Cell, Vol. 70, 539-551,

August 21, 1992, Copyright

0 1992 by Cell Press

A cDNA That Suppresses MPP+ Toxicity Encodes a Vesicular Amine Transporter Yongjian Liu,* Doris Peter,‘t Ali Roghani,’ Shimon Schuldiner,* Gilbert G. Prive,§ David Eisenberg,§ Nicholas Brecha,ll# and Robert H. Edwards’ l Department of Neurology tDepartment of Microbiology and Immunology §Department of Chemistry and Biochemistry 1lDepartment.s of Anatomy and Cell Biology and Medicine Molecular Biology Institute University of California, Los Angeles School of Medicine Los Angeles, California 90024-1769 *The Institute of Life Sciences Hebrew University 91904 Jerusalem Israel #Veterans Administration Medical Center West Los Angeles, California 90073

Summary Classical neurotransmitters are transported into synaptic vesicles so that their release can be regulated by neural activity. In addition, the vesicular transport of biogenic amines modulates susceptibility to N-methyl4-phenylpyridinium (MPP+), the active metabolite of the neurotoxin N-methyl-1,2,3,6-tetrahydropyridine that produces a model of Parkinson’s disease. Taking advantage of selection in MPP’, we have used gene transfer followed by plasmid rescue to identify a cDNA clone that encodes a vesicular amine transporter. The sequence predicts a novel mammalian protein with 12 transmembrane domains and homology to a class of bacterial drug resistance transporters. We have detected messenger RNA transcripts for this transporter only in the adrenal gland. Monoamine cell populations in the brain stem express a distinct but highly related protein. Introduction Synaptic transmission involves the control of neurotransmitter release by neural activity and the interaction of synaptic transmitter with a postsynaptic receptor to transduce the physiological signal. Two distinct transport activities participate in synaptic transmission by classical neurotransmitters such as the biogenic amines, y-aminobutyric acid, glycine, and glutamate. One activity occurs at the plasma membrane and serves to terminate the action of the neurotransmitter by uptake into the presynaptic neuron (Kanner and Schuldiner, 1987). This activity operates by the cotransport of Na+ and, in the case of the amines, is the site of inhibition by cocaine and tricyclic antidepressants (Axelrod, 1961; Iversen, 1976). Another distinct transport activity occurs in the synaptic vesicle of the pre-

synaptic neuron and transports cytoplasmic transmitter into the vesicle. Classical neurotransmitters differ from neural peptides in the way that they enter the regulated secretory pathway. Neural peptides sort to this pathway after translocation into the endoplasmic reticulum (De Camilli and Jahn, 1990; Trimble et al., 1991; Kelly, 1991). In contrast, classical transmitters accumulate in the cytoplasm after both synthesis and reuptake from the synapse. Thus, storage in vesicles requires transport from the cytoplasm, and vesicular transport has been observed for several classical transmitters, including acetylcholine (Anderson et al., 1982), the amines (Carlsson et al., 1963; Kirshner, 1962; Johnson, 1988), glutamate (Naito and Ueda, 1983; Maycox et al., 1988; Carlson et al., 1989) y-aminobutyric acid (Fykse and Fonnum, 1988; Hell et al., 1988; Kish et al., 1989), and glycine (Christensen, 1990; Burger et al., 1991). This activity uses the electrochemical gradient generated by a vesicular H+-ATPase to drive transport (Rudnick, 1986; Forgac, 1989). In the case of amines, this involves the exchange of a lumenal proton for the cytoplasmic amine (Kanner and Schuldiner, 1987; Johnson, 1988). Vesicular transport is inhibited by drugs such as reserpine (for the amines) (Carlsson et al., 1963; Johnson, 1988) and vesamicol (for acetylcholine) (Anderson et al., 1983) that are distinct from agents that act on plasma membrane transport. In addition to the differences in biological function, mechanism, and pharmacology, considerably more is known about plasma membrane transport than about vesicular neurotransmitter transport at a molecular level. The structures of plasma membrane transporters for y-aminobutyric acid, norepinephrine, dopamine, and serotonin have recently been elucidated by molecular cloning and found to define a family of closely related proteins with 12 transmembrane domains (Guastella et al., 1990; Pacholczyk et al., 1991; Shimada et al., 1991; Kilty et al., 1991; Hoffman et al., 1991; Blakely et al., 1991; Giros et al., 1991). On the other hand, the molecular basis of neurotransmitter transport into synaptic vesicles, a process required for the processing of information by a wide diversity of neural systems, has eluded identification. To isolate the cDNA clone for a vesicular transporter of amines, we have now used the strategy of selection in the neurotoxin N-methyl-4-phenylpyridinium (MPP’). Systemic administration of N-methyl-l ,2,3,6-tetrahydropyridine (MPTP) causes the death of dopaminergic neurons in the substantia nigra and clinical Parkinsonism (Langston et al., 1983). Since MPTP produces a syndrome with remarkable pathological and clinical similarity to Parkinson’s disease (PD), it has served as a model system to study the pathogenesis of the idiopathic disorder. After penetration into the brain, MPTP is metabolized to MPP’ by monoamine oxidase (Langston et al., 1984; Markey et al., 1984; Heikkila et al., 1964). Dopaminergic neurons in the midbrain then accumulate MPP’ by uptake through a plasma membrane catecholamine transporter (Javitch et

Cdl 540

al., 1985). Inside the cell, MPP+ acts by inhibiting respiration, probably at the level of complex I in the respiratory chain (Ramsay and Singer, 1986; Krueger et al., 1990; Ramsay et al., 1991). The elucidation of the MPTP model has helped to identify several pathogenetic elements involved in idiopathic PD. MPTP affects oxidative phosphorylation, and mitochondrial defects have been found in the idiopathicdisorder(Mizunoet al., 1989; Parkeret al., 1989; Ozawa et al., 1990; Shoffner et al., 1991). Inhibition of monoamine oxidase prevents MPTP toxicity, and the monoamine oxidase inhibitor deprenyl slows progression of idiopathic PD (Parkinson Study Group, 1989). However, certain features of MPTP toxicity have not been adequately explained. Although the plasma membrane uptake of toxin accounts for much of the selective cell vulnerability, adrenal chromaffin cells express a plasma membrane transporter for amines that also recognizes MPP’, but these cells show little susceptibility to the toxin (Johannessen et al., 1985; Reinhard et al., 1987). Idiopathic PD also spares this aminergic popuiation, suggesting that the same feature that protects it from MPP’ may protect it in PD as well. Rat pheochromocytoma PC12 cells have been used as a model cell line to study MPP+ toxicity, but they show toxicity only at extremely high concentrations of MPP+ (Snyder et al., 1988; Denton and Howard, 1987), thus resembling the chromaffin cells from which they derive (Greene and Rein, 1978). To our surprise, Chinese hamster ovary (CHO) fibroblasts, which lack a plasma membrane amine transporter, show more sensitivity to MPP’ than PC12 cells (Liu et al., 1992). Thus, we have used CHO cells as a sensitive host in which to identify the basis of PC12 cells and, hence, presumably adrenal chromaffin cell resistance to the toxin. Following the transfer of a cDNA expression library from PC12 cells into CHO cells, selection of the stable transformants in 1 mM MPP+ has yielded a clone extremely resistant to the toxin. Reserpine reverses this resistance, suggesting that uptake into an intracellular compartment by a vesicular amine transporter sequesters the toxin from mitochondria and so protectsthecell (Liuet al., 1992). Indeed, thechromaffin granule amine transporter (CGAT) has been reported to recognize MPP+ (Daniels and Reinhard, 1988). We have now used the resistant cells to isolate a cDNA clone encoding vesicular amine transport.

