 2.0 1.0 5.5 2.3 3.4 2.3 7.5 4.2 134bp 132 bp 130 bp 128 bp 126bp 122 bp

NA H

329

7p MAP

2.6 1.7 10.0 8.0 10.0 8.0 8.0 7.0 199 195 197 201

2.1

8.4

1.7, 1.5

5.0 8.0

Freq %* 15 47 38 35 26 39 53 (0.64) 21 76 03 83 17 51 49 78 22 63 37 60 40 84 16 86 14 25 75 63 36 0.36 0.64 35 65 30 70 77 23 19 81 38 62 26 74 64 36 03 31 01 20 41 03

NA 01 99

bp bp bp bp

88 12 89 11 90 10 24 66 09 01

HET (PIC)

IM

61 (0.53)

80

67 (0.59)

288

69

185

28 (0.24) 54 (0.37) 40 (0.30) 59 (0.42) 63 (0.37) 31 (0.28) 25 (0.19) 38 (0.30) 58 (0.35) 46 (0.35) 56 (0.35) 32 (0.33) 45 (0.29) 32 (0.26) 44 (0.36) 38 (0.31) 46 (0.35) 69 (0.64)

70 357 140 342 243 203 68 104 329 193 250 98 214 149 152 73 123 365

102 2 (i.02) 21 (0.19) 19 (0.17) 19 (0.17) 50 (0.44)

70 133 59

307

330

MISHRA

TABLE Locus

Reg. lot.

Probe

ILG/INFBZ

7~21’

pBeta2.15

M

pSRV1

T

PSF/BAM

Pv

pSRV1 TCRG’

7p15’

ET

AL.

l-Continued

Enzyme”

Allele size (kb) 1 2 1 2 1 2 3

= = = = = = =

8.1 4.3 5.7 6.8 14.7 12.6 10.5

Con&.

Freq 47 53 42 58 26 53 19

%b

HET (PIG) 50 (0.37) 49 (0.37) 61 (0.52)

IM 306 235 270

Note. NA, Data not available, the polymorphism is a hypervariable minisatellite (LMS31) or alpha satellite (pMGB7) with a large number of alleles. Because fragment lengths are very close in size, it is difficult to make allele assignments correlated to fragment length, therefore allele frequencies, HET and PIC are not available. ’ Bg, BglII; E, EcoRI; H, HindIII; Hae, HaeIII; Hc, HincII; Hf, HinfI; M, MspI; P, PstI; Pv, PuuII; T, TaqI; X, XmnI. b Observed allele frequency in CEPH pedigrees. ’ IM, total number of informative meioses. For each family, IM is calculated as the number of CEPH children (sibs) who have information, multiplied by the number of parents heterozygous for the system. d In situ hybridization (Royle et al., 1988). e In situ hybridization (Donis-Keller et al., 1989). ‘Hybrid panel localization (Lathrop et al., 1989). 8 Hybrid panel localization (Waye et al., 1987). ’ In situ hybridization (Yang-Feng et al., 1984). ‘In situ hybridization and linkage (Bowcock et al., 1988). ’ In situ hybridization (Murre et al., 1985).

markers from the set of 47. When the odds for order was reduced to lOO:l, one additional marker (D7S92) was uniquely placed. Odds for order of 10,OOO:l resulted in a map with 15 markers uniquely placed (D7S108, D7S103, pSRV1, D7Sl1, D7S65 were no longer uniquely placed and D7S69 was inserted). One build order was selected and the order of the markers was again tested using the CRI-MAP “flips3” option, which successively permutes the order of sets of three markers along the map. No change in order was indicated from the flips3 analysis. The most likely order was then established for the remaining nonuniquely localized markers. The program chrompics, which displays the grandparental origin of marker alleles from the CEPH siblings, was used as a check on possible data errors (e.g., apparent double recombinants are flagged and are often indicative of genotyping or data entry errors) and following error corrections a final build analysis was performed.

