ANALYTICAL SCIENCES MARCH 2015, VOL. 31
231
2015 © The Japan Society for Analytical Chemistry
Notes
A Comparative Fluorescent Beacon-based Method for Serum microRNA Quantification Madhu BETA,*1,*4 Subramanian KRISHNAKUMAR,*1 Sailaja V ELCHURI,*3 Bindu SALIM,*2 and Janakiraman NARAYANAN*3† *1 L & T Ocular Pathology Department, Kamalnayan Bajaj Institute for Research in Vision and Opthalmology, Vision Research Foundation. No 18/41, College Road, Chennai 600006, Tamil Nadu, India *2 Department of Electronics and Communication, PSG Institute of Advanced Studies, Coimbatore, Tamil Nadu, India *3 Nanobiotechnology Department, Kamalnayan Bajaj Institute for Research in Vision and Opthalmology, Vision Research Foundation, No 18/41, College Road, Chennai 600006, Tamil Nadu, India *4 CeNTAB, SASTRA (Shanmugha Arts, Science, Technology & Research Academy) University, Tanjore, India
Circulating serum microRNAs (miRNAs) are promising biomarkers for disease diagnosis. The quantification of the serum miRNA copy number is a challenge due to the presence of low levels in the serum. Here, we report on a direct measurement of the miRNA copy number from human serum using a locked nucleic acid (LNA) modified beacon probe with a single step using fluorescence spectroscopy and microscopy. We had used a minimum volume of 0.1 μL healthy human serum and retinoblastoma serum to show the biological variation of the miRNA copy number. Keywords Locked nucleic acid (LNA), serum, miRNA, retinoblastoma (Received October 6, 2014; Accepted December 2, 2014; Published March 10, 2015)
Introduction MicroRNAs (miRNAs) are short, non-coding, single stranded oligonucleotides (19 – 25 mers) that play a critical role in the cellular process such as the repression of miRNA translation and degradation. Several reports have been published on The determining the biological function of miRNAs.1–5 circulating serum miRNAs have been used as molecular signatures for identifying breast cancer,6 retinoblastoma,7 and colorectal cancers.8 The accurate assessment of miRNAs related to the disease condition in the serum samples would help in The existing standard methods for early diagnosis.9,10 quantifying miRNAs are northern blotting and qRT-PCR methods. These methods require high amount of input RNA template and lengthy processing time, which is not suitable for routine clinical diagnostics on serum samples. Earlier reports on the rapid and sensitive detection of miRNA used a molecular beacon probe with an additional step for removing any nonhybridized probe.11 To overcome these technical challenges, the molecular beacon probes modified with locked nucleic acid (LNA) bases were used for better sensitivity and specificity of hybridization.11 Here, we show an extended application of LNA beacon probes for the direct detection, quantification of wellstudied miR-18a in human serum samples.7,12,13 To the best of our knowledge, this application has not been reported for direct serum hybridizations. Moreover, in this method a minimum volume of 0.1 μL human serum is used to determine the miRNA To whom correspondence should be addressed. E-mail: [email protected]
†
copy numbers by fluorescence spectroscopy and microscopy methods.
Experimental Materials Vacutainer (BD, USA), circulating RNA isolation kit (Qiagen, Germany), Synthetic hsa-miR-18a (Origene, USA), hsamiR-129 (Eurofins), Human Serum and commercial fetal bovine serum (Sigma Aldrich, India), Biotinylated (FITC) LNA miR-18a probe (M/s Exiqon, USA Design ID: 201793, 5′/6FAM/CCGAGCTATCTGCACTAGATGCACCTTAC/iBiodT/ CGG/3Dab), Fluorescent microscopy (Nikon Eclipse TS100) with fluorescein isothiocyanite (FITC) emission filter (Nikon Intense light, C-HGFI pre-centered fiber illuminator, Germany) and camera (Q imaging Retiga Exi, Fast 1394), Spectrophotometer (SpectraMax M4 MultiMode Microplate Reader, Molecular Devices LLC, USA). Methods Serum sample collection. A volume of 1.0 mL blood sample was collected directly into a vacutainer from healthy and Retinoblastoma (RB) individuals. The whole blood was allowed to stand for 30 min at room temperature (RT) and centrifuged at 1800g for 20 min at RT. The resultant serum was aliquot into sterile diethylpyrocarbonate (DEPC) treated, RNAase free 1.5 mL tubes and stored in a –80° C freezer. A total of fifteen non-retinoblastoma age-matched healthy and fifteen retinoblastoma samples were used for this study. Commercial fetal bovine serum was used for in vitro studies. Our institution
232
ANALYTICAL SCIENCES MARCH 2015, VOL. 31
Fig. 1 Schematic representation of LNA hybridization with miRNA. The LNA probe binds to target miRNA, which results in hybridization by opening of the beacon loop and the quenching of FAM dye.