rescue procedure has two potential problems. One is that the cDNA responsible for resistance to MPP’ may have integrated in such a way as to preclude rescue. A second is that even if it is rescued, the resulting plasmid may contain a rearranged fragment of the original cDNA that is not capable of expression on retransfer. However, pools of rescued plasmids were retransfected into CHO cells, again selected in MPP+, and whereas the plasmid vector as control did not give rise to resistant cells, several pools of rescued plasmids did confer resistance. In contrast with selection of the primary transformant that required 4 weeks to isolate a resistant cell clone (Liu et al., 1992) selection of the secondary transformants required only 2-3 weeks. The pool conferring the highest frequency of resistance to MPP+ contained three independent cDNA clones. When transfected individually, only one of these (mpp”“) conferred drug resistance, and this selection required l-2 weeks (Figure 1). The ability of reserpine to reverse MPP+ resistance suggests that a vesicular amine transporter is responsible for the resistance. However, it is not possible to detect adifference in the uptake of radiolabeled amine between the transformant and wild-type CHO cells or between the transformant with or without reserpine. This may result from the absence in CHO cells of high affinity plasma membrane uptake activity, which does not allow the entry of low concentrations of labeled transmitter. (Neuronal populations in which amine uptake has usually been studied contain both a plasma membrane and vesicular amine transporter.) To circumvent this problem, we have devised an assay in which the cells are loaded first in high concentrations of dopamine. At 1 mM dopamine, the amine enters the cells by low affinity, nonspecific systems. The distribu-

Results Plasmid Rescue of Resistance to MPP+ and Vesicular Amine Transport To identify the sequences responsible for resistance to MPP+, we have taken advantage of the origin of the transferred sequences from a cDNA library. Rather than retransfect all of the genomic DNA from the primary transformant, as would be required with the use of genomic DNA for the primary transfection, we have simply digested genomic DNA from the primary transformant with an enzyme that cuts once within the plasmid vector CDM8 (Seed and Aruffo, 1987), religated the mixture, and transformed it at high efficiency into bacteria (Dower et al., 1988). This

Figure 1. Identification MPP’

of a cDNA Clone That Confers Resistance

to

Selection of CHO cells in MPP’ after transfection with cDNA clone mpp (left).and CDM8 vector alone (right). Following selection for stable transformants in the neomycin analog 6418, the cells surviving 2 weeks of selection in 1 m M MPP’ were stained with 0.1% Coomassie blue-R, 10% acetic acid, 50% methanol. Only cells transfected with the mpp” cDNA gave rise to healthy colonies, whereas the cells remaining after transfection with other rescued cDNAs and the vector alone showed the refractile cytoplasmic inclusions characteristic of MPP’ toxicity.

Vesicular NeurotransmitterTransport 541

28s

18s

Figure 2. Expressionof RNA Transcripts for the Rescuedmpp” Sequences in PC12, Wild-Type,and MPP+-ResistantCHO Cells Ten milligrams of total RNA separated by electrophoresisthrough 1.5% formaldehyde-agarosewas blottedto nitrocellulose,hybridized in 50% formamideto an mpp”” insert radiolabeledby randompriming, washed, and exposedto film overnight. PC12 cells express low levels of a 3.0 kb transcript, whereas wild-typeCHO cells express no crosshybridizingspecies and the primary CHO transformantexpressesextremely high levels. The positionsof 18s and 28s ribosomalRNA are shown on the right.

tion of intracellular dopamine is then determined by glyoxylic acid-induced fluorescence (de la Torre, 1980). By this assay, wild-type CHO cells show diffuse cytoplasmic staining (Liu et al., 1992). In contrast, the MPP+-resistant sec-

ondary transformant shows strong perinuclear and particulate cytoplasmic staining, and reserpine entirely reverses the localized pattern of dopamine-loaded fluorescence (data not shown). The persistently low frequency and late appearance of resistant colonies raise the possibility that an additional factor may be required to express this mechanism of resistance to MPP+. If another factor were limiting the expression of resistance, the transferred sequences need not be expressed at unusually high levels. However, Figure 2 shows that whereas wild-type CHO cells express none of these sequences, the resistant cells express over 20 times more than the PC12 cells that served as the source for the cDNA library. Thus, the low frequency of resistant colonies presumably results from the extraordinarily high levels of mpp”” expression that are required to confer drug resistance. To address the additional possibility that selection in MPP’ may be required to express functional vesicular amine transport, we have also cotransfected the mpp” cDNA with the selectable marker Rous sarcoma virus (RSV)-neo. As determined by dopamine-loaded fluorescence, selection in the neomycin analog G418 yields a high proportion of stable transformants expressing easily detectable vesicular transport activity qualitatively similar to that observed after selection in MPP+ (Figure 3). Thus, the expression of mpp”” alone suffices to confer vesicular amine transport, even in a nonneuronal cell. Mechanism, Specificity, and Pharmacology To determine whether the properties of the protein encoded bythempp”ScDNAcorrespondwith thoseexpected for the CGAT, we have tested the effect of various pharmacologic agents. Although reserpine has a variety of nonspecific interactions at high concentration, we have found that as lowas 50 nM, reserpine inhibits vesicular dopamine uptake completely in the fluorescence assay. This supports a more specific interaction with the vesicular amine transport activity previously described in chromaffin granules (Scherman and Henry, 1984). However, we have

Cell 542

Figure 4. Amine branes .a i?! e =

5

4

-

r ‘; 8 B

3

9 h

2

wp

res

-

mpp res + CCCP

-

wt

-

wt +CCCP

2s 1 zE n 0 0

10

30

20

40

minutes

Transport

into CHO

Mem-

(A) Membranes from the mpp”’ transformant accumulate significantly more [JH]dopamine than wild-type (wt) CHO cells. The proton ionophore carbonyl cyanide m-chlorophenylhydrazone (CCCP) at aconcentration of 5 nM inhibits this specific transport activity. (B) Lineweaver-Burk plot of dopamine transport indicates a Ku of 2.3 pM. (C) Dose-response analysis of the inhibition of dopamine transport by reserpine, tetrabenazine, and cocaine. Incubation of the membranes with 13H]dopamine was carried out for 2 min at 29% (B and C). The measurements of transport to determine K., K,, and the dose response were performed in duplicate, and the data presented as the mean (with standard deviation shown in

ICI).

0

1

2

C

4

3

l/[dopamine]

5

(l/uM)

120 1

I

reserpine tetrabenazine cocaine

0 .OOOl

,001

.Ol

.I

[inhibitor],

1

10

100

1000

uM

also developed a quantitative assay of vesicular amine transport. We have measured the uptake of [3H]dopamine into homogenates prepared from wild-type cells and mpp”” transformants (Figure 4A). Membranes from rnpp transformants accumulate substantially more [3H]dopamine than those from wild-type cells. Similar to previous studies of chromaffin granule transport, disruption of the vesicular pH gradient with a proton ionophore inhibits transport into membranes from the mppns transformants (Figure 4A) (Johnson, 1988). Using uptake into the membranes, we have also determined the affinity for different substrates. The Ku for dopamine transport is 2.3 PM, and the Ki for

inhibition of dopamine uptake by serotonin is 0.6 ELM,values slightly lower than reported for transport into chromaffin granules but with the same relative affinity (Figure 48) (Johnson, 1988). The transfected transport activity differsfrom the activity in bovine chromaffin granules by having a relatively higher affinity for epinephrine than fordopamine, with a rank order for affinity of serotonin > epinephrine > dopamine > norepinephrine. Using the membranes, reserpine inhibits transport with an I& of -25 nM (Figure 4C), well within the range of previously reported values, even though the assay was performed without preincubation in the inhibitor and even though reserpine is known to bind slowly at low concentrations

‘gk$ular

Neurotransmitter

Transport

(Weaver and Dupree, 1982; Scherman and Henry, 1984; Rudnick et al., 1990). Tetrabenazine, the other principal known inhibitor of vesicular amine transport, inhibits transport into the CHO membranes with an I& of -4 PM (Figure 4C), in good agreement with prior reports from similar crude membrane preparations, although more recent studies using osmotically lysed chromaffin ghosts indicate a greater potency (Carlsson et al., 1963; Darchen et al., 1989). Cocaine, which inhibits plasma membrane amine transport, has little effect on the transport activity conferred by the mpp”” cDNA. In summary, the dependence on a proton electrochemical gradient, the relative affinity for different amine substrates, and the pharmacology all indicate that the cloned sequences encode a vesicular transporter of amines.