viduals whose alleles had been sequenced were electrophoresed in lanes adjacent to those of individuals whose allele assignments had been previously assigned from direct genomic sequencing or from comparison to Ml3 sequencing ladders. Figure 1 shows an example of the inheritance of the polymorphism in CEPH pedigree K104 and reports a “reference genotype standard” that can be used to unambigously establish the size of alleles in previously untested individuals. Two-point linkage analysis calculations using the genotypic data from the dinucleotide repeat and our entire database conclusively confirmed unique localization to chromosome 7. Linkage with LODs in excess of 12 for several markers on chromosome 7p provided preliminary subregional localization. LODs for markers on all other chromosomes were strongly negative or, if positive, did not reach the threshold of statistical signifi-

Mapping the Glucokinase (GCK) Gene A (CA), dinucleotide repeat element was identified from genomic DNA immediately adjacent to the gene for human glucokinase, and chromosome 7 localization was indicated from PCR amplification of the repeat element and flanking sequence tested against a set of rodent/human somatic cell hybrids (Matsutani et al., 1992). Polymorphism was suggested from analysis of amplification products found to range in size from 195 to 199 bp in unrelated individuals (Matsutani et al., 1992). We determined that allelic variation resulted from inheritance at a single locus and identified a new allele in the CEPH pedigree resource (Z + 6 = 201 bp is found with CEPH grandparent K13293-12). To verify the accuracy of allele assignments, PCR-amplified genomic DNAs from indi-

FIG. 1. Reference genotypes demonstrating inheritance of the GCK dinucleotide repeat polymorphism in CEPH family K104. Three alleles (195, 197, and 199 nucleotides) are evident in this family and follow Mendelian segregation patterns. The PCR products were 5’end-labeled with 32P, fractionated on a DNA sequencing gel, and visualized by autoradiography (see Materials and Methods). The individuals are numbered according to the CEPH designation, and the respective genotypes are indicated beneath the gel lane. A DNA sequence ladder of bacteriophage Ml3 is indicated on the left and the adenosine at position 196 nucleotides is indicated.

CHROMOSOME

331

7p MAP

1

D7S21 D7S108

-

4.7

D7S89

6.C 2.2

-

D7SlO D7SlO3

‘t

pSRV1 D7S83




GCK 07357 D7S74

\

D7S59

IL6AFNB21 D75370

D7S77 D7S65 GCK

3.: I 2.L I _ 1

07857 07574 D7S59

D7S1501

;:;

I

2.4

D7S55

D7S66 I

I

I D7S58 D7SlO9

D7Sl32 D7S691

1 4.7

D7S921

D7SllO D7S96 I

D7Z2

EGFR D7S81 D7S88 D7S371 D7SlO2 D7S395

7p Genetic Linkage Map

As Fig. 2 illustrates, the chromosome 7p genetic linkage map is composed of 47 loci (54 systems), 19 of which are uniquely localized with odds of at least 1OOO:l. Four genes (TCRG, EGFR, ILG/IFNB2, and GCK) have now been placed in the context of the genetic linkage map. The sex-average map spans a distance of 94.4 CM, the male-specific map is 73.2 CM, and the female-specific map is 116.1 CM. A statistically significant recombination frequency difference was observed for one interval along the map with female recombination in excess of male recombination. For this interval (D7SlO%D7S89, 51 jointly informative female meioses and 64 jointly informative male meioses) x2 = 16.97. The average marker

5.i

’ i:

12

94.4 CM

73.2 CM

cance (LOD 3.0), although a single marker on chromosome 1 (pHRnX3.6) gave a LOD of 2.89 by pairwise analysis with the dinucleotide marker. As shown in Fig. 2, by multipoint analysis the GCK gene maps within the interval defined by D7S65 and D7S57.

D7S112

D7SlO3 pSRV1

FIG. 2. Chromosome 7p genetic linkage maps. The maps were constructed from genotypic collection and the program package CRI-MAP. Female-specific, male-specific, and sex-average converted from recombination fraction to centimorgans using the Kosambi mapping function lengths are shown at the bottom of each map. Correlations of genetic markers to cytogenetic situ hybridization studies (see Table 1 for references).

The Chromosome

7.2

D7S751

D7S62 D7S435 D7S86

1 -

4.c 1

E1’

D7S103 pSAV1 D7S83

D7S369 D7Sll

-

-D7Sl08

112.6

D7S108 D7S89 D7SlO

1.t i 3.c I .TCRG 5.1 I

-D7S21

D7SlOO

5.c I

, -

I

5.2

D7S85

-

9.6 .