ethics review board approved the collection of serum samples to study the serum miRNA profile in retinoblastoma (Ethics code: 49B-2011-P; 298A-2011-P). MiR-18a beacon probe design. The design of the miR-18a probe was 5′/6-FAM/CCGAGCTATCTGCACTAGATGCACCTTAC/iBiodT/CGG/3′Dab/. Briefly, a microRNA probe designed for mature miR-18a (MIMAT0000072) or the hairpin loop region of precursor miR-18a contained a total number of 33 nucleotides in length. It comprises the middle ‘23’ nucleotides complementary to the miR-18a seed sequence; (underlined), a 6-carboxylfluorescein (FAM) flourophore at the 5′ end, a Biotin (iBio) moiety, and a 4-dimethylaminoazobenzene 4 carboxylic acid (Dab or Dabsyl) quencher at the 3′ end. The seed sequence was flanked at both ends by 5 residues; CCGAG/CTCGG to form the stem structure of the hair-pin loop. The approximate number of LNA modifications for the seed sequence were calculated based on given DNA/ RNA Tm of the synthesized probe, and was found to be equivalent to 10 numbers (Exiqon Oligo Tm prediction tool,www.exiqon.com/RNA-tm; Underlined in the probe sequence). The synthesized probes were HPLC purified and re-constituted in nuclease-free water, and stored at –20° C in a freezer. Fluorescence spectra of LNA probe hybridization with synthetic miRNA. Initial experiments were conducted in PBS spiked with synthetic miR-18a and miR-129 in order to study the specificity and sensitivity of the custom miR-18a LNA probe hybridization. The molecular beacon probe designed with sequence complimentary to miR-18a, was labeled with 5′-FAM and 3′-Dabcyl reporter dye molecules (Fig. 1). A different concentration of synthetic miR-18a and miR-129a (non-specific) starting from 500, 1000, 1500, 2000 to 2500 nM was hybridized with 500 nM of a custom LNA miR-18a probe at room temperature for 30 min. The fluorescence of the hybridized probe was detected at 525 nm (excitation 485 nm) using a fluorescence spectrophotometer. The miRNA copy number/concentration (nM) determination in serum samples by a spectroscopic method. Experiments were
done using healthy human serum with different volumes ranging from 0.1 to 5 μL. The copy number/concentration (nM) was determined from the above mentioned synthetic miRNA standard graph. The biological variation in the miRNA copy number and linearity in hybridization between healthy and RB serum (n = 15) was also determined for serum volumes ranging from 0.1 to 5 μL. Fluorescent microscopy imaging and quantification of hybridized miRNA. Florescence images were taken for all the hybridized samples at 4× and 10× magnification fields using microscopy with an FITC filter, and were captured through an attached CCD camera. Experiments were carried out in 384 well plates; each well was incubated with 500 nM of a custom LNA probe, standard miR-18a template ranging from 500 to 2500 nM and unknown concentration of 0.1 μL (LOD) human serum in a final volume of 20 μL each. The emission intensity was measured and used to calculate the miRNA copy number from a standard graph. The standard graph was obtained by calculating the area under the curve by measuring the pixel of the image using ImageJ software. The difference in the fluorescence intensity between healthy and RB serum was measured in ten independent samples of each group.
Results and Discussion A gradual increase in the fluorescence was observed by fluorescent microscopy for 500 nM custom LNA probe hybridization with different concentrations of synthetic miR-18a ranging from 500, 1000, 1500, 2000 to 2500 nM (Fig. 2A) in a buffer solution. The image intensity pixel values were measured using ImageJ software (R2 = 0.94) (Fig. 2B). An increased fluorescence was observed for an increased volume of healthy serum such as 0.1, 0.2, 0.5, 1, and 5 μL with 500 nM when hybridized with a custom LNA-18a probe (Fig. 2C). The difference in the fluorescence intensity between healthy serum and RB serum (n = 10) was found to be significant (Fig. 2D). Similarly, a gradual increase in fluorescence was observed
ANALYTICAL SCIENCES MARCH 2015, VOL. 31
233
Fig. 2 A) Microscopic imaging of hybridization experiments of a custom LNA-miR-18a probe with spiked miR-18a with known concentrations and an unknown concentration of human serum. The known concentrations of a custom LNA-miR-18a probe used to spike miR-18a was in ratios of 500:500 nM (A), 500:1000 nM (B), 500:1500 nM (C), 500:2000 nM (D), 500:2500 nM (E). However, 0.1 μL healthy serum was incubated with 500 nM of custom LNA-miR-18a probe (F), water (G), 500 nM LNA probe alone (H), and FBS alone (I) were used as controls. B) Standard graph obtained using ImageJ software for Fig. 1A. C) Microscopic images of human serum hybridized with a custom LNA miR-18a probe (volume from 0.1 to 5 μL both healthy and RB (Test) serum. D) Microscopic Imaging values derived using ImageJ software were plotted as a bar diagram. The values are shown in Mean ± SD. The bar diagram shows the mean fluorescence units along with the standard deviation. A student unpaired t-test was applied to derive the p-values. Significant difference was observed between healthy and RB samples (p < 0.01).
