The EMBO Journal vol.1 1 no.3 pp. 1065 - 1073, 1992
A conserved 1 1 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene William D.Rapp and David B.Stern Boyce Thompson Institute for Plant Research, Cornell University, Tower Road, Ithaca, NY 14853, USA Communicated by D.Lonsdale
To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atpl promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within -19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atpl 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Key words: in vitro transcription/promoter/mitochondrial DNA/maize
Introduction Mitochondrial DNA (mtDNA) encodes several components of the respiratory chain, the F I-Fo ATPase and the mitochondrial translational apparatus. The organization and expression patterns of mitochondrial genomes vary widely between animals, fungi and plants. The vertebrate mitochondrial genome is 16 kb in size and genome-length precursor RNAs are synthesized from both DNA strands from promoters within the D loop (Tzagoloff and Myers, 1986; Clayton, 1991). The Saccharomyces cerevisiae mitochondrial genome is 75 kb in size and transcription initiates at 20 copies of a highly conserved nonanucleotide sequence (Constanzo and Fox, 1990). Plant mitochondria differ from their animal and fungal counterparts in that their genomes are large and that numerous transcripts can be identified from individual genes (Newton, 1988; Levings and Brown, 1989; Lonsdale, 1989). These complex transcript patterns result from the recombinogenic properties of plant mtDNA, promoter multiplicity for many genes and post-transcriptional processing events. Transcriptional run-on experiments in maize have -
-
Oxford University Press
demonstrated that each promoter has a characteristic strength, with the ribosomal RNA promoters being the strongest (Finnegan and Brown, 1990; Mulligan et al., 1991). Inspection of sequences surrounding transcription initiation sites in maize, defined by guanylyl transferase capping experiments, identified a putative 11 nucleotide (nt) promoter element with a loose consensus sequence (Mulligan et al., 1991). In addition, the repeated motif G(A/T)3_4 is found upstream of this element in some genes and the number of copies of this motif can be roughly correlated with promoter strength as judged by run-on transcription. Despite the progress that has been achieved in the analysis of plant mitochondrial gene expression, the mechanisms of transcriptional regulation have remained elusive. In particular, the inability to transcribe plant mtDNA in vitro has precluded the functional definition of promoter and transcription termination elements. To determine the structure of maize mitochondrial promoters, we have developed an in vitro transcription system. Our transcription system is similar to one from wheat that was recently reported to initiate accurately at the cox2 promoter (HanicJoyce and Gray, 1991). We have used the maize in vitro transcription system to study initiation at the atpl promoter (atpl encodes the ce-subunit of the F1 -FO ATPase). We demonstrate an absolute requirement for the proposed consensus promoter; however, the G(A/T)3_4 motif is dispensable in vitro. This is the first reported functional analysis of a plant mitochondrial promoter.
Results Development of a maize mitochondrial in vitro transcription system Plasmid pBHO.7, which contains the maize mitochondrial atpl promoter, was used to monitor in vitro transcription (Figure IA; see Mulligan et al., 1991). Atpl was chosen because, based on run-on transcription assays, it is one of the most actively transcribed protein-coding genes. Also, the atpl gene appears to utilize a single promoter, in contrast to most other maize mitochondrial protein-coding genes analyzed thus far (Mulligan et al., 1988a, 1988b, 1991; Kennell and Pring, 1989). To isolate mitochondrial protein fractions possessing promoter-specific transcriptional activity, a lysate of isolated mitochondria was clarified to yield a membrane-free soluble protein fraction (S-100). The S-100 fraction displayed nonspecific transcriptional activity when double-stranded poly(dA -dT) was used as a template, as evidenced by the incorporation of [a-32P]UTP into high molecular weight RNA (data not shown). This activity was enriched in 20-30% and 30-50% (w/v) ammonium sulfate fractions of the S-100 fraction. However, neither the S-100 nor the ammonium sulfate fractions initiated transcription at the atpl promoter in pBHO.7. The transcriptionally active ammonium sulfate fractions
1065
W.D.Rapp and D.B.Stern
were combined and subjected to anion-exchange FPLC and proteins were eluted by step-wise increases in KCl concentration (see Materials and methods). The resultant fractions were then assayed for transcriptional activity using HindIII-linearized pBHO.7; we found that a transcript of -300 nt was synthesized using proteins that eluted with 0.3 M KCl (Figure IB, lane 0.3). This was close in size to the 298 nt transcript expected if transcription initiated accurately and terminated at the end of the linear template. No product of this size was synthesized when HindIlllinearized vector replaced pBHO.7 as template (data not shown). The heterogeneous RNA migrating above the 300 nt transcript was observed using linearized vector, indicating that this RNA results from non-specific transcription of vector DNA. Similar non-specific transcriptional activities observed in other in vitro transcription systems have been attributed to non-specific initiation by RNA polymerase at nicks or ends of linear templates, or to the partial dissociation of a specificity factor from a core polymerase (Weil et al., 1979; Orozco et al., 1985; Hanic-Joyce and Gray, 1991).