Predicted Structure and Homology to Bacterial Drug Resistance Transporters The cDNA conferring both resistance to MPP’ and vesicular amine transport contains a 2.5 kb insert. Sequence analysis shows a single large open reading frame with the first ATG at its start, in a context that conforms to the consensus for translation initiation (Figure 5a) (Kozak, 1986). The predicted protein of 521 aa shows no strong homology to known proteins and contains no apparent signal peptide, but it does show extensive hydrophobic domains suggestive of a membrane protein. In particular, analysis by the method of hydrophobic moments predicts 12 transmembrane domains (Eisenberg et al., 1984). This is a structure characteristic of other known transport proteins, further supporting the identity of the encoded protein as a transporter (Calamia and Manoil, 1990; Kaback et al., 1990). The largest hydrophilic loop occurs between membrane domains 1 and 2 and contains three potential sites for N-linked glycosylation. Thus, the model in Figure 5b shows this loop facing the lumen of the vesicle, with the other loops disposed accordingly, and both N- and C-termini in the cytoplasm. Protein kinase C phosphorylation consensus sequences occur in the cytoplasmic domains flanking the large lumenal loop, at residues Ser-19 and Thr-158, and a protein kinase A site occurs at Ser-421. Although the cloned transporter does not show strong homology with other known transport proteins, it does show weak but definite homology with a class of bacterial transporters (Figure 5~). These include the tetracycline resistance genes from TnlO and pBR322, the bacterial multidrug resistance transporter, and, more remotely, a methylenomycin resistance gene (Nguyen et al., 1983; Neal and Chater, 1987; Neyfakh et al., 1991). The alignment occurs almost exclusively in the N-terminal half of these transporters, with conserved residues in both transmembrane helices and intermembrane loops but not in the cytoplasmic N-terminus or large lumenal loop between transmembrane domains 1 and 2. Neither these conserved residues nor the nonconserved regions in the large lumenal loop or C-terminal half of the protein occur in the plasma membrane transporters for amines and other transmitters that have been characterized previously (Guastella et al., 1990; Pacholczyk et al., 1991; Shimada et

al., 1991; Kilty et al., 1991; Hoffman et al., 1991; Blakely et al., 1991; Giros et al., 1991). identification of the Vesicular Amine Transporter from the Central Nervous System Since vesicles from both the brain and peripheral tissues take up amines (Scherman, 1986) we have determined the distribution of messenger RNA (mRNA) for the cloned sequences. As expected, the adrenal gland, but no other peripheral tissue, expresses mRNA transcripts for the cloned transporter. However, despite the use of poly(A) RNA for maximal sensitivity, we have not detected transcripts in the central nervous system (Figure 6A). The level of expression of the cloned sequences is fairly low even in the adrenal gland, where chromaffin cells constitute a large proportion of the cells, and it may be difficult to detect mRNA transcripts in tissues, such as the midbrain, where dopaminergic neurons constitute only a small fraction of all the cells present. On the other hand, it is also possible that the reserpine-sensitive vesicular amine transporter from the brain is encoded by a different gene. To address the possibility that central aminergic populations express a synaptic vesicle amine transporter (SVAT) that is distinct from the CGAT, we have searched for sequences related to CGAT that are expressed in the brain. Screening of a rat brain stem cDNA library under moderately reduced stringency has yielded a number of positive clones. Alignment of the sequences from several independent cDNAs shows that they overlap and encode a single protein with 12 transmembrane domains that is closely related to CGAT (Figure 7). Extensive sequence divergence occurs principally in the large lumenal loop located between the first two transmembrane domains of both proteins and, to a lesser extent, at the N- and C-termini. Consensus sequences for phosphorylation by protein kinase C are conserved in the regions flanking the large lumenal loop, as are the Asn at +155 and the protein kinase A site at Ser417. However, additional protein kinase C sites occur at Ser-280 and Ser-326 and in a protein kinase A site at Thr-497. The tissue distribution of RNA transcripts for the brain stem cDNA clone suggests that it also encodes avesicular amine transporter. Northern blots show expression of an - 4 kb transcript in the midbrain, pons, and medulla, but not in the adrenal gland or other peripheral tissues (see Figure 6B). Further, in situ hybridization shows localization of the transcripts to dopaminergic cell populations in the substantia nigra and ventral tegmental area, to noradrenergic populations in the locus coeruleus, nucleus tractus solitarius, and A2 and A5 cell groups, and to serotonergic populations in the raphe (Hokfelt et al., 1984) (Figure 8). Thus, we have termed this transporter the synaptic vesicle amine transporter (SVAT), in contrast with the chromaffin granule amine transporter (CGAT).

Discussion The method that we have used to isolate a functional cDNA has several advantages over other methods of cloning

Cell 544

Figure 5. Sequence

and Predicted

Structure

of the CGAT

(a) The nucleotide sequence of cDNA clone mpp* determined from both strands. The deduced amino acid sequence is shown below. Transmembrane domains predicted by the method of Eisenberg et al. (1994) are underlined. Potential sites for N-linked glycosylation are indicated by an asterisk beneath. (b) Predicted structure of the chromaffin granule catecholamine transporter. The lumen of the granule is above, and cytoplasm is below. Basic and acidic residues are represented by a plus and a minus, respectively, with N-linked carbohydrates in the first lumenal loop indicated by the branched structure. The shading indicates the extent of homology between CGATand SVAT, with black used for identical residues and stippling for conservative changes. (c) Homology to bacterial drug resistance transporters. Alignment of the N-terminal domains of the methylenomycin’n* (Mmr), tetracycline’” (Tet pBR and Tet TnlO), and bacterial multidrug resistance (BMR) transporters with the vesicular catecholamine transporter (VCT, or CGAT), using profilebased methods (Gribskov et al., 1987; Devereux et al., 1994). Residues are capitalized if 3 of 5 residues at a position are similar, and they are shown below as a consensus sequence. The regions in brackets indicate the predicted transmembrane helices.

Vesicular 545

Neurotransmitter

Figure 6. Differential

Transport

Expression

-

28s

-

16s

of CGAT and SVAT mRNAs

(A) Ten milligrams of poly(A)+ RNA per tissue was separated by electrophoresis through formaldehyde-agarose, blotted to nylon, hybridized in aqueous solution under high stringency to the radiolabeled CGAT cDNA insert, and exposed to film with an enhancing screen for 11 days at -70°C. The 3 kb transcript appears only in the adrenal gland and PC12 cells. No signal is detectable from the dissected brain regions or a cell line (CSM) derived from the dopaminergic neurons of the midbrain. (B) The same Northern blot hybridized with the radiolabeled SVAT cDNA shows a 4 kb transcript in the brain stem, but not in more rostra1 brain regions or the adrenal gland. The CSM cells contain a slightly shorter band hybridizing to this probe. The positions of ribosomal RNA are shown to the right.

by functional expression. With classical methods of gene transfer using genomic DNA, the invariable presence of many genes in each primary transformant requires retransfection to identify the individual genes responsible for expression. However, it can be difficult to distinguish the donor from host sequences on retransfer. In addition, the large genomic fragments usually require considerable characterization before they can finally be used to isolate a functional cDNA. The use of a cDNA library in a plasmid expression vector circumvents these difficulties by permitting the rapid rescue of integrated cDNAs. Although this method has potential problems related to the efficiency of rescue and the possibility of rearrangement, we have found the procedure to yield functional clones on each of several different occasions (R. H. E., unpublished data).