D7S21

12.1

20.6

-

Average

Sex-

Female

data collected using the CEPH reference pedigree maps are depicted with marker interval spacing (see Materials and Methods). Cumulative maps localizations are shown for markers placed by in

spacing of the sex-average map is 2.0 CM, and the largest interval in this map is 13.0 CM (D7S83-D7SlOO). The largest interval for all of the maps is 20.6 CM (D7S108D7S89, female map). The map presented here represents a combined and expanded dataset compared to previously published chromosome 7 maps. Genotypic data used to construct our previously published chromosome 7 map (Barker et aZ., 1987) have been considerably augmented by the incorporation of genotypes for 12 of these markers from the complete primary CEPH 40 family panel (the earlier map consisted of genotypes from 21 CEPH families) and from the inclusion of genotype data for 11 additional loci used to construct another chromosome 7 map (Lathrop et al., 1989) available from the CEPH collaborators database or retyped in our laboratory (genotypes for 19 of the 59 families submitted to the database (11 markers) by Lathrop et al. were not included in our study since none of the remaining markers in our study had been typed in these families). Genotypes for 4 markers pSRV1, ILG/IFNB2, D7S1, D7S17) not previously incor-

332

MISHRA

porated into genetic linkage maps were also available from the CEPH genotype database. In addition, genotypes from six families using the marker pMGB7 (D7Z2) were kindly made available to us by Dr. H. Willard. A second dinucleotide repeat marker, Mfd20 (D7S435), was genotyped and a new allele (130 bp) was found. Our map extends the 7p terminus considerably beyond that published by Lathrop et al. (1989) by the inclusion of 6 additional markers distal to D7S135, a distance of 32.5 CM (sex-average map). We converted the recombination fractions reported in Lathrop et al. (1989) to centimorgans using the Kosambi mapping function so that our map lengths could be compared. Overall our maps are roughly consistent with the two previously reported maps, considering distances spanned by shared markers. However, we observe a 1.5 times increased map length for females over males rather than the threefold difference reported by Lathrop et al. (1989). In addition, our female map is about 54% shorter and our male map twice as large as the map reported by Lathrop et al. (1989) for the intervals between shared terminal markers. The order of the 11 loci from 7p published by Lathrop et al. (1989) is in good agreement with the order we have independently determined which includes additional loci. Similarly, the order of loci we published previously (Barker et al., 1987) was found to be roughly the same in these analyses. Thirteen markers were uniquely ordered by Barker et al. and eight of these markers overlapped with our set of uniquely ordered markers; one additional marker (D7S92) was placed in the 1OO:l map of Barker et al. (1987) and our 1OO:l map (not shown). Correlations to Cytogenetic L4xuZizutions The genetic map can be correlated to chromosome structure landmarks and to cytogenetic localizations because a number of these markers have associated polymorphisms. For example, a centromere-specific sequence pMGB7(D7Z2) reveals a hypervariable polymorphic region useful as a genetic marker (Waye et al., 1987; Spence et al., 1988). While the small number of informative meioses available from D7Z2 did not allow unique localization of this marker within the genetic linkage map, its physical characteristics and in situ hybridization data confirm that it derives from the centromere. Therefore, D7Z2 serves as an anchor for this region on our map. A number of markers near the centromere could not be ordered with respect to each other, and the possibility remains that some of them may be located on the proximal q arm of chromosome 7. For example, EGFR has been depicted as originating from 7p12-p13 (Lathrop et uZ., 1989); however, other published data indicate a broader subregional assignment (7p13-7q11.2) (Yang-Feng et al., 1984). Our current map does not allow us to distinguish unambiguously the location of EGFR with respect to the centromere marker. The 7p terminal marker from our genetic linkage map, D7S21, has been mapped by in situ hybridization to 7~22, the most distal

ET AL.