However, since the synthesis of the 300 nt transcript is absolutely dependent upon atpl sequences and since initiation occurs precisely at the same site as atpl mRNA initiation in vivo (see below), this protein fraction can be used with confidence to investigate atpi promoter structure. In some preparations, protein that eluted with 0.2 M KCl also displayed a low level of atpl promoter-specific transcriptional activity (Figure iB, lane 0.2), but this fraction appeared to contain higher levels of non-specific transcriptional activity. Consequently, the 0.3 M KCl eluted fraction was used in all subsequent in vitro transcription experiments. Atp 1 transcription initiates accurately in vitro To establish that transcription initiates accurately at the atpi promoter in vitro, we first compared transcripts synthesized
using KpnI-linearized pBHO.7 with those synthesized using the HindIl-linearized template. KpnI cleaves pBHO.7 in the polylinker region 34 nt downstream of the HindlIl site (Figure IA). Thus, KpnI-linearized pBHO.7 should direct the synthesis of a 332 nt transcript. Figure 2 shows that transcripts of the expected sizes were indeed obtained using HindIII and KpnI-digested pBHO.7. To determine the precise site of transcription initiation in vitro, the 5' end of the 298 nt transcript was mapped by primer extension. An oligonucleotide complementary to the atpi sense strand was annealed to in vitro-synthesized RNA and to total RNA isolated from maize mitochondria, and cDNA synthesis was carried out using reverse transcriptase. Figure 3 shows that the primer extension products of in vitro-synthesized RNA and total maize mitochondrial RNA are identical (compare lanes 1 and 2). When in vitrosynthesized atpi RNA was treated with RNase A prior to hybridization with the primer, or when pBHO.7 template DNA was omitted from the in vitro transcription reaction,
4127
g_
311
Fig. 1. Assay of mitochondrial protein fractions for promoter-specific transcriptional activity. (A) pBHO.7 contains a 0.7 kb fragment from the 5' non-coding region of the maize mitochondrial atpl gene (Mulligan et al., 1991). The top arrow represents the atpl transcription initiation site. BamHI (B), HindlIl (H) and KpnI (K) restriction sites are indicated. The sizes of RNA molecules expected from initiation at the atpl promoter followed by transcriptional run-off of HindIII or KpnI linearized templates are indicated. (B) Proteins that eluted from a Pharmacia Mono-Q FPLC column in buffer containing 0.1, 0.2, 0.3 or 0.5 M KCI were assayed for promoter-specific transcriptional activity using HindIII-linearized pBH0.7 as a template (see Materials and methods). In vitro transcription products were electrophoresed in a 5% denaturing polyacrylamide gel. The arrow to the right indicates the 298 nt transcript. Mobilities of DNA size standards are indicated in nt.
1066
_k
332r
r
298 lrt.
249
Fig. 2. Run-off transcript analysis. pBHO.7 was linearized with HindlIl KpnI (see Figure IA) and used as a template in standard in vitro transcription reactions. Products were electrophoresed in a 5% denaturing polyacrylamide gel. Mobilities of DNA size standards are indicated in nt. HindIII and KpnI linearized templates direct the synthesis of 298 nt (lane H) and 332 nt (lane K) transcripts, respectively.
or
Maize mitochondrial transcription
no primer extension products were generated (Figure 3, lanes 3 and 4). This demonstrates that template-dependent RNA synthesis is occurring in vitro. Comparison of the primer extension products with the sequence ladder shows that the 5' ends of both the in vitro and in vivo-synthesized transcripts map to the previously identifed atpl transcription initiation site (Figure 3; Mulligan et al., 1991). This site lies within an 11 nt consensus sequence that was proposed to be a maize mitochondrial promoter element (Mulligan et al., 1991).