with known standard concentrations of synthetic miR-18a (500, 1000, 1500, 2000, and 2500 nM) by spectroscopic method (R2 = 0.97) (Fig. 3A). There was no gradual increase in the fluorescent spectra of the LNA beacon miR-18a probe with non-target miR129 (Fig. 3A) indicating the specificity of the probe to the target miR-18a. The copy numbers of miRNA in serum samples were calculated by using the above standard graph. A spectral analysis of varying volume (0.1 to 0.5 μL) of healthy serum (Fig. 3B) had shown a difference in the fluorescence intensity (Fig. 3B). Further, it was validated in fifteen healthy samples for copy number/concentration variation (Fig. 3C). The copy number of miRNA in healthy serum was calculated for both microscopy and spectroscopy methods using standard curves (Figs. 2B and 3A). The copy number of healthy serum was found to be 349808.4 ± 3375 copies (1399.23 ± 13.5 nM) for the microscopic method (n = 10) (Fig. 2C), whereas 356743.3 ± 18300 copies (1426.92 ± 73 nM) were obtained by the spectroscopic method (n = 15) (Fig. 3A) in 0.1 μL. Similarly, for RB samples, the microscopic method (n = 10) showed 528815.3 ± 9975 copies (2115.2 ± 39.9 nM) and the spectroscopic method (n = 15) showed 595862.3 ± 24970 (2383.22 ± 99 nM) copies. Significant differences were obtained in both methods (p < 0.01) (Figs. 2D and 3C) In a detailed analysis of this study, we used the LNA miR-18a
probe directly on to the serum samples for miR-18a detection. Further, we could detect miRNA directly from a minimum volume of 0.1 μL serum despite serum complexities, such as interference from other proteins and coagulation factors. In contrast, the conventional methods require 200 – 500 μL of serum for the extraction of miRNA.14,15 This method showed that hybridization was more specific, and there was no enhancement in the fluorescence or cross hybridization with miR-129 as well as with bovine originated microRNAs which might be present in FBS.16 The copy number determination method can be performed in 384 well plates, to also enable the method to be more robust and economic in quantifying miRNA from serum samples. It was very evident from the results that the copy number detected by microscopic and spectroscopy methods was greater in number, indicating that it is more sensitive than the qRT-PCR methods. The relative fold change difference between healthy and RB individuals was the same in the spectroscopy (n = 15) and microscopy (n = 10) methods, which showed a copy number ≥ 1 fold difference. Although both methods showed a uniform relative difference between healthy and RB, the spectroscopy method seems to be more sensitive in determining the copy number compared to the microscopic method. This suggest that the labeled LNA method is robust for the quantification of miRNAs.
234
ANALYTICAL SCIENCES MARCH 2015, VOL. 31
Fig. 3 A) The figure shows the graphical representation of custom LNA miR-18a hybridization in serum spiked with miR-18a. The ratios of custom LNA miR-18a to spiked serum miR-18a were in the range of 500:500 nM, 500:1000 nM, 500:1500 nM, 500:2000 nM, 500:2500 nM. 0.1 μL of healthy, blank and commercial serum (FBS). They were also incubated with 500 nM custom LNA miR-18a probe (standard graph shown in the sub figure). B) Fluorescent spectra of healthy serum and RB serum samples hybridized with 500 nM of a Custom LNA miR-18a probe. The colored lines and a peak at 525 nm indicate an increase in hybridization. It was observed in ascending order from 0.1 to 5 μL volume (0.1, 0.2, 0.5, 1, and 5 μL). C) Validation of LNA probe hybridization in healthy (Control) and RB serum (n = 15) using the spectroscopy method. The bar diagram shows the mean fluorescence units along with standard deviation. A student unpaired t-test was applied to derive p-values. A significant difference was observed between healthy and RB samples (p < 0.01).