cytogenetic band, although it is not known where this marker lies with respect to the physical end of the chromosome (Royle et al., 1988; Armour et al., 1989). Because TCRG, a marker immediately distal to D7S65, has been cytogenetically localized to 7~15 (Murre et uZ., 1985), the glucokinase gene can be placed within this region or somewhat proximal to it. As Table 1 indicates, 8 additional markers, or a total of 11 markers from the genetic map, have also been cytogenetically localized by in situ or hybrid panel analysis. Figure 2 shows subregional assignments for markers localized by in situ hybridization. DISCUSSION We have constructed a new genetic linkage map for chromosome 7 that is composed of 47 markers spaced at ~-CM average intervals. Our new chromosome 7p map includes the most distal 7p marker cytogenetically localized (D7S21), which is more than 30 CM distal to the terminus of the Lathrop et al. (1989) map, extends our previously published map by 5 CM at the p terminus (Donis-Keller et uZ., 1987), and also includes, for the first time, a genetically mapped centromere marker (D7Z2). We therefore believe that our genetic map spans most of the physical length of the short arm of chromosome 7. Nonetheless, the telomere has not yet been cloned, and connection to the true physical end of this chromosome is yet to be accomplished. Also, due to the limited number of jointly informative meioses for markers in the centromere region, the order and spacing of these markers remain somewhat ambiguous. Additional genotyping of the centromere marker should help clarify the position of the centromere with respect to other nearby genetic markers. Comparisons of overall genetic distance for sex-specific and sex-average maps are somewhat at variance with the previously reported map of Lathrop and colleagues; for example, they reported more than threefold increased recombination in females compared to males, while we observe about 1.5 times recombination in females compared to males. The reason for this difference is not apparent, although it may be due to increased coverage of the chromosome with our map both in terms of numbers of markers and new regions mapped. Overall, we do not observe dramatically increased male recombination for any intervals including the regions near the end of the chromosome and note that female recombination is about 1.5 times that for males for most intervals (except for one case for which female recombination is significantly greater than that for males). This observation is in marked contrast to several reports for other chromosomes. For example, Nakamura et al. (1989) reported a significant increase in male over female recombination for the 14q terminal region of chromosome 14 and a similar finding for the 19p terminal region (Nakamura et al., 1988). However, Dracopoli et al. (1991) found no regions of significant excess male recombination for all intervals along a map for chromosome 1 consisting of 58 continuously linked markers, although earlier reports had indicated rare in-

CHROMOSOME

tervals of excess male recombination. The significance of these differences is not clear at this time and will perhaps be clarified as the maps become more saturated with markers, as extensive error checking protocols are instituted, and as precise correlations to physical maps become possible. Two SSRP markers, both consisting of (CA), repeat elements, have been incorporated into the 7p linkage map. They are separated by an interval of about 25 CM (sex-average map) and are located well within the interior of the short arm of the chromosome. Evidence from this mapping study and linkage analysis using dinucleotide markers from chromosomes 8,11,14, and 7qter indicates that such markers extend across the entire lengths of the chromosomes (unpublished data), suggesting that SSRPs may be extremely useful as randomly distributed genetic and physical markers. One drawback of such markers is the presence of additional bands on DNA sequencing gels, even when a single end-labeled primer is used in the PCR reaction. The additional bands are attributed to “slippage” during the PCR reaction (Litt and Luty, 1989; Petersen et al., 1990) and they did not seriously affect our ability to score the genotypes in this study. The slippage phenomenon appears to be more severe for some repeat elements (unpublished observations), and it may also be restricted to dinucleotide markers as others have not encountered the problem with tetranucleotide repeats (Edwards et al., 1991a,b), although we have noted secondary bands for tri- and tetranucleotide repeats that, nonetheless, do not present genotyping problems due to the 3- and 4-bp spacing between alleles. Continued efforts to identify additional SSRPs and integrate them into the “baseline” map described in this report should enable relatively rapid construction of a 1-CM genetic linkage map. Markers with heterozygosities in excess of 70% would prove most efficient since comparatively small family resources (i.e., 40 CEPH type pedigrees) would be needed and there is evidence that a sufficient number of highly informative SSRPs can be found for this purpose. SSRPs also double as STSs and can be used conveniently to screen YAC libraries. We have successfully used the PCR assays described in this work for Mfd20 and GCK to identify YACs in a total human genomic library to serve as nuclei for contig assembly (unpublished). Since library screening by Southern hybridization is considerably more labor intensive, screening grids of YACs already identified from random STSs should prove more efficient for physical mapping purposes. As physical mapping studies gain momentum, the map reported here should be of use for placing overlapping sets of clones (contigs) along its length, and at later stages of contig assembly, a higherresolution genetic linkage map should provide a means to orient contigs and identify possible gaps in the map. Likewise, markers that cannot be ordered genetically may well be resolved by physical mapping studies. This interplay between physical and genetic maps may prove crucial to the overall efforts to map and sequence the