Upstream sequence requirements for atp 1 in vitro transcription To identify the extent of upstream sequences required for atpi transcription initiation, a series of 5' deletion constructs was generated (see Materials and methods; Figure 4A). Selected constructs were linearized and tested for their ability to direct transcription of a 298 nt RNA species as described above. Figure 4B shows that deletion of 5' non-transcribed
T
A
AT
A
T
TA
AT
T A _ J.-
AT TA T A AAA
_-sw.
_
TA T T
A
Fig. 3. Accurate in vitro transcription initiation at the atpi promoter. An end-labeled oligonucleotide (BRIO, see Materials and methods) was hybridized with maize mitochondrial RNA or with atpl RNA synthesized in vitro using HindUI linearized pBHO.7 as a template. Primers were extended using MMLV reverse transcriptase and electrophoresed in a 6% denaturing polyacrylamide gel. Lane 1, primer extension products from maize mitochondrial RNA; lane 2, primer extension products from in vitro-synthesized atpl RNA; lane 3, same as lane 2 except that RNA was treated with RNase A prior to hybridization with the primer; lane 4, same as lane 2 except pBHO.7 DNA was omitted from the in vitro transcription reaction.
Dideoxynucleotide sequencing reactions using the end-labeled primer and double-stranded pBHO.7 were run in adjacent lanes to allow the precise identification of the atpl RNA 5' ends. The sequence surrounding 5' ends is shown to the left. The in vivo transcription initiation site (arrow) and the conserved 11 nt motif (boxed sequence) are indicated (Mulligan et al., 1991).
sequences to within 19 nt of the transcription initiation site had no significant effect on in vitro transcriptional activity. Deletion of an additional 16 bp, however, reduced transcriptional activity by 90-95 % (Figure 4B; lane A -3). This deletion removes the first 2 nt of the consensus promoter. A deletion that extends 4 nt beyond the transcription initiation site abolished transcriptional activity (Figure 4B; lane z +4). As discussed above, it was previously proposed that the maize mitochondrial promoter consists of two elements, an 11 nt motif surrounding the transcription initiation site and an upstream G(A/T)3-4 motif that is present in one to several copies (Mulligan et al., 1991). Two G(A/T)3>4 sequences are found upstream of the atpl transcription initiation site, GTTAT at nucleotides -27 to -23 and GAAAA at -13 to -9. In pBHO.7A-19, the GTTAT sequence has been deleted, but a fortuitous G(A/T)3-4 sequence in the vector (GAATT) was brought into proximity of the initiation site (nucleotides -26 to -22) during the construction of this mutant. Therefore, while the observation that template pBHO.7A -19 supports accurate initiation allows us to conclude that there is not a requirement for specific sequences upstream of nucleotide -19, it does not allow us to draw any conclusions about the role of the G(A/T)3-4 repeats in promoting atpl transcription. Role of conserved motifs in promoting transcription To determine if the 11 nt and G(A/T)3-4 sequences are absolutely required for transcription initiation, these sequences were specifically deleted from or altered in the atpl promoter by oligonucleotide-directed mutagenesis. In pBHO.7A 13nt, the 11 nt consensus sequence, along with the 5' and 3' flanking nucleotides, has been deleted (Figure 5A). Figure 5B (left) shows that this 13 nt deletion abolished transcription initiation at the atpi promoter. We conclude that the deleted region contains an essential part of the atpl promoter. To determine if the two G(A/T)3-4 repeats immediately upstream of the 11 nt sequence are required for transcription initiation, these sequences were altered by nucleotide substitutions. In pBHO.7/BR21, the G(A/T)3_4 element located at nucleotides -13 to -9 was mutated and corresponding mutations were made to alter the G(A/T)3-4 element located at nucleotides -27 and -23 and generate pBHO.7/BR22 (Figure SA). In pBHO.7/BR21+22 both G(A/T)34 elements have been mutated. Figure SB (right) shows that pBHO.7, pBHO.7/BR21, pBHO.7/BR22 and pBHO.7/BR21+22 all directed similar levels of transcription (the differences in transcript levels seen in Figure SB were found not to be significant upon repetition of the experiment). Therefore, the G(A/T)34 repeats are not required for atpi promoter function in vitro, though we cannot rule out the possibility that these elements influence atpl transcription in vivo through an interaction with additional factor(s) that are not present in our transcription extract. Although the results presented in Figures 4 and 5 demonstrate that the 11 nt consensus motif includes sequences that are required for atpi transcription initiation, they do not prove that the 11 nt sequence alone constitutes a functional promoter. To determine if the atpl 11 nt consensus sequence is sufficient to promote transcription, an oligonucleotide with the same sequence (ACGTATTAAAA) was inserted upstream of three cloned DNA fragments that had no mitochondrial promoter activity (Figure 6A). In 1067
W.D.Rapp and D.B.Stern .A
-. 9?;AAA .f. .AA .. .1 A'.AAAIe GTATTAAA(AAAAAC p T A AA Ti '-"A TA AAA CAAAG. ;"AAAAc;TATA;. .CAAAG ...