The usual lower yield of the miRNA copy number from serum or plasma10,17 by qRT-PCR is due to multiple steps involved in the process. This LNA molecular beacon approach can overcome any technical difficulties such as improper copy number estimations,18 through indirect hybridization which will not be suitable for the diagnostic purpose. Moreover, in clinical settings it is important to measure any intact miRNAs from biological samples to find out the actual amount of miRNAs without any processing artefacts. Thus, the LNA molecular beacon approach is very rapid and can detect microRNA in intact 0.1 μL healthy serum samples within 30 min. This approach may thus open new avenues for developing point-ofcare device platforms.
2. 3.
4. 5.
Acknowledgements We acknowledge a grant from National Programme on Micro and Smart Systems (NPMASS) (PARC 4.12) for funding provided to this project. We thank Ms. Sanghmitra K.S for technical assistance.
References
6. 7. 8. 9.
1. P. S. Mitchell, R. K. Parkin, E. M. Kroh, B. R. Fritz, S. K. Wyman, E. L. Pogosova-Agadjanyan, A. Peterson, J. Noteboom, K. C. O’Briant, A. Allen, D. W. Lin, N. Urban,
10.
C. W. Drescher, B. S. Knudsen, D. L. Stirewalt, R. Gentleman, R. L. Vessella, P. S. Nelson, D. B. Martin, and M. Tewari, Proc. Natl. Acad. Sci. U. S. A., 2008, 105, 10513. Y. Huang, X. J. Shen, Q. Zou, S. P. Wang, S. M. Tang, and G. Z. Zhang, J. Physiol. Biochem., 2011, 67, 129. S. Volinia, G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueitt, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce, Proc. Natl. Acad. Sci. U. S. A., 2006, 103, 2257. P. Kantharidis, B. Wang, R. M. Carew, and H. Y. Lan, Diabetes, 2011, 60, 1832. S. Fichtlscherer, S. De Rosa, H. Fox, T. Schwietz, A. Fischer, C. Liebetrau, M. Weber, C. W. Hamm, T. Roxe, M. Muller-Ardogan, A. Bonauer, A. M. Zeiher, and S. Dimmeler, Circ. Res., 2010, 107, 677. S. Kumar, R. Keerthana, A. Pazhanimuthu, and P. Perumal, Indian J. Biochem. Biophys., 2013, 50, 210. M. Beta, N. Venkatesan, M. Vasudevan, U. Vetrivel, V. Khetan, and S. Krishnakumar, Bioinform. Biol. Insights, 2013, 7, 21. C. Li, W. Yang, H. Liu, M. Li, W. Zhou, and J. Xie, Molecules, 2013, 18, 15737. M. Ichikawa and H. Akiyama, Methods Mol. Biol., 2013, 1024, 247. E. M. Kroh, R. K. Parkin, P. S. Mitchell, and M. Tewari, Methods, 2010, 50, 298.
ANALYTICAL SCIENCES MARCH 2015, VOL. 31 11. M. B. Baker, G. Bao, and C. D. Searles, Nucleic Acids Res., 2012, 40, 21. 12. R. Morimura, S. Komatsu, D. Ichikawa, H. Takeshita, M. Tsujiura, H. Nagata, H. Konishi, A. Shiozaki, H. Ikoma, K. Okamoto, T. Ochiai, H. Taniguchi, and E. Otsuji, Br. J. Cancer, 2011, 105, 1733. 13. W. T. Garrison and D. Biggs, Diabetes Educ., 1990, 16, 304. 14. Y. Li and K. V. Kowdley, Anal. Biochem., 2012, 431, 69. 15. V. Koberle, B. Kronenberger, T. Pleli, J. Trojan, E. Imelmann, J. Peveling-Oberhag, M. W. Welker, M. Elhendawy, S. Zeuzem, A. Piiper, and O. Waidmann, Eur. J.
235 Cancer, 2013, 49, 3442. 16. X. Chen, Y. Ba, L. Ma, X. Cai, Y. Yin, K. Wang, J. Guo, Y. Zhang, J. Chen, X. Guo, Q. Li, X. Li, W. Wang, J. Wang, X. Jiang, Y. Xiang, C. Xu, P. Zheng, J. Zhang, R. Li, H. Zhang, X. Shang, T. Gong, G. Ning, K. Zen, and C. Y. Zhang, Cell Res., 2008, 18, 997. 17. J. C. Brase, D. Wuttig, R. Kuner, and H. Sultmann, Mol. Cancer, 2010, 9, 1476. 18. T. Blondal, S. Jensby Nielsen, A. Baker, D. Andreasen, P. Mouritzen, M. Wrang Teilum, and I. K. Dahlsveen, Methods, 2013, 59, S1-6.