In addition, the number of cDNA clones that need to be tested individually is usually quite small. Since the method involves stable transformants that can be used to produce replicas, it also has certain advantages over functional cloning in transient systems, since the assay can be extended to cells killed by the assay procedure or fixation. The replica can then be used to rescue the cDNA responsible for the observed activity. The data indicate that the mpp”” cDNA encodes a functional vesicular amine transporter. This cDNA alone confers the ability to sequester dopamine (and presumably MPP’) within an intracellular compartment. Using a direct assay of transport, we have demonstrated the expected dependence on an electrochemical gradient that is presumably generated by a vesicular ATPase. The affinity for several ligands slightly exceeds values previously reported for chromaffin granules, but the purified transporter has also been reported to show increased affinity (SternBach et al., 1990). In addition, the transfected activity shows the anticipated relative affinity for serotonin, dopamine, and norepinephrine. The affinity for epinephrine differs from that reported using bovine chromaffin granules, possibly as a result of species differences, expression of the activity in a fibroblast, or features of the membrane preparation. On the other hand, since dopamine and epinephrine (rather than norepinephrine) are the principal substrates for transport, the higher affinity for these amines may have physiologic relevance, and epinephrine preferentially accumulates in chromaffin granules (Johnson, 1988). The cloned transport activity has the pharmacologic properties expected for chromaffin granule transport, with inhibition by both reserpine and tetrabenazine. Even without preincubation in the inhibitor, the transport activity shows the expected sensitivity to reserpine. Tetrabenazine is somewhat less potent but is still within the range previously reported for crude chromaffin granule preparations (Carlsson et al., 1963). The observed variation in sensitivity to tetrabenazine may reflect the apparent existence of two conformations for the chromaffin granule transporter that bind exclusively to either reserpine or tetrabenazine (Darchen et al., 1989). The activity differs from plasma membrane amine transporters in showing no dependence on external Na+ (the assay is performed in 0.32 M sucrose) and no inhibition by cocaine. Thus, functional analysis of the activity encoded by the rescued cDNA shows that it confers vesicular amine transport. The sequence of the rescued cDNA predicts a protein with 12 transmembrane domains, further supporting its role as a transport protein (Calamia and Manoil, 1990; Kaback et al., 1990). Purification of the transporter labeled with [3H]reserpine and assayed by functional reconstitution in liposomes has suggested a molecular size of 80 kd (Stern-Bach et al., 1990; Vincent and Near, 1991; lsambert et al., 1992). Consistent with these findings, the sequence of the isolated cDNA predicts a protein of at least 65 kd, with three potential sites for N-linked glycosylation. Both the cloned chromaffin granule and presumed SVATs show several clear structural differences from the family of Na+dependent plasma membrane transporters. First, a large hydrophilic loop occurs between transmembrane domains

Cdl 546

60

Figure 7. Nucleotide and Predicted Acid Sequence of the SVAT

CAGAGCAGAGCCATGGCCCTAGCGATCTGGTGCTGCTGCCCGC MetAlaLeuSerAspLeuValLeuLeuArgTrpLeuArgAspSerArg

119 17

CACTCGCGCAAACTGATCCTTTCATCGTGTTCCTTGCGcATGCTG HisSerArgLys~eLeuPheIleValP~

179 37

CTCACCGTCGTGGTTCCCATCATCCCCAGCTATCTGTACAGCATT~GCATGAG~~C LeuThrValValValProIleIleProSerTyrLeu~rSerIleLysHisGluLysAsn

239 57

TCTACGGAAATCCAGACCACCAGACCAGAGCTCGTGGTCTCATCTTC SerThrGluIleGlnThrThrArgProGluLeuValValSerThrSerGluSerIlePhe

293 77

419 117

TCTTACTATAACAACTCTACTGn;TTGATCACCGGGAATCACCTGCCAC~GGACTCTTCCAGGA SerTyr~rAsnAsnSerThrValLeuIleThrGlyAsnAlaThrGlyThrLeuProGly * * GGGCAGTCACACAAGGCTACCAGCACACAGCACACTGTGGCACCACTGTCCCTTCG GlyGlnSerHisLysAlaThrSerThrGlnHisThrValAlaAsnThrThrValProSer * GACTGTCCCAGTGAAGACAGAGACCTTCTGAATGAGAATGTTT AspCysProSerGluAspArgAspLeuLeuAsnGluAsnValGlnValGlvLeuLeuPhe

479 137

GCCTCCAAAGCCACTGTCCAGCTCCTCACTAACCCCATTCATA~ACTTCTGACC~CAGA AlaSerL s *LeuLeuThrAsnArg

539 157

ATTGGCTATCCAATTCCCATGTTTTGCCGGCATCATTATG IleGlyTyrPro~eCvsIle~~ValMet

599 177

TTTGCCTTCTCCAGCAGCTATGCCTTCCTTCCTGCCAGC PheAlaPheSerSerSerTyrAlaPheLeuLeuIleAlaArgSerLeuGlnGlvIleGlv

659 197

TCCTCCTGCTCATCCGTGGCTGGGATGGGTATGCTGGTA~C~GCCAGCGTGTACACAGATGATGAG SerSerCvsSerSerValAlaGlvMetGlvMetLeuAlaSerValTyrThrAspAspGlu

719 217

GAGAGGGGGAAGCCCATGGGCATTGCTTTGGGTGGCCTGGCCT~CCA~GGAGTCTTAGT~GA GluArgGlyLys~roMetGlvIl~euGlvGlvLe~tGlvValLeuValG~

779 237

CCCCCCTTCGGGAGTGTGCTCTAn;AGTTTGTTTGTGG~~GACAGCTCCCTTCCTGGTGCTA ~ ProProPheGlvSerValLeuTyrGluPheValGlyLysThrA

839 257

GCTGCCTTGGTGCTCTTGGATGGGGCTATTCAGCTATTCAGCTCTTTG~CTCCAGCCGTCCCGAGTA @aAlaLeuV 7ProSerArgVal

899 277

CAGCCAGAGAGTCAGAAGGGGACACCTCTAACGACCTTGCGATCCATACATCCTC GlnProGluSerGlnLysGlyThrProLeuThrThrLeuLeuLysAsp~o~rIleLeu

359 97

*

959 297 1019 317

CCCATCTGGATGATGGAGACCATGTGTTCCCGAAAGTGGCCGTTGCTTTCCTC ProIleTrpMetMetGluThrMetCysSerArgLysTrpGlnLeuGlvValAlaPheLeu

1079 337

CCGGCGAGCATCTCTTATCTCATTGGAACCAATATTTTTTGGGATACTTGCACAC~TG eGlvTpHisLysMet

1139 357 1199 377 1259 397 1319 417 1379 437 1439 457 1499 477

AAGGAGGAAAAAATGGCTATCCTCATGGACCACAACTGTCTAC LysGluGluLysMetAlaIleLeuMetAspHlsAsnCysProIl~LySThrLysMet~r

1559 497

ThrGlnAsnAsnValGlnSer?LrProTleGlyAspAspG***

1619

GACCCTCTAACGTCGCCC

ACTCAG~TAATGTCCAGTCATATCCCATCGGTGATGATG~G~TCTG~AGTGACTGA

Amino

The CGAT cDNA was used as a probe to screen a rat brain stem cDNA library under moderately reduced stringency. All of the clones overlapped with each other to yield a single sequence with considerable homology to CGAT (see Figure 68 for the shared residues).

Vesicular 547

Neurotransmitter

Figure 8. Expression Brain Stem

Transport

of SVAT mRNA by Aminergic

Populations

in the

Transverse sections of the rat brain stem were hybridized with the 35S-labeled antisense SVAT RNA probe. Hybridizing cell populations appear in the substantia nigra (SN), ventral tegmental area (VTA), locus coeruleus (LC), nucleus raphe pallidus (nrp), nucleus tractus solitarius (nts), dorsal motor nucleus X, and regions Al and A5. Adjacent sections incubated with a sense SVAT RNA probe did not show any hybridization.