A{xmT
A -'41
A A
.3 I
A 3. 4 3AC.AAAG ...A
A l ATTAAA CAAA G
L
CO
0
a
Kr-
i.
,--
I'4. +
nt 427
298 nt--
rn-rn
311
249
Fig. 4. Effects of 5' deletions on atpl transcription initiation in vitro. (A) The sequence of the atpl promoter region and the 5' deletion constructs described in Materials and methods are shown. The 11 nt (boxed) and G(A/T)3_4 (underlined) motifs are indicated, and an arrow indicates the transcription initiation site (+ 1). (B) pBHO.7 and the six 5' deletion constructs shown in Figure 4A were linearized with HindIII and used as templates in standard in vitro transcription reactions. Products were electrophoresed in a 4% denaturing polyacrylamide gel. Mobilities of DNA size standards are indicated in nt. The 298 nt atpl transcript is indicated.
p3'IR+ I1, the 11 bp sequence was inserted upstream of a fragment from the 3' non-coding region of the maize mitochondrial atp9 gene (R. M. Mulligan, personal communication). In p(-G) + I1, the 11 bp sequence was inserted upstream of a 'G-less' cassette (Sawadogo and Roeder, 1985), which encodes a 377 nt stretch of RNA devoid of G residues. In pCAB + 11, the 11 bp sequence was inserted upstream of a cDNA fragment corresponding to the 3' region of a pea chlorophyll a/b binding protein gene (Coruzzi et al., 1983). When assayed for in vitro activity, only p3'IR+ l I directed the synthesis of a transcript of the expected size (Figure 6B). Lane 3'IR shows that no discrete transcript was synthesized when the atp9 fragment alone was used as a template. Thus, although the 11 nt element alone does not appear to be sufficient to promote transcription initiation, it apparently contains enough of the promoter sequence to direct transcription initiation if placed in an appropriate sequence context (see Discussion). We cannot rule out, however, the possibility that transcriptionally inhibitory elements are fortuitously present in both p(-G)+l1 and pCAB+ 11.
1068
In vitro transcription initiation at the maize mitochondrial cox3 and atp6 promoters To determine if promoters other than atpl are active in our in vitro system, the promoters for the maize mitochondrial
encoding cytochrome oxidase subunit 3 (cox3) and ATPase subunit 6 (atp6) were tested. Three promoters for cox3 were previously mapped to a 1.4 kb fragment contained in clone pTL42 (Figure 7A; Mulligan et al., 1988a). The linearized clone was predicted to direct the synthesis of 215 and 175 nt transcripts, as well as a large transcript that could not be resolved in our gel system. As shown in Figure 7B (lane cox3), transcripts of the expected sizes were observed. We have confirmed by primer extension analysis that initiation in vitro and in vivo occurs at the same sites (A.Cobb, W.Rapp and D.Stern, unpublished data). Six promoters for atp6 have previously been mapped to a 1.1 kb fragment contained in clone pHBsN1. 1 (Figure 7A; R.M.Mulligan, personal communication). Figure 7B (lane atp6) shows that a predominant transcript of 330 nt was synthesized using this template. This was the size expected genes
-
Maize mitochondrial transcription
A. AA.-
L:7A::AAGCCALAAAGAfT7
ATTAAA -AA AAGT GT.T >, -v L A .AA CC GAAAAG ... AATGCCTT. TT A::AA:ATTAAAAG:AE-GTAAAAgA3A
AA: **.