231
2015 © The Japan Society for Analytical Chemistry
Notes
A Comparative Fluorescent Beacon-based Method for Serum microRNA Quantification Madhu BETA,*1,*4 Subramanian KRISHNAKUMAR,*1 Sailaja V ELCHURI,*3 Bindu SALIM,*2 and Janakiraman NARAYANAN*3† *1 L & T Ocular Pathology Department, Kamalnayan Bajaj Institute for Research in Vision and Opthalmology, Vision Research Foundation. No 18/41, College Road, Chennai 600006, Tamil Nadu, India *2 Department of Electronics and Communication, PSG Institute of Advanced Studies, Coimbatore, Tamil Nadu, India *3 Nanobiotechnology Department, Kamalnayan Bajaj Institute for Research in Vision and Opthalmology, Vision Research Foundation, No 18/41, College Road, Chennai 600006, Tamil Nadu, India *4 CeNTAB, SASTRA (Shanmugha Arts, Science, Technology & Research Academy) University, Tanjore, India
Circulating serum microRNAs (miRNAs) are promising biomarkers for disease diagnosis. The quantification of the serum miRNA copy number is a challenge due to the presence of low levels in the serum. Here, we report on a direct measurement of the miRNA copy number from human serum using a locked nucleic acid (LNA) modified beacon probe with a single step using fluorescence spectroscopy and microscopy. We had used a minimum volume of 0.1 μL healthy human serum and retinoblastoma serum to show the biological variation of the miRNA copy number. Keywords Locked nucleic acid (LNA), serum, miRNA, retinoblastoma (Received October 6, 2014; Accepted December 2, 2014; Published March 10, 2015)
Introduction MicroRNAs (miRNAs) are short, non-coding, single stranded oligonucleotides (19 – 25 mers) that play a critical role in the cellular process such as the repression of miRNA translation and degradation. Several reports have been published on The determining the biological function of miRNAs.1–5 circulating serum miRNAs have been used as molecular signatures for identifying breast cancer,6 retinoblastoma,7 and colorectal cancers.8 The accurate assessment of miRNAs related to the disease condition in the serum samples would help in The existing standard methods for early diagnosis.9,10 quantifying miRNAs are northern blotting and qRT-PCR methods. These methods require high amount of input RNA template and lengthy processing time, which is not suitable for routine clinical diagnostics on serum samples. Earlier reports on the rapid and sensitive detection of miRNA used a molecular beacon probe with an additional step for removing any nonhybridized probe.11 To overcome these technical challenges, the molecular beacon probes modified with locked nucleic acid (LNA) bases were used for better sensitivity and specificity of hybridization.11 Here, we show an extended application of LNA beacon probes for the direct detection, quantification of wellstudied miR-18a in human serum samples.7,12,13 To the best of our knowledge, this application has not been reported for direct serum hybridizations. Moreover, in this method a minimum volume of 0.1 μL human serum is used to determine the miRNA To whom correspondence should be addressed. E-mail: [email protected]
†
copy numbers by fluorescence spectroscopy and microscopy methods.
Experimental Materials Vacutainer (BD, USA), circulating RNA isolation kit (Qiagen, Germany), Synthetic hsa-miR-18a (Origene, USA), hsamiR-129 (Eurofins), Human Serum and commercial fetal bovine serum (Sigma Aldrich, India), Biotinylated (FITC) LNA miR-18a probe (M/s Exiqon, USA Design ID: 201793, 5′/6FAM/CCGAGCTATCTGCACTAGATGCACCTTAC/iBiodT/ CGG/3Dab), Fluorescent microscopy (Nikon Eclipse TS100) with fluorescein isothiocyanite (FITC) emission filter (Nikon Intense light, C-HGFI pre-centered fiber illuminator, Germany) and camera (Q imaging Retiga Exi, Fast 1394), Spectrophotometer (SpectraMax M4 MultiMode Microplate Reader, Molecular Devices LLC, USA). Methods Serum sample collection. A volume of 1.0 mL blood sample was collected directly into a vacutainer from healthy and Retinoblastoma (RB) individuals. The whole blood was allowed to stand for 30 min at room temperature (RT) and centrifuged at 1800g for 20 min at RT. The resultant serum was aliquot into sterile diethylpyrocarbonate (DEPC) treated, RNAase free 1.5 mL tubes and stored in a –80° C freezer. A total of fifteen non-retinoblastoma age-matched healthy and fifteen retinoblastoma samples were used for this study. Commercial fetal bovine serum was used for in vitro studies. Our institution
232
ANALYTICAL SCIENCES MARCH 2015, VOL. 31
Fig. 1 Schematic representation of LNA hybridization with miRNA. The LNA probe binds to target miRNA, which results in hybridization by opening of the beacon loop and the quenching of FAM dye.