333

7p MAP

human genome as well as to benefit disease gene localization studies. ACKNOWLEDGMENTS The authors thank Mr. Christopher Tierney and Ms. Rose Veile for genotyping and cell culture assistance. We also thank Dr. Huntington Willard for contribution of genotypic data for the centromere marker D7Z2. This work was supported in part by Grant DK16746 (M.A.P.) from the NIH and NIH Grants HG00304 and HG00201 (H.D-K.). Genotypic data reported in this work will be deposited in the CEPH database and, in addition, is freely available upon request. REFERENCES ARMOUR, J. A. L., WONG, Z., WILSON, V., ROYLE, N. J., AND JEFFREYS, A. L. (1989). Sequences flanking the repeat arrays of human minisatellites: association with tandem and dispersed repeat elements. Nucleic Acids Res. 17: 4925. BARILLOT, E., DAUSSET, J., AND COHEN, D. (1991). Theoretical analysis of a physical mapping strategy using random single-copy landmarks. Proc. Natl. Acad. Sci. USA 88: 3917-3921. BARKER, D., GREEN, P., KNOWLTON, R., SCHUMM, J., LANDER, E., OLIPHANT, A., WILLARD, H., AKOTS, G., BROWN, V., GRAVIUS, T., HELMS, C., NELSON, C., PARKER, C., REDIKER, K., RISING, M., WATT, D., WEIFFENBACH, B., AND DONIS-KELLER, H. (1987). Genetic linkage map of human chromosome 7 with 63 DNA markers. Proc. Natl. Acad. Sci. USA 84: 8006-8010. BOTSTEIN, D., WHITE, R. W., SKOLNICK, M., AND DAVIS, R. W. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 32: 314331. BOWCOCK, A. M., KIDD, J. R., LATHROP, G. M., DANESHVAR, L., MAY, L. T., RAY, A., SEHGAL, P. B., KIDD, K. K., AND CAVALLI-SFORZA, L. L. (1988). The human “interferon-&/hepatocyte stimulating factor/interleukin-6” gene: DNA polymorphism studies and localization to chromosome 7~21. Genomics 3: 8-16. DONIS-KELLER, H., GREEN, P., HELMS, C., CARTINHOUR, S., WEIFFENBACH, B., STEPHENS, K., KEITH, T. P., BOWDEN, D. W., SMITH, D. R., LANDER, E. S., BOTSTEIN, D., AKOTS, G., REDIKER, K. S., GRAVIUS, T., BROWN, V. A., RISING, M. B., PARKER, C., POWERS, J. A., WA?T, D. E., KAUFFMAN, E. R., BRICKER, A., PHIPPS, P., MULLER-KAHLE, H., FULTON, T. R., NG, S., SCHUMM, J. W., BRAMAN, J. C., KNOWLTON, R. G., BARKER, D. F., CROOKS, S. M., LINCOLN, S. E., DALY, M. J., AND ABRAHAMSON, J. (1987). A genetic linkage map of the human genome. Cell 51: 319-337. DONIS-KELLER, H., HELMS, C., GREEN, P., RIETHMAN, H., RAMACHANDRA, S., FALLS, K., BOWDEN, D. W., WEIFFENBACH, B., KEITH, T., STEPHENS, K., CANNIZZARO, L. A., SHOWS, T. B., STEWART, G. D., AND VAN KEUREN, M. (1989). A human genome linkage map with more than 500 RFLP loci and average marker spacing of 6 centiMorgans. Cytogenet. Cell Genet. 51: 991. DRACOPOLI, N. C., O’CONNELL, P., ELSNER, T. I., LALOUEL, J-M., WHITE, R. L., BUETOW, K. H., NISHIMURA, D. Y., MURRAY, J. C., HELMS, C., MISHRA, S. K., DONIS-KELLER, H., HALL, J. J., LEE, M. K., KING, M-C., ATTWOOD, J., MORTON, N. E., ROBSON, E. G., MAHTANI, M., WILLARD, H. F., ROYLE, N. J., PATEL, I., JEFFRJXYS,A. J., VERGA, V., JENKINS, T., WEBER, J. L., MITCHELL, A. L., AND BALE, A. (1991). The CEPH consortium linkage map of human chromosome 1. Genomics 9: 686-700. EDWARDS, A., CIVITELLO, A., HAMMOND, H. A., AND CASKEY, C. T. (1991a). DNA typing and genetic mapping with trimeric and tetramerit tandem repeats. Am. J. Hum. Genet. 49: 746-756. EDWARDS, A., HAMMOND, H. A., ZOGHBI, H. Y., CASKEY, C. T., AND CHAKRABORTY, R. (1991b). Population genetics of trimeric and tetrameric tandem repeats in four human ethnic groups. Gerwmics, in press.