TA-TATAAAGCCGAAAAG;:AiTA
AAA3
:-.
.CA
-I..-
.-.
T CGATit AATTTAAA"TA::AT:AA"ATTAAAAGTPAG:A
B. Y..
NC
BR22 / BR2 1--2 2
N + " N
ccmx m m X
CII
o o
z m
U
Cd1 N
-
JA IA 3 nt
m
298 nt
o6O r_ m
m
N 5f
Fig. 5. Effects of oligonucleotide-directed mutations on atpl transcription initiation in vitro. (A) Oligonucleotides were used to direct a deletion (see line replacing nucleotides -6 to +7 in pBHO.7A13 nt) or nucleotide substitutions (indicated by asterisks) in pBHO.7. The 11 nt (boxed) and G(A/T)3-4 (underlined) motifs are indicated. (B) Standard in vitro transcription reactions were performed using HindHI-linearized pBHO.7A13 nt (left), and pBHO.7/BR21, pBHO.7/BR22 and pBHO.7/BR21 +22 (right). For comparison, identical reactions using pBHO.7 were performed with each experiment (lanes pBHO.7). The 298 nt atpl transcripts are indicated.
if transcription initiated at the distal promoter, which is also the most active of the atp6 promoters in vivo, as determined by the relative abundance of primary transcripts (R. M. Mulligan, personal communication). In addition, minor transcripts of -240 and 160 nt were synthesized, along with several others ranging from 270 to 300 nt. The 240 and 160 nt transcripts were of the sizes expected if transcription initiated at two of the other atp6 promoters mapped to pHBsN1. 1 (Figure 7A).
Discussion We have developed and exploited a maize mitochondrial in vitro transcription system that accurately initiates transcription at several cloned maize mitochondrial promoters. Our analysis of atpl distinguishes this plant mitochondrial promoter from mitochondrial promoters of other organisms. Unlike the atpl promoter, which appears to consist of a single sequence block, mammalian mitochondrial promoters span - 50 nt and are bipartite (Clayton, 1991). Although the atpl promoter bears some resemblance to the highly conserved octanucleotide and nonanucleotide promoters of Xenopus laevis and S. cerevisiae (discussed below), our and others' analyses suggest that plant
mitochondrial promoters are relatively fluid in sequence. Furthermore, transcription initiates at different positions within the maize consensus sequence (Mulligan et al., 1991), although a similar consensus sequence can also be formed based on alignments at the initiation site (Lonsdale, 1989). This is in contrast to S. cerevisiae, in which initiation usually occurs at the last nucleotide of the nonanucleotide consensus sequence (Osinga and Tabak, 1982; Christianson and Rabinowitz, 1983). In general, the maize atpl promoter appears to resemble X. laevis and S. cerevisiae mitochondrial promoters more closely than mammalian promoters. Atp 1 promoter structure Our deletion mutagenesis studies suggest that essential upstream atpl promoter sequences lie within 19 nt of the transcription initiation site. Deletion of sequences to within 3 nt of the initiation site reduced transcription by 90-95%. This deletion replaced the first 2 nt of a conserved 11 nt motif with vector sequences, but did not appear to alter the initiation site. When the first three transcribed nucleotides were deleted, no promoter activity was detected. These results establish that a critical region of the atpl promoter is located between -3 and + 3 nt relative to the initiation site and suggest that at least part of the sequence between 1069
W.D.Rapp and D.B.Stern
.,!
:: :.
...
;-ess cassette
d.
:. 1?
rct;
i
..
._.
'*
A PiEt_r cb co._._i cDNA
4-
U..
7x.
, ei .,
cn
1-i
1-
-:.
rL. .0
u 71
427
i.
1Ii
.V:
330 298 nt
loo.