1 and 2, whereas the large loop in the plasma membrane transporters of amines, as well as other neurotransmitters, occurs between membrane-spanning domains 3 and 4 (Guastella et al., 1990; Pacholczyk et al., 1991; Shimada et al., 1991; Kiltyet al., 1991; Hoffman et al., 1991; Blakely etal., 1991;Girosetal., 1991). Second, boththeintermembrane loops and the hydrophilic N- and C-termini are in general smallerthan those in the plasma membrane transporters. Nonetheless, the overall structural homology to membrane transporters remains striking. In addition to the common structure of 12 transmembrane domains, the largest intermembrane loop in both classes of transporter is predicted to reside in the lumenal, or extracellular, space, yet the transporters function in opposite directions relative to the cytoplasm and have distinct mechanisms, one involving cotransport of a cation and the other involving proton exchange. The extremely high level of transporter mRNA expressed by the primary transformant may reflect the stringency of selection in MPP+. Selection with the toxin presumably requires very high levels of transport activity to reduce substantially the cytoplasmic concentration of MPP+ and thereby prevent mitochondrial injury. Alterna-

tively, the high levels of expression may indicate reduced function in a heterologous cell type. However, stable cell lines made by cotransformation with a standard marker that does not specifically select for high levels of expression also exhibit the particulate pattern of dopamineloaded fluorescence. Thus, avesicular transporter for neurotransmitters can function in a heterologous cell type in the absence of synaptic vesicles. In light of the known dependence of vesicular amine transport on a pH gradient, the strong perinuclear and scattered punctate cytoplasmic staining suggests that the transferred uptake occurs into acidic compartments, such as the Golgi complex, lysosomes, and late endosomes (Rudnick, 1986; Forgac, 1989). The remote sequence similarity to a class of bacterial drug resistance transporters is of particular interest because it appears to reflect a striking similarity in function. First, both the bacterial proteins and the vesicular transporters mediate the efflux of toxic compounds (MPP+ or antibiotics) from the cell interior. Second, both act by exchanging a proton for the transported molecule (Kaneko et al., 1985). Third, the vesicular system transports indoleamines as well as catecholamines, and the bacterial multidrug resistance transporter also transports a variety of molecules with relatively low specificity (Carlsson et al., 1963; Neyfakh et al., 1991). Fourth, reserpine inhibits the bacterial multidrug resistance transporter as well as the vesicular amine transporter (Neyfakh et al., 1991). Since the region of homology between the amine transporter and the bacterial transporters occurs within the N-terminal half of the protein, this domain may account for such common features as orientation in the membrane, mechanism, or drug response. Interestingly, although mutagenesis of Asp-66 to Asn in the TnlO tetracycline transporter eliminates transport activity, the chromaffin granule transporter has an Asn at the equivalent position (+159) in the small loop between transmembrane domains 2 and 3 (Figure 7) (Yamaguchi et al., 1990). Since this residue is predicted to occur on the cytoplasmic face of the protein, the result suggests that this domain may be involved in a relatively specific feature of transport function, such as substrate recognition. The identification of remote homology to bacterial transporters indicates that the cloned sequences define a novel class of mammalian transport protein. Additional members of this class may well transport other classical neurotransmitters such as acetylcholine, y-aminobutyric acid, glutamate, and glycine into synaptic vesicles. The identification of two distinct vesicular amine transporters suggests that subtypes may exist for other vesicular transporters. Further, the differential expression of vesicular amine transporters may account for the selective vulnerability of dopaminergic neurons in the substantia nigra. The method by which the cDNA was isolated has implications for the MPTP model of PD. Although studied in a fibroblast cell line, the ability of CGAT sequences to protect against MPP’ toxicity suggests that increased vesicular transport may protect adrenal chromaffin cells from the effects of systemic MPTP administration. The expression of distinct transporters by the relatively MPTP-resistant

Cdl 548

adrenal gland and the MPTP-sensitive dopaminergic midbrain cells raises the possibility that differences in vesicular transport underlie the selective vulnerability of the central neurons. With the cDNA clones available, it is now possible to explore this hypothesis directly. The ability of vesicular amine transport to reduce susceptibility to MPP+ also has relevance for idiopathic PD. Although an exogenous toxin similar to MPTP has not been identified in the idiopathic disorder (Tanner and Langston, 1990) it has been proposed that the endogenous transmitter dopamine itself induces oxidative stress (Rosenberg, 1988; Cohen, 1990; Michel and Hefti, 1990). The vesicular amine transporter would certainly regulate the cytoplasmic concentration of dopamine as well as MPP’ and thereby influence its susceptibility to oxidation. With increasing age, even a slight reduction in vesicular transport would increase the cytoplasmic pool of dopamine, leading to increased free radical generation and cellular damage. Thus, vesicular transport can also be expected to limit vulnerability to the putative endogenous toxin. In addition, pharmacologic evidence suggests a role for vesicular amine transport in psychiatric disease. A variety of psychoactive drugs interact with vesicular amine transport. Reserpine induces a clinical syndrome characterized by lethargy, and this observation originally gave rise to the amine hypothesis of depression (Frize, 1954). Amphetamines and other psychostimulants disturb vesicular amine storage, either by reducing intracellular pH gradients or by exchanging with the vesicular pool of endogenous amines through the transporter (Sulzer and Rayport, 1990; Rudnick and Wall, 1992). These observations suggest that the regulation of amine transport into synaptic vesicles could play a role in idiopathic affective disorders, either through maintaining the abnormal state or by increasing the likelihood that a perturbation will induce the abnormal state. Indeed, the presence of additional sites for phosphorylation by protein kinase A and protein kinase C on the brain transporter compared with the chromaffin granule protein suggests more complex regulation that may contribute to behavioral abnormalities. The availability of a cDNA clone for a vesicular amine transporter provides the means to explore these hypotheses. It also provides the first molecular information about a transport activity required forthe processing of information by a wide range of neural systems. Experimental

Procedures

Plasmid Rescue The primary MPP+-resistant CHO transformant was amplified, and, following cell lysis in 5 M guanidinium isothiocyanate, the high molecular weight DNA was prepared by repeated precipitation in isopropranol. After digestion with Notl, which cleaves the CDM6 vector once downstream of the cDNA insertion site as well as at rare 8 nt recognition sites elsewhere in the genome (Seed and Aruffo, 1987) the DNA was religated and transformed into Escherichia coli by electroporation (Dower et al., 1988). Four pools of the derived plasmids containing approximately 50 colonies each were transfected into CHO cells and, after 2 days, selected in 1 m M MPP. Four weeks later, one pool gave rise to several MPP+-resistant colonies, two pools gave rise to one or two colonies, and the fourth pool and CDM8 vector gave rise to no healthy, resistant colonies. Restriction enzyme analysis of the plasmids in the pool conferring the highest frequency of resistance to MPP’