ethics review board approved the collection of serum samples to study the serum miRNA profile in retinoblastoma (Ethics code: 49B-2011-P; 298A-2011-P). MiR-18a beacon probe design. The design of the miR-18a probe was 5′/6-FAM/CCGAGCTATCTGCACTAGATGCACCTTAC/iBiodT/CGG/3′Dab/. Briefly, a microRNA probe designed for mature miR-18a (MIMAT0000072) or the hairpin loop region of precursor miR-18a contained a total number of 33 nucleotides in length. It comprises the middle ‘23’ nucleotides complementary to the miR-18a seed sequence; (underlined), a 6-carboxylfluorescein (FAM) flourophore at the 5′ end, a Biotin (iBio) moiety, and a 4-dimethylaminoazobenzene 4 carboxylic acid (Dab or Dabsyl) quencher at the 3′ end. The seed sequence was flanked at both ends by 5 residues; CCGAG/CTCGG to form the stem structure of the hair-pin loop. The approximate number of LNA modifications for the seed sequence were calculated based on given DNA/ RNA Tm of the synthesized probe, and was found to be equivalent to 10 numbers (Exiqon Oligo Tm prediction tool,www.exiqon.com/RNA-tm; Underlined in the probe sequence). The synthesized probes were HPLC purified and re-constituted in nuclease-free water, and stored at –20° C in a freezer. Fluorescence spectra of LNA probe hybridization with synthetic miRNA. Initial experiments were conducted in PBS spiked with synthetic miR-18a and miR-129 in order to study the specificity and sensitivity of the custom miR-18a LNA probe hybridization. The molecular beacon probe designed with sequence complimentary to miR-18a, was labeled with 5′-FAM and 3′-Dabcyl reporter dye molecules (Fig. 1). A different concentration of synthetic miR-18a and miR-129a (non-specific) starting from 500, 1000, 1500, 2000 to 2500 nM was hybridized with 500 nM of a custom LNA miR-18a probe at room temperature for 30 min. The fluorescence of the hybridized probe was detected at 525 nm (excitation 485 nm) using a fluorescence spectrophotometer. The miRNA copy number/concentration (nM) determination in serum samples by a spectroscopic method. Experiments were
done using healthy human serum with different volumes ranging from 0.1 to 5 μL. The copy number/concentration (nM) was determined from the above mentioned synthetic miRNA standard graph. The biological variation in the miRNA copy number and linearity in hybridization between healthy and RB serum (n = 15) was also determined for serum volumes ranging from 0.1 to 5 μL. Fluorescent microscopy imaging and quantification of hybridized miRNA. Florescence images were taken for all the hybridized samples at 4× and 10× magnification fields using microscopy with an FITC filter, and were captured through an attached CCD camera. Experiments were carried out in 384 well plates; each well was incubated with 500 nM of a custom LNA probe, standard miR-18a template ranging from 500 to 2500 nM and unknown concentration of 0.1 μL (LOD) human serum in a final volume of 20 μL each. The emission intensity was measured and used to calculate the miRNA copy number from a standard graph. The standard graph was obtained by calculating the area under the curve by measuring the pixel of the image using ImageJ software. The difference in the fluorescence intensity between healthy and RB serum was measured in ten independent samples of each group.
Results and Discussion A gradual increase in the fluorescence was observed by fluorescent microscopy for 500 nM custom LNA probe hybridization with different concentrations of synthetic miR-18a ranging from 500, 1000, 1500, 2000 to 2500 nM (Fig. 2A) in a buffer solution. The image intensity pixel values were measured using ImageJ software (R2 = 0.94) (Fig. 2B). An increased fluorescence was observed for an increased volume of healthy serum such as 0.1, 0.2, 0.5, 1, and 5 μL with 500 nM when hybridized with a custom LNA-18a probe (Fig. 2C). The difference in the fluorescence intensity between healthy serum and RB serum (n = 10) was found to be significant (Fig. 2D). Similarly, a gradual increase in fluorescence was observed
ANALYTICAL SCIENCES MARCH 2015, VOL. 31
233
Fig. 2 A) Microscopic imaging of hybridization experiments of a custom LNA-miR-18a probe with spiked miR-18a with known concentrations and an unknown concentration of human serum. The known concentrations of a custom LNA-miR-18a probe used to spike miR-18a was in ratios of 500:500 nM (A), 500:1000 nM (B), 500:1500 nM (C), 500:2000 nM (D), 500:2500 nM (E). However, 0.1 μL healthy serum was incubated with 500 nM of custom LNA-miR-18a probe (F), water (G), 500 nM LNA probe alone (H), and FBS alone (I) were used as controls. B) Standard graph obtained using ImageJ software for Fig. 1A. C) Microscopic images of human serum hybridized with a custom LNA miR-18a probe (volume from 0.1 to 5 μL both healthy and RB (Test) serum. D) Microscopic Imaging values derived using ImageJ software were plotted as a bar diagram. The values are shown in Mean ± SD. The bar diagram shows the mean fluorescence units along with the standard deviation. A student unpaired t-test was applied to derive the p-values. Significant difference was observed between healthy and RB samples (p < 0.01).