:1 x.
Am*
239_
249 230 nt
'200
Fig. 6. In vitro transcription of 11 nt insertion constructs. (A) An 11 bp fragment (11 nt box) with a sequence matching the consensus promoter of atpl was inserted upstream of three different cloned DNA fragments. In p3'IR +11 the promoter fragment was inserted upstream of a 0.3 kb fragment from the 3' non-coding region of the maize mitochondrial atp9 gene. In p( -G) +1, the promoter fragment was inserted upstream of a synthetic 0.4 kb fragment that encodes a 377 nt RNA devoid of G residues (G-less cassette). In pCAB(+ 11), the promoter fragment was inserted upstream of a 0.3 kb pea chlorophyll alb binding protein cDNA. Arrows show sizes of RNAs predicted from transcriptional run-off to the end of templates linearized by the indicated restriction endonucleases (Sc, SacI; B, BamHI; H, HindlIl). (B) The 11 nt insertion constructs and the corresponding clones lacking the 11 nt inserts described in Figure 6A were linearized (at the restriction sites shown in Figure 6A) and tested as templates using standard in vitro transcription conditions. Electrophoresis and size standards are as in Figure 4. The arrow indicates the 230 nt transcript directed by p3'IR + l1 nt.
nucleotides -19 to -4 is important in determining promoter strength. We cannot rule out the possibility that the decreased promoter activity associated with pBHO.7A-3 is due to a negative effect by some region of the vector that was brought into proximity of the atpl promoter in the construction of this plasmid. However, the observation that the atpl sequence from nucleotides -5 to + 6 (11 nt sequence) was insufficient to promote transcription in two out of three contexts tested (Figure 6; discussed below) indicates that part
1070
Fig. 7. In vitro transcription of maize mitochondrial atp6 and cox3 genes. (A) pTL42 and pHBsN1.1 contain 1.4 kb and 1.1 kb fragments from the 5' non-coding regions of maize mitochondrial cox3 and atp6 genes, respectively. Sites of transcription initiation in vivo for cox3 (Mulligan et al., 1988a) and for atp6 (R.M.Mulligan, personal communication) are indicated by arrows above the boxes (for pHBsN 1.1, the two arrows closest to the BstNI site each represent a pair of closely spaced transcription initiation sites). The predicted sizes of in vitro run-off transcripts for KpnI-linearized pTL42 and Sacllinearized pHBsN1 .1 are indicated by arrows under the boxes. Restriction sites are Bg, BglIl; Bs, BstNI; H, HindIII; K, KpnI; and X, XAoI. (B) HindIII-linearized pBHO.7 (lane atpl, see also Figure IA), SacI-linearized pHBsN1.1 (lane atp6) and KpnI-linearized pTL42 (lane cox3) were transcribed in vitro, and the products were electrophoresed in a 4% polyacrylamide denaturing gel. Arrows indicate in vitro transcripts and their sizes. Sizes were assigned based on primer extension data of in vitro transcripts (Figure 3 for atpl; Cobb, Rapp and Stem, unpublished data, for cox3) and the assumption that transcription proceeds to the ends of the linear templates. For atp6 transcripts (marked with asterisks), primer extension analysis has not been performed and sizes are based on predicted mobilities and DNA size standards.
of the sequence outside of this region is also important for promoter activity. Two conserved sequence motifs near the transcription initiation sites of a number of maize mitochondrial genes have been postulated to function as promoter elements
Maize mitochondrial transcription Promoter
activity
atpl atpl atp9 cox3 cox3
TAAGCCGAAAAGTP ...TAATATTAAAAGTP ...CTTGATATCGAATI ACAGATGAGAAATC ACGGATGAGAATTC ...
G(A/T)3-4
mutant
3'IR + 11 nt (-355) (-315)
G-less + 11 nt cab cDNA + 11 nt
...
...
...
...
CGTATTAAAI
ACGTATTAAA1 ACGTATTAAA-
ACGTATCTTAC kCGTATTCAAA
ACAA ACAA kATT... 'TAT... ..TGG... ...
+
...
CTAGTGGATCCCCC1ACGTATTAAA7I3GGC... GGCCAGTGAATTC ACGTATTATT- CCAT...