334

MISHRA

GREEN, E., AND OLSON, M. (1990). Chromosomal region fibrosis gene in yeast artificial chromosomes: A model genome mapping. Science 250: 94-98. HALL, J. M., LEE, M. K., NEWMAN, B., MORROW, J. E., L. A., HUEY, B., AND KING, M-C. (1990). Linkage of familial breast cancer to chromosome 17q21. Science 1689.

of the cystic for human ANDERSON, early-onset 250: 1684-

JARCHO, J. A., MCKENNA, W., PARE, P., SOLOMON, S. D., HOLCOMBE, R. F., DICKIE, S., LEVI, T., DONIS-KELLER, H., SEIDMAN, J. G., AND SEIDMAN, C. E. (1989). Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14ql. N. Engl. J. Med. 321: 13721378. KERN, S. E., FEARON, E., TERSME~, K. W. F., ENTERLINE, J. P., LEPPERT, M., NAKAMIJRA, Y., WHITE, R., VOGELSTEIN, B., AND HAMILTON, S. R. (1989). Allelic loss in colorectal cancer. J. Am. Med. Assoc. 261: 3099-3103. LANDER, E. S., AND GREEN, P. (1987). Construction of multilocus genetic linkage maps in humans. Proc. Natl. Acad. Sci. USA 84: 2363-

2367. LATHROP, G. M., O’CONNELL, P., LEPPERT, M., NAKAMURA, Y., FARRALL, M., TSUI, L-C., LALOUEL, J-M., AND WHITE, R. (1989). Twenty-five loci form a continuous linkage map of markers for human chromosome 7. Genomics 5: 866-873. LITT, M., AND LUTY, J. A. (1989). A hypervariable vealed by in vitro amplification of a dinucleotide cardiac muscle actin gene. Am. J. Hum. Genet.

microsatellite repeat within 44: 397-401.

rethe

ET

AL.

PETERSEN, M. B., ECONOMOU, E. P., SLAUGENHAUPT, S. A., CHAKRAVARTI, A., AND ANTONARAKIS, S. E. (1990). Linkage analysis of the human HMG14 gene on chromosome 21 using a GT dinucleotide repeat as polymorphic marker. Genomics 7: 136-138. RICHARDS, B., HORN, G. T., MERRILL, J. J., AND KLINGER, K. W. (1991). Characterization and rapid analysis of the highly polymorphic VNTR locus D4S125 (YNZ32), closely linked to the Huntington disease gene. Genomics 9: 235-240. ROYLE, N. J., CLARKSON, R. E., WONG, Z., AND JEFFREYS, A. L. (1988). Clustering of hypervariable minisatellites in the proterminal regions of human autosomes. Genomics 3: 352-360. SAMBROOK, J., FRITSCH, E. F., AND MANIATIS, T. (1989). “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. SPENCE, E., PERCIACCANTE, R. G., GREIG, G. M., WILLARD, H. F., LEDBETTER, D. H., HEJTMANCIK, F., POLLACK, M. S., O’BRIEN, W. E., AND BEAUDET, A. L. (1988). Uniparental disomy as a mechanism for human genetic disease. Am. J. Hum. Genet. 42: 217-226. TANIGAWA, G., JARCHO, J. A., KASS, S., SOLOMON, S. D., VOSBERG, H-P., SEIDMAN, J. G., AND SEIDMAN, C. E. (1990). A molecular basis for familial hypertrophic cardiomyopathy: An a/P cardiac myosin heavy chain hybrid gene. Cell 62: 991-998. VOGELSTEIN, B., FEARON, E., HAMILTON, S. R., KERN, S. E., PREISINGER, A. C., LEPPERT, M., NAKAMURA, Y., WHITE, R., SMITS, A. M. M., ANJJ BOS, J. L. (1988). Genetic alterations during colorectal-tumor development. N. Engl. J. Med. 319: 525-532.