with known standard concentrations of synthetic miR-18a (500, 1000, 1500, 2000, and 2500 nM) by spectroscopic method (R2 = 0.97) (Fig. 3A). There was no gradual increase in the fluorescent spectra of the LNA beacon miR-18a probe with non-target miR129 (Fig. 3A) indicating the specificity of the probe to the target miR-18a. The copy numbers of miRNA in serum samples were calculated by using the above standard graph. A spectral analysis of varying volume (0.1 to 0.5 μL) of healthy serum (Fig. 3B) had shown a difference in the fluorescence intensity (Fig. 3B). Further, it was validated in fifteen healthy samples for copy number/concentration variation (Fig. 3C). The copy number of miRNA in healthy serum was calculated for both microscopy and spectroscopy methods using standard curves (Figs. 2B and 3A). The copy number of healthy serum was found to be 349808.4 ± 3375 copies (1399.23 ± 13.5 nM) for the microscopic method (n = 10) (Fig. 2C), whereas 356743.3 ± 18300 copies (1426.92 ± 73 nM) were obtained by the spectroscopic method (n = 15) (Fig. 3A) in 0.1 μL. Similarly, for RB samples, the microscopic method (n = 10) showed 528815.3 ± 9975 copies (2115.2 ± 39.9 nM) and the spectroscopic method (n = 15) showed 595862.3 ± 24970 (2383.22 ± 99 nM) copies. Significant differences were obtained in both methods (p < 0.01) (Figs. 2D and 3C) In a detailed analysis of this study, we used the LNA miR-18a
probe directly on to the serum samples for miR-18a detection. Further, we could detect miRNA directly from a minimum volume of 0.1 μL serum despite serum complexities, such as interference from other proteins and coagulation factors. In contrast, the conventional methods require 200 – 500 μL of serum for the extraction of miRNA.14,15 This method showed that hybridization was more specific, and there was no enhancement in the fluorescence or cross hybridization with miR-129 as well as with bovine originated microRNAs which might be present in FBS.16 The copy number determination method can be performed in 384 well plates, to also enable the method to be more robust and economic in quantifying miRNA from serum samples. It was very evident from the results that the copy number detected by microscopic and spectroscopy methods was greater in number, indicating that it is more sensitive than the qRT-PCR methods. The relative fold change difference between healthy and RB individuals was the same in the spectroscopy (n = 15) and microscopy (n = 10) methods, which showed a copy number ≥ 1 fold difference. Although both methods showed a uniform relative difference between healthy and RB, the spectroscopy method seems to be more sensitive in determining the copy number compared to the microscopic method. This suggest that the labeled LNA method is robust for the quantification of miRNAs.
234
ANALYTICAL SCIENCES MARCH 2015, VOL. 31
Fig. 3 A) The figure shows the graphical representation of custom LNA miR-18a hybridization in serum spiked with miR-18a. The ratios of custom LNA miR-18a to spiked serum miR-18a were in the range of 500:500 nM, 500:1000 nM, 500:1500 nM, 500:2000 nM, 500:2500 nM. 0.1 μL of healthy, blank and commercial serum (FBS). They were also incubated with 500 nM custom LNA miR-18a probe (standard graph shown in the sub figure). B) Fluorescent spectra of healthy serum and RB serum samples hybridized with 500 nM of a Custom LNA miR-18a probe. The colored lines and a peak at 525 nm indicate an increase in hybridization. It was observed in ascending order from 0.1 to 5 μL volume (0.1, 0.2, 0.5, 1, and 5 μL). C) Validation of LNA probe hybridization in healthy (Control) and RB serum (n = 15) using the spectroscopy method. The bar diagram shows the mean fluorescence units along with standard deviation. A student unpaired t-test was applied to derive p-values. A significant difference was observed between healthy and RB samples (p < 0.01).