Fig. 8. Comparison of sequences with promoter activity. The atpl promoter (clone pBHO.7), atpl promoter G(A/T)3-4 sequence mutant (clone pBHO.7/BR2 1), atp9 3' inverted repeat (IR) with atpl 11 nt sequence insert (clone p3' IR+ l1) and the two cox3 promoters (at nucleotides -355 and -315 relative to cox3 coding sequence; clone pTL42) all function as promoters in vitro (indicated by '+'). Constructs in which the atpl 11 nt sequence has been inserted upstream of a G-less cassette [p(-G) +11] or cab cDNA (pCAB + 11) do not display promoter activity (indicated by '-'). Arrows indicate transcription initiation sites (those without arrows have not been mapped). Sequences conforming to the conserved 11 nt motif are boxed. Conserved nucleotides upstream of the 11 nt motif in sequences with promoter activity are underlined.
(Mulligan et al., 1991). We found that deletion of the conserved 11 nt motif that surrounds the transcription initiation site abolished promoter activity. A similar motif surrounds wheat mitochondrial transcription initiation sites (Covello and Gray, 1991). The other conserved motif has the sequence G(A/T)3 4 and is repeated one to several times upstream of the initiation sites of most maize mitochondrial genes. However, altering either or both of the G(A/T)3-4 sequences had no affect on promoter activity, indicating that they are not elements of the core atpi promoter. Although the G(A/T)3-4 elements were not found to contribute to atpi promoter function in vitro, we also found that the 11 nt sequence alone was insufficient for promoter activity (Figure 6). Figure 8 shows a comparison of sequences that function as promoters in vitro with those that do not. In addition to containing a variant of the 11 nt consensus sequence, each functional promoter contains adenosine and thymidine residues 4 and 2 nt upstream of the 11 nt motif, respectively. This is also true for the strongest atp6 promoter (Figure 7). These bases are not found in the two sequences that did not function as promoters. We therefore suggest that a specific nucleotide must be present at one or both of these positions for efficient promoter function, and that the maize mitochondrial promoter may extend 4 nt or more upstream of the conserved 11 nt motif. We have not yet explored the possibility that sequences downstream of the 11 nt sequence also play a role in promoter function. Mitochondrial promoter heterogeneity Mitochondrial promoters have now been analyzed by in vitro transcription for plants, animals and fungi. One class of promoters, of which S. cerevisiae (Constanzo and Fox, 1990), Neurospora crassa (Kennell and Lambowitz, 1989), X. laevis (Bogenhagen and Romanelli, 1988), sea urchin (Elliot and Jacobs, 1989) and maize atpi are representative, consist of a single sequence block of 9-15 nt. The maize atpi promoter (AGTAACGTATTAAA) is most similar to the X. laevis consensus promoter (ACGTTATA), but distinct from that of S. cerevisiae [(A/T)TATAAGTA]. The significance of these comparisons awaits a more detailed analysis of the maize atpi and other plant mitochondrial -
promoters.