indicated three independent clones of 1.0, 1.3, and 2.5 kb. These plasmids were then transfected individually into CHO cells, which were again selected in 1 m M MPP’. After 2.5 weeks, only cells transfected with the 2.5 kb cDNA (mpp”) contained healthy CHO cells growing at a normal rate. However, even these transfectants contained relatively few colonies resistant to MPP’. To increase the proportion of colonies capable of drug resistance, we also cotransfected CHO cells with the selectable marker RSV-neo and selected stable transformants, first in the neomycin analog G418 (400 nglml) for 1 week and then in 1 m M MPP+ for 2 weeks. Dopamlne-Loaded Fluorescence Cells on polylysine-coated glass coverslips were grown in 1 m M dopamine for 24 hr, washed three times in 0.1 M sodium phosphate (pH 7.4) and incubated at 4OC in 2% (w/v) glyoxylic acid, 0.0005% (w/v) MgCI, (pH 4.9-5.0) for 3 min (de la Torre, 1980). The coverslips were then drained thoroughly, dried in air at 45“C, heated to 80°C for 5 min, and examined under mineral oil by fluorescence at 400 x magnification (Knigge et al., 1977). Uptake of [3H]Dopamine into Membranes rnpp transformants and wild-type CHO cells were homogenized at 0.01 m m clearance in cold 0.32 M sucrose and 10 m M HEPES-KOH (pH 7.4) (SH buffer) containing 5 m M magnesium-EGTA, 1 pg/ml leupeptin, and 0.2 m M diisopropylfluorophosphate, and the cell debris was removed by centrifugation at 3500 x g for 5 min. Protein (loo150 pg) from this low speed supernatant was then added to 200 trl of SH buffer containing 4 m M KCI, 4 m M MgSO,, 5 m M ATP, 44 nM PH]dopamine, and the compounds indicated, incubation performed at 29OC, the assay terminated by dilution in cold assay buffer followed by filtration through 0.2 pm Supor 200 membranes (Gelman), and the bound radioactivity measured. The K, for inhibition of dopamine uptake was determined using increasing concentrations of serotonin, norepinephrine. and epinephrine. RNA and Sequence Analysis RNA was prepared by disruption of the tissue in 8 M guanidinium isothiocyanate followed by centrifugation through cesium chloride (Chirgwin et al., 1979). Poly(A)t RNA was isolated by chromatography overoligo(dT)-cellulose (Avivand Leder, 1972). For Northern analysis, 10 pg of total or poly(A)’ RNA was separated by electrophoresis through 2.2 M formaldehyde and 1.5% agarose and blotted to nylon (Hybond, Amersham). For hybridization in formamide, the filters were prehybridized in 50% formamide, 5x SSC (1 x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5 x Denhardt’s solution, 0.5% sodium dodecyl sulfate (SDS), 200 uglml salmon sperm DNA for 4 hr at 42OC; hybridized in the same solution with the mpp” insert labeled by random priming (Feinberg and Vogelstein, 1983) at 42OC for 16 hr; washed twice in 2 x SSC, 0.1% SDS for 30 min at room temperature, in 1 x SSC, 0.1% SDS for 1 hr at 50°C, and in 0.1 x SSC, 0.1% SDS for 1 hr at 50°C; and submitted to autoradiography with an intensifying screen. For aqueous hybridization, 0.5 M NaP04 (pH 7.2) 1% bovine serum albumin, 1 m M EDTA, 7% SDS, 100 pglml denatured salmon sperm DNA were used for both prehybridization and hybridization at 68OC, and the washes were carried out in 40 m M NaP04 (pH 7.2) 0.5% bovine serum albumin, 5% SDS, 1 m M EDTA twice for 1 hr at 68OC, followed by 40 m M NaP04 (pH 7.2) 1% SDS, 1 m M EDTA twice for 1 hr at 68’C (Boulton et al., 1991). Sequence analysis was carried out on both strands using the chain termination method and Sequenase (US Biochemical) (Sanger et al., 1977). Library Screening Approximately lo6 plaques from a lgtl0 rat brain stem cDNA library (Clontech) were screened on duplicate nylon filters (Biotrans, ICN Pharmaceuticals) with the CGAT probe labeled by random priming (Feinberg and Vogelstein, 1983) using the aqueous hybridization procedure described above (Boulton et al., 1991) at 60°C, with washes at 55°C. Positive plaques were purified through two additional rounds of screening, subcloned into pBluescript (Stratagene), and sequenced by the chain termination method as above.

Vesicular 549

Neurotransmitter

Transport

In Situ Hybridization The in situ hybridization procedure is described in detail in an earlier publication (Sternini et al., 1989). In brief, the animals were anesthetized with nembutal and perfused with 4% paraformaldehyde in phosphate-buffered saline. The brain was then dissected, postfixed for an additional 2 hr, cryoprotected with 25% sucrose in 4% paraformaldehyde-phosphate-buffered saline, and sectioned in a transverse plane at 30 pm. The sections were then washed in 0.75 mglml glycine, digested in 1 pglml proteinase K, 50 m M Tris (pH 8) 5 m M EDTA for 30 min at 37OC, and then treated with 0.25% acetic anhydride, 0.1 M triethanolamine (pH 8) for IO min at room temperature. Strand-specific RNA probes were prepared from the SVAT cDNA subcloned into pBluescript (Stratagene) using T7 RNA polymerase (Promega) (Cox et al., 1984). After prehybridization in 50% formamide, 0.75 M NaCI, 25 m M EDTA, 25 m M PIPES buffer (pH 6.8) 1 x Denhardt’s solution, 0.2% SDS, 25 m M dithiothreitol, 250 pg/ml denatured salmon sperm DNA, 250 uglml poly-r(A) for more than 1 hr at 37OC, the sections were hybridized overnight at !Z#‘C in the same solution containing 5% dextran sulfate and 0.1 ng/ul probe. The sections were washed in 4 x SSC and 50 m M 8-mercaptoethanol, treated with 50 ug/ml RNAase A for 30 min at 37OC, and washed in 2 x SSC, then in 0.1 x SSC at 65”C, and finally in 0.1 x SSC at room temperature overnight. The sections were mounted on gelatin-coated slides and exposed to autoradiographic film (Kodak) for 4 days.

topology and sequence elements promoting Proc. Natl. Acad. Sci. USA 87, 4937-4941.

membrane

insertion.

Carlson, M. D., Kish, P. E., and Ueda, T. (1989). Characterization of the solubilized and reconstituted ATP-dependent vesicular glutamate uptake system. J. Biol. Chem. 264, 7369-7376. Carlsson, A., Hillarp, N.-A., and Waldeck, B. (1963). Analysis of the Mg”-ATP-dependent storage mechanism in the amine granules of the adrenal medulla. Acta Physiol. Stand. (Suppl.) 275, 1-38. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 78, 5294-5299. Christensen, H., Fykse, E. M., and Fonnum, F. (1990). Uptake of glytine into synaptic vesicles isolated from rat spinal cord. J. Neurochem. 54, 1142-I 147. Cohen, G. (1990). Monoamine oxidase and oxidative stress at dopaminergic synapses. J. Neural Transm. (Suppl.) 32, 229-238. Cox, K. H., DeLeon, D. V., Angerer, L. M., and Angerer, R. C. (1984). Detection of mANAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev. Biol. 707, 485-502. Daniels, A. J., and Reinhard, J. F. (1988). Energy-driven uptake of the neurotoxin I-methyl-4-phenylpyridinium into chromaffin granules via the catecholamine transporter. J. Biol. Chem. 283, 5034-5038. Darchen, F., Scherman, E., and Henry, J. P. (1989). Reserpine binding to chromaffin granules suggests the existence of two conformations of the monoamine transporter. Biochemistry 28, 1692-1697.

Acknowledgments We thank S. Mah and C. Weigmann for technical assistance, K. Mogahddami for help preparing the manuscript, and Drs. H. Ft. Kaback, D. Bredesen, 6. Howard, A. Cho, J. Barchas, C. Evans, D. Freedman, and E. Neufeld for their thoughtful discussion. We particularly wish to thank Dr. R. C. Collins for his support. This work was funded by the National Science Foundation, the March of Dimes, the Alzheimer Foundation, the Veterans Administration Medical Research Funds, and the National Institutesof Health. G. G. P. isafellow of the American Cancer Society, California Division. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received June 22, 1992; revised July 8, 1992

De Camilli, P., and Jahn, R. (1990). Pathways to regulated exocytosis in neurons. Annu. Rev. Physiol. 52, 625-845. de la Torre, J. C. (1980). An improved approach to histofluorescence using the SPG method for tissue monoamines. J. Neurosci. Meth. 3, l-5. Denton, T., and Howard, B. D. (1987). A dopaminergic cell line variant resistant to the neurotoxin 1-methyl-4-phenyl-1,2,3,8-tetrahydropyridine. J. Neurochem. 49, 622-830. Devereux, J., Haberli, P., and Smithies, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 72, 387-395. Dower, W. J., Miller, J. F.. and Ragsdale, C. W. (1988). High efficiency transformation of E. co/i by high voltage electroporation. Nucl. Acids Res. 76, 8127-6145.

References

Eisenberg, D., Schwarz, E., Komaromy, M., and Wall, R. (1984).Analy sis of membrane and surface protein sequences with the hydrophobic moment plot. J. Mol. Biol. 779, 125-142.