The usual lower yield of the miRNA copy number from serum or plasma10,17 by qRT-PCR is due to multiple steps involved in the process. This LNA molecular beacon approach can overcome any technical difficulties such as improper copy number estimations,18 through indirect hybridization which will not be suitable for the diagnostic purpose. Moreover, in clinical settings it is important to measure any intact miRNAs from biological samples to find out the actual amount of miRNAs without any processing artefacts. Thus, the LNA molecular beacon approach is very rapid and can detect microRNA in intact 0.1 μL healthy serum samples within 30 min. This approach may thus open new avenues for developing point-ofcare device platforms.
2. 3.
4. 5.
Acknowledgements We acknowledge a grant from National Programme on Micro and Smart Systems (NPMASS) (PARC 4.12) for funding provided to this project. We thank Ms. Sanghmitra K.S for technical assistance.
References
6. 7. 8. 9.
1. P. S. Mitchell, R. K. Parkin, E. M. Kroh, B. R. Fritz, S. K. Wyman, E. L. Pogosova-Agadjanyan, A. Peterson, J. Noteboom, K. C. O’Briant, A. Allen, D. W. Lin, N. Urban,
10.
C. W. Drescher, B. S. Knudsen, D. L. Stirewalt, R. Gentleman, R. L. Vessella, P. S. Nelson, D. B. Martin, and M. Tewari, Proc. Natl. Acad. Sci. U. S. A., 2008, 105, 10513. Y. Huang, X. J. Shen, Q. Zou, S. P. Wang, S. M. Tang, and G. Z. Zhang, J. Physiol. Biochem., 2011, 67, 129. S. Volinia, G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueitt, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce, Proc. Natl. Acad. Sci. U. S. A., 2006, 103, 2257. P. Kantharidis, B. Wang, R. M. Carew, and H. Y. Lan, Diabetes, 2011, 60, 1832. S. Fichtlscherer, S. De Rosa, H. Fox, T. Schwietz, A. Fischer, C. Liebetrau, M. Weber, C. W. Hamm, T. Roxe, M. Muller-Ardogan, A. Bonauer, A. M. Zeiher, and S. Dimmeler, Circ. Res., 2010, 107, 677. S. Kumar, R. Keerthana, A. Pazhanimuthu, and P. Perumal, Indian J. Biochem. Biophys., 2013, 50, 210. M. Beta, N. Venkatesan, M. Vasudevan, U. Vetrivel, V. Khetan, and S. Krishnakumar, Bioinform. Biol. Insights, 2013, 7, 21. C. Li, W. Yang, H. Liu, M. Li, W. Zhou, and J. Xie, Molecules, 2013, 18, 15737. M. Ichikawa and H. Akiyama, Methods Mol. Biol., 2013, 1024, 247. E. M. Kroh, R. K. Parkin, P. S. Mitchell, and M. Tewari, Methods, 2010, 50, 298.
ANALYTICAL SCIENCES MARCH 2015, VOL. 31 11. M. B. Baker, G. Bao, and C. D. Searles, Nucleic Acids Res., 2012, 40, 21. 12. R. Morimura, S. Komatsu, D. Ichikawa, H. Takeshita, M. Tsujiura, H. Nagata, H. Konishi, A. Shiozaki, H. Ikoma, K. Okamoto, T. Ochiai, H. Taniguchi, and E. Otsuji, Br. J. Cancer, 2011, 105, 1733. 13. W. T. Garrison and D. Biggs, Diabetes Educ., 1990, 16, 304. 14. Y. Li and K. V. Kowdley, Anal. Biochem., 2012, 431, 69. 15. V. Koberle, B. Kronenberger, T. Pleli, J. Trojan, E. Imelmann, J. Peveling-Oberhag, M. W. Welker, M. Elhendawy, S. Zeuzem, A. Piiper, and O. Waidmann, Eur. J.
235 Cancer, 2013, 49, 3442. 16. X. Chen, Y. Ba, L. Ma, X. Cai, Y. Yin, K. Wang, J. Guo, Y. Zhang, J. Chen, X. Guo, Q. Li, X. Li, W. Wang, J. Wang, X. Jiang, Y. Xiang, C. Xu, P. Zheng, J. Zhang, R. Li, H. Zhang, X. Shang, T. Gong, G. Ning, K. Zen, and C. Y. Zhang, Cell Res., 2008, 18, 997. 17. J. C. Brase, D. Wuttig, R. Kuner, and H. Sultmann, Mol. Cancer, 2010, 9, 1476. 18. T. Blondal, S. Jensby Nielsen, A. Baker, D. Andreasen, P. Mouritzen, M. Wrang Teilum, and I. K. Dahlsveen, Methods, 2013, 59, S1-6.