MACLENNAN, D. H., DUFF, C., ZORZATO, F., FUJII, J., PHILLIPS, M., KORNELUK, R. G., FRODIS, W., BRA, B. A., AND WORTON, R. G. (1990). Ryanodine receptor gene is a candidate for predisposition to malignant hyperthermia. Nature 343: 559-561.

WAYE, J. S., ENGLAND, S. B., AND WILLARD, H. F. (1987). Genomic organization of alpha satellite DNA on human chromosome 7: Evidence for two distinct alphoid domains on a single chromosome. Mol. Cell. Biol. 7: 349-356.

MATSUTANI, A., JANSSEN, R., DONIS-KELLER, H., AND PERMUTT, M. A. (1992). A polymorphic (CA), repeat element maps to the human glucokinase gene (GCK) to chromosome 7p. Genomics 12: 319-

WEBER, J. L., AND MAY, P. E. (1989). Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44: 388-396.

325. MCCARTHY, T., SANDRA HEALY, J. M., HEFFRON, J. J. A., LEHANE, M., DEUFEL, T., LEHMANN-HORN, F., FARRALL, M., AND JOHNSON, K. (1990). Localization of the malignant hyperthermia susceptibility locus to human chromosome 19q12-13.2. Nature 343: 562-564. MURRE, C., WALDMANN, R. A., MORTON, C. C., BONCIOVANNI, K. F., WALDMANN, T. A., SHOWS, T. B., AND SEIDMAN, J. G. (1985). Human gamma-chain genes are rearranged in leukaemic T cells and map to the short arm of chromosome 7. Nature 316: 549-552. NAKAMURA, Y., LATHROP, M., O’CONNELL, P., LEPPERT, M., LALOUEL, J-M., AND WHITE, R. (1988). A primary map of ten DNA markers and two serological markers for human chromosome 19. Genomics 3: 67-71. NAKAMURA, Y., LATHROP, M., O’CONNELL, P., LEPPERT, M., KAMBOH, M. I., LALOUEL, J-M., AND WHITE, R. (1989). Frequent recombination is observed in the distal end of the long arm of chromosome 14. Genomics 4: 76-81. OLSON, M., HOOD, L., CANTOR, C., AND BOTSTEIN, D. (1989). mon language for physical mapping of the human genome. 245: 1434-1435.

A comScience

WEBER, J. L., KWITEK, A. E., AND MAY, P. E. (1990). Dinucleotide repeat polymorphisms at the D7S435 and D7S440 loci. Nucleic Acids Res. 18: 4039. WEBER, J. L. (1990). Informativeness of human (dC-dA); (dG-dT), polymorphisms. Genomics 7: 524-530. WHITE, R., LALOUEL, J-M., LATHROP, M., LEPPERT, M., NAKAMURA, Y., AND O’CONNELL, P. (1990a). Human genetic linkage maps. In “Genetic Maps” (S. J. O’Brien, Ed.), 5th ed., pp. 5.134-5.157, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. WHITE, R. L., LALOUEL, J-M., NAKAMURA, Y., DONIS-KELLER, H., GREEN, P., BOWDEN, D. W., MATHEW, C. G. P., EASTON, D. F., ROBSON, E. B., MORTON, N. E., GUSELLA, J. F., HAINES, J. L., ETIEF, A. E., KIDD, K. K., MURRAY, J. C., LATHROP, G. M., AND CANN, H. M. (1990b). The CEPH consortium primary linkage map of human chromosome 10. Genomics 6: 393-412. YANG-FENG, T. L., SCHECHTER, A. L., WEINBERG, R. A., AND FRANCKE, U. (1984). Oncogene from rat neuro/glioblastomas (human gene symbol NGL) is located on the proximal long arm of human chromosome 17 and EGFR is confirmed at 7p13-q11.2. Cytogenet. Cell Genet. 40: 784.