Anderson, D. C., King, S. C., and Parsons, S. M. (1982). Proton gradient linkage to active uptake of 3H-acetylcholine by Torpedo electric organ synaptic vesicles. Biochemistry 21, 3037-3043.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 732, 6-13.

Anderson, D. C., King, S. C., and Parsons, S. M. (1983). Pharmacological characterization of the acetylcholine transport system in purified Torpedo electric organ synaptic vesicles. Mol. Pharmacol. 24,48-54.

Forgac, M. (1989). Structure and function of vacuolar driven proton pumps. Physiol. Rev. 69, 765-796.

Aviv, H., and Leder, P. (1972). Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69, 1408-1412. Axelrod, J., Whitby, L., and Hertting, G. (1961). Effect of psychotropic drugs on the uptake of JH-norepinephrine by tissues. Science 733, 383-384. Blakely, R. D., Berson, H. E., Fremeau, R. T., Jr., Caron, M. G., Peek, M. M., Prince, H. K., and Bradley, C. C. (1991). Cloning and expression of a functional serotonin transporter from rat brain. Nature 354, 66-70. Boulton, T. G., Nye, S. H., Robbins, D. J., Ip, N. Y., Radziejewska, E., Morgenbesser, S. D., DePinho, R. A., Panayotatos, N., Cobb, M. H., and Yancopoulos, G. D. (1991). ERKs: a family of protein-serinelthreonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF. Cell 65, 663-675.

class of ATP-

Frize, E. D. (1954). Mental depression in hypertensive patients treated for long periods with high doses of reserpine. N. Engl. J. Med. 257, 1008-l 008. Fykse, E. M., and Fonnum, F. (1988). Uptake of r-aminobutyric acid by a synaptic vesicle fraction isolated from rat brain. J. Neurochem. 50, 1237-l 242. Giros, B., el Mestikawy, S., Bertrand, L., and Caron, M. G. (1991). Cloning and functional characterization of a cocaine-sensitive dopamine transporter. FEBS Lett. 295, 149-154. Greene, L. A., and Rein, G. (1978). Release, storage and uptake of catechotamines by a clonal cell line of nerve growth factor (NGF) responsive pheochromocytoma cells. Brain Res. 729, 247-263. Grtbskov, M., McLachlan, A. D., and Eisenberg, D. (1987). Profile analysis: detection of distantly related proteins. Proc. Natl. Acad. Sci. USA 84,4355-4358.

Burger, P. M., Hell, J., Mehl, E., Krasel, C., Lottspeich, F., and Jahn, R. (1991). GABA and glycine in synaptic vesicles: storage and transport characteristics. Neuron 7, 287-293.

Guastetta, J., Nelson, N., Nelson, H., Czyzyk, L., Keynan, S., Miedel, M. C., Davidson, N., Lester, H. A., and Kanner, B. I. (1990). Cloning and expression of a rat brain GABA transporter. Science 249, 13031306.

Calamia, J., and Manoil, C. (1990). Lac permease of Escherichia

Heikkita, R. E., Manzino, L., Cabbat, F. S., and Duvoisin, R. C. (1984).

co/i:

Protection against the dopaminergic neurotoxicity of l-methyl-4 phenyl-1,2,5,6-tetrahydropyridine by monoamine oxidase inhibitors. Nature 317, 467-469.

Liu, Y., Roghani, A., and Edwards, R. H. (1992). Gene transfer of a reserpine-sensitive mechanism of resistance to MPP+. Proc. Natl. Acad. Sci. USA 89, in press.

Hell, J. W., Maycox, P. R., Stadler, H., and Jahn, Ft. (1966). Uptake of GABA by rat brain synaptic vesicles isolated by a new procedure. EMBO J. 7,3023-3029.

Markey, S., Johannessen, J., Chiueh, C., Burns, R., and Herkenham, M. (1984). lntraneuronal generation of a pyridinium metabolite may cause drug-induced Parkinsonism. Nature 37 7, 484-467.

Hoffman, B. J., Mezey, E., and Brownstein, M. J. (1991). Cloning of a serotonin transporter affected by antidepressants. Science 254,579560.

Maycox, P. R., Deckwerth, T., Hell, J. W., and Jahn, R. (1988). Glutamate uptake by brain synaptic vesicles: energy dependence of transport and functional reconstitution in proteoliposomes. J. Biol. Chem. 263, 15423-I 5428.

Hokfelt, T., Martensson, R., Bjorklund, A., Kleinau, S., and Goldstein, M. (1964). Distributional maps of tyrosine hydroxylase-immunoreactive neurons in the rat brain. In Handbook of Chemical Neuroanatomy, Vol. 2: Classical Transmitters in the CNS, Part I, A. Ejorklund and T. Hokfelt, eds. (Amsterdam: Elsevier Press), pp. 277-360.

Michel, P. P., and Hefti, F. (1990). Toxicity of 6-hydroxydopamine and dopamine for dopaminergic neurons in culture. J. Neurosci. Res. 26, 428-435.

Isambert, M.-F., Gasnier, B., Botton, D., and Henry, J.-P. (1992). Characterization and purification of the monoamine transporter of bovine chromaffin granules. Biochemistry 31, 1960-1966.

Mizuno, Y., Ohta, S., Tanaka, M., Takamiya, S., Suzuki, K., Sato, T., Oya, H., Ozawa, T., and Kagawa, T. (1989). Deficiencies in complex I subunits of the respiratory chain in Parkinson’s disease. Biochem. Biophys. Res. Commun. 763, 1450-1455.

Iversen, L. L. (1976). The uptake of biogenic amines. In Handbook of Psychopharmacology, Vol. 3, S. D. lversen and S. H. Snyder, eds. (New York: Plenum Publishing), pp. 361-442.

Naito, S., and Ueda, T. (1983). Adenosine uptake of glutamate into protein l-associated Chem. 258,696-899.

Javitch, J., D’Amato, R., Nye, J., and Javitch, J. (1965). Parkinsonisminducing neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine: uptake of the metabolite N-methyl-Qphenylpyridine by dopamine neurons explains selective toxicity. Proc. Natl. Acad. Sci. USA 82, 21732177.

Neal, R. J., and Chater, K. F. (1987). Nucleotide sequence analysis reveals similarities between proteins determining methylenomycin A resistance in streptomyces and tetracycline resistance in eubacteria. Gene 58, 229-241.

Johannessen, J. N., Chiueh, C. C., Burns, R. S., and Markey, S. P. (1965). Current concepts. IV. Differences in the metabolism of MPTP in the rodent and primate parallel differences in sensitivity to its neurotoxic effects. Life Sci. 36, 219-224. Johnson, R. G. (1988). Accumulation of biological amines intochromaffin granules: a model for hormone and neurotransmitter transport. Physiol. Rev. 68, 232-307.

triphosphate-dependent synaptic vesicles. J. Biol.

Neyfakh, A. A., Bidnenko, V. E., and Chen, L. B. (1991). Effluxmediated multidrug resistance in Bacillus w&i/is: similarities and dissimilarities with the mammalian system. Proc. Natl. Acad. Sci. USA 88, 4781-4785. Nguyen, T. T., Pestle, K.. and Bertrand, K. P. (1983). Sequence homology between the tetracycline-resistance determinants of TnlO and pBR322. Gene 25.83-92.

Kaback, H. R., Bibi, E., and Roepe, P. D. (1990). 8-galactoside transport in E. co/i: a functional dissection of lac permease. Trends Biochem. Sci. 75, 309-314.

Ozawa, T., Tanaka, M., Ikebe, S., Ohno, K., Kondo, T., and Mizuno, Y. (1990). Quantitative determination of deleted mitochondrial DNA relative to normal DNA in Parkinsonian striatum by a kinetic PCR analysis. Biochem. Biophys. Res. Commun. 172, 483-489.

Kaneko, M., Yamaguchi, A., and Sawai, T. (1985). Energetics of tetracycline efflux system encoded by TnlO in Escherichia co/i. FEBS Lett. 193, 194-198.

Pacholczyk, T., Blakely, R. D., and Amara, S. G. (1991). Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. Nature 350, 350-354.

Kanner, B. I., and Schuldiner, transport of neurotransmitters.

Parker, W. D., Boyson, S. J., and Parks, J. K. (1989). Abnormalities of the electron transport chain in idiopathic Parkinson’s disease. Ann. Neurol. 26, 719-723.

S. (1987). Mechanism of storage and CRC Crit. Rev. Biochem. 22, l-38.

Kelly, R. B. (1991). Secretory granule and synaptic vesicle formation. Curr. Opin. Cell Biol. 3, 654-660. Kilty, J. E., Lorang, D., and Amara, S. G. (1991). Cloning and expression of a cocaine-sensitive rat dopamine transporter. Science 254, 578-579. Kirshner, N. (1962). Uptakeof catecholamines by a particulate fraction of the adrenal medulla. J. Biol. Chem. 237, 231 l-2317. Kish, P. E., Fischer-Bovenkerk, C., and Ueda, T. (1989). Active transport of u-aminobutyric acid and glycine into synaptic vesicles. Proc. Natl. Acad. Sci. USA 86, 3877-3881. Knigge, K. M., Hoffman, G., Scott, D. E., and Sladek, J. R. (1977). Identification of catecholamine and luteinizing hormone-releasing hormone (LHRH)-containing neurons in primary cultures of dispersed cells of the basal hypothalamus. Brain Res. 726, 393-405. Kozak, M. (1986). Point mutationsdefine asequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292. Krueger, M. J., Singer, T. P., Casida, J. E., and Ramsay, R. R. (1990). Evidence that the blockade of mitochondrial respiration by the neurotoxin I-methyl+phenylpyridinium(MPP+)involves bindingatthesame site as the respiratory inhibitor, rotenone. Biochem. Biophys. Res. Commun. 769, 123-128. Langston, J. W., Ballard, P., Tetrud, J. W., and Irwin, I. (1983). Chronic Parkinsonism in humansdue toa product of meperidine analog synthesis. Science 279, 979-980. Langston, J. W., Irwin, I., Langston, E. G., and Forno, L. S. (1984). Pargyline prevents MPTP-induced Parkinsonism in primates. Science 225, 1480-1482.

Parkinson Study Group (1989). Effect of deprenyl on the progression of disability in early Parkinson’s disease. N. Engl. J. Med. 327, 13641371. Ramsay, R. R., and Singer, T. P. (1986). Energy-dependent uptake of N-methyl+phenylpyridinium, the neurotoxic metabolite of l-methyl4-phenyl-1,2,3,8-tetrahydropyridine, by mitochondria. J. Biol. Chem. 261 I 7585-7587. Ramsay, R. R., Krueger, M. J., Youngster, S. K., Gluck, M. R., Casida, J. E., and Singer, T. P. (1991). Interaction of l-methylll-phenylpyridinium (MPP’) and its analogs with the rotenone/piericidin binding site of NADH dehydrogenase. J. Neurochem. 56, 1184-I 190. Reinhard, J. F., Jr., Diliberto, E. J., Jr., Viveros, 0. H., and Daniels, A. J. (1987). Subcellular compartmentalization of I-methyl-Cphenylpyridinium with catechalomines in adrenal medullary chromaffin vesicles may explain the lack of toxicity to adrenal chromaffin cells. Proc. Natl. Acad. Sci. USA 84, 8160-8164. Rosenberg, dissociated

P. A. (1988). Catecholamine toxicity in cerebral cortex in cell culture. J. Neurosci. 8, 2887-2894.

Rudnick, G. (1986). ATP-driven H+ pumping elles. Annu. Rev. Physiol. 48, 403-413.

into intracellular

organ-

Rudnick, G., and Wall, S. C. (1992). The molecular mechanism of “ecstasy” [3&methylenedioxymethamphetamine (MDMA)]: serotonin transporters are targets for MDMA-induced serotonin release. Proc. Natl. Acad. Sci. USA 89, 1817-1821. Rudnick, G., Steiner-Mordoch, S. S., Fishkes, H., Stern-Bach, Y., and Schuldiner, S. (1990). Energetics of reserpine binding and occlusion by the chromaffin granule biogenic amine transporter. Biochemistry 29, 603-808.

Vesicular 551

Neurotransmitter

Transport

Sanger, F., Nicklen, S., and Coulson, A. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 54635467. Scherman, D. (1986). Dihydrotetrabenazine binding and monoamine uptake in mouse brain regions. J. Neurochem. 47, 331-339. Scherman, D., and Henry, J.-P. (1984). Reserpine binding to bovine chromaffin granule membranes: characterization and comparison with dihydrotetrabenazine binding. Mol. Pharmacol. 25, 113-122. Seed, B., and Aruffo, A. (1987). Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proc. Natl. Acad. Sci. USA 84, 3365-3369. Shimada, S., Kitayama, S., Lin. C-L., Patel, A., Nanthakumar, E., Gregor, P., Kuhar, M., and Uhl, G. (1991). Cloning and expression of a cocaine-sensitive dopamine transporter complementary DNA. Science 254,576~578. Shoffner, J. M., Watts, Ft. L., Juncos, J. L., Torroni, A., and Wallace, D. C. (1991). Mitochondrial oxidative phosphorylation in Parkinson’s disease. Ann. Neural. 30, 332-339. Snyder, S., D’Amato, R., Nye, J., and Javitch, J. (1986). Selective uptake of MPP’ by dopamine neurons is required for MPTP toxicity: studies in brain synaptosomes and PC-1 2 cells. In MPTP: A Neurotoxin Producing a Parkinsonian Syndrome, S. Markey, N. Castagnoli, Jr., A. Trevor, and I. Kopin, eds. (New York: Academic Press), pp. 191201. Stern-Bach, Y., Greenberg-Ofrath, N., Flechner, I., and Schuldiner, S. (1990). Identification and purification of a functional amine transporter from bovine chromaffin granules. J. Biol. Chem. 265, 3961-3966. Sternini, C., Anderson, K., Frantz, G., Krause, J. E., and Brecha, N. (1989). Expression of substance P/neurokinin A-encoding preprotachykinin messenger ribonucleic acids in the rat enteric nervous system. Gastroenterology 97, 348-356. Sulzer, D., and Rayport, S. (1990). Amphetamine and other psychostimulants reduce pH gradients in midbrain dopaminergic neurons and chromaffin granules: a mechanism of action. Neuron 5, 797-808. Tanner, C. M., and Langston, J. W. (1990). Do environmental toxins cause Parkinson’s disease?: a critical review. Neurology 40, 17-30. Trimble, W. S., Linial, M., and Scheller, R. H. (1991). Cellular and molecular biology of the presynaptic nerve terminal. Annu. Rev. Neurosci. 14, 93-122. Vincent, M S., and Near, J. A. (1991). Identification of a PHldihydrotetrabenazine-binding protein from bovine adrenal medulla. Mol. Pharmacol. 40, 889-894. Weaver, J. H., and Dupree, J. D. (1982). Conditions required for reserpine binding to the catecholamine transporter on chromaffin granule ghosts. Eur. J. Pharmacol. 80, 437-438. Yamaguchi, A., Ono, N., Akasaka, T., Noumi, T., and Sawai, T. (1990). Metal-tetracycline/H+ antiporter of Escherichia co/i encoded by a transposon, TnlO. J. Biol. Chem. 265, 15525-15530. GenBank

Accession

Numbers

The accession numbers for the sequences M97380 (CGAT) and M97381 (SVAT). Note Added

reported in this paper are

in Proof

The deduced amino acid sequences for CGAT and SVAT show a strong homology with peptide sequences derived from the purified bovine transporter (Stern-Bach, Y., Kenn, J. N., Bejerano, M., SteinerMordoch, S., Wallach, M., Findlay, J. B. C., and Schuldiner, S. [1992]. Homology of a vesicular-aiming transporter to a gene conferring resistance to MPP’. Proc. Natl. Acad. Sci. USA, in press).