The bipartite mammalian mitochondrial promoters represent a second class. These promoters contain an upstream binding site for the essential mitochondrial transcription factor mtTF1 (Clayton, 1991). A possible third
promoter class would include those of trypanosome mitochondria. A promoter consisting of an inverted repeat
and a consensus sequence 5'-RYAYA-3' was proposed by Pollard et al. for several Trypanosoma brucei guide RNA genes (Pollard et al., 1990), but this is clearly not universal for trypanosome mitochondria (Michelotti and Hajduk, 1987). Thus, sequence and structural diversity appear to be hallmarks of mitochondrial promoter structure as well as mitochondrial genome structure. Specificity of mitochondrial RNA polymerase activity Promoter-specific initiation in maize mitochondrial extracts required several purification steps. The lack of transcriptional specificity with crude RNA polymerase fractions was also observed in a wheat mitochondrial extract, and there are several possible explanations (Hanic-Joyce and Gray, 1991). For example, specific initiation may be dependent on a threshold concentration of transcription factors that is only attained in the final purification step. Alternatively, an activity that promotes non-specific initiation, or one that inhibits specific initiation, may have been removed. Although we have demonstrated specific transcription initiation at the maize atpl, cox3 and atp6 promoters (Figure 7), we have not been able to obtain efficient transcription of the maize mitochondrial 18S rRNA gene (data not shown). This suggests that while our RNA polymerase preparation has a general role in transcribing protein-coding genes, rDNA transcription may be carried out by a modified or distinct RNA polymerase activity. In nuclei and chloroplasts, protein-coding and ribosomal RNA genes are transcribed by biochemically separable RNA polymerase activities. For example, in chloroplasts a 'transcriptionally active chromosome' (TAC) activity that preferentially transcribes rRNA genes remains membraneassociated during purification of the soluble (protein-coding gene transcribing) RNA polymerase (Greenberg et al., 1984). Thus, it is possible that our extract lacks essential components for rDNA transcription, although we cannot rule out the possibility that the construct used (pHB650; Mulligan et al., 1988b) lacks a critical promoter element. Since pHB650 includes -480 nt upstream of the 18S rRNA initiation site, however, we feel that this explanation is unlikely. We therefore speculate either that the maize mitochondrial 18S rRNA gene is transcribed by a modified RNA polymerase, or that essential transcriptional factors differ from those that transcribe protein-coding genes. Since rRNA must be synthesized at a high rate relative to mRNA 1071
W.D.Rapp and D.B.Stern
(given similar turnover rates), an 'ideal' promoter sequence alone may not be sufficient to impart the necessary transcriptional activity. Conclusions The maize mitochondrial in vitro transcription system will allow a detailed characterization of regulatory sequences and proteins involved in the transcription initiation process in plant mitochondria. The development of mammalian, amphibian and fungal mitochondrial in vitro transcription systems has allowed the discovery of fundamental differences in the mitochondrial transcriptional machinery in these organisms (Schinkel and Tabak, 1989). It will be of interest to discover to what extent the components of the plant mitochondrial transcription complex resemble those of these other organisms. In addition, plant mitochondrial in vitro systems should enable us to expand our understanding of the transcriptional and post-transcriptional mechanisms underlying the expression of cytoplasmic male sterility.
Materials and methods Preparation of transcription extracts Maize inbred line B73 and hybrid lines B73 x Mol7, Mol7 x B73 and Pioneer brand 3377 were germinated and grown in the dark for 3-4 days. Intact mitochondria were isolated from etiolated maize seedlings by differential centrifugation of a crude homogenate, followed by Percoll density gradient centrifugation (Moore and Proudlove, 1983). The transcription extract was isolated according to a modification of the method used to isolate wheat mitochondrial transcriptional activity (Hanic-Joyce and Gray, 1991). Briefly, mitochondria were lysed in the presence of 1 M KCl and 0.5% Triton X-100. Centrifugation of the lysate at 100 000 g yielded a membranefree soluble protein fraction (S-100). The S-100 fraction was subjected to ammonium sulfate fractionation, and the 20-30% and 30-50% (w/v) ammonium sulfate fractions were combined and subjected to anion-exchange FPLC using a Pharmacia Mono-Q column. Proteins that bound in Buffer A [10 mM Tris-HCI pH 8.0, 50 mM KCI, 1 mM DTT, 0.1 mM EDTA, 7.5 % (w/v) glycerol] were eluted by KCI concentrations of 0. 1, 0.2, 0.3, 0.5 and 1.0 M. Protein concentrations were determined by the Bradford assay (Bradford, 1976). The fractions were dialyzed against Buffer A containing 10 mM KCI, concentrated using a Centricon microconcentrator (Amicon), rapidly frozen and stored at -80°C. In general, hybrid lines yielded transcription extracts with a higher specific activity. In vitro transcription reactions Standard in vitro transcription reactions contained 10 mM Tris-HCI pH 7.9, 10 mM MgCl2, 1 mM DTT, 0.5 mM each ATP, CTP and GTP, 25 jiM UTP, 10 /Ci [a-32P]UTP (800 Ci/mmol) and 40 U RNasin (Promega). Template DNA was added to a final concentration of 50 ,ug/ml, and 10-100 ag of protein per 12.5 ,1l reaction was included. Reactions were incubated at 30°C for 30 min and terminated by the addition of 37.5 itl stop mix [4.8 M urea, 0.4 M sodium acetate, 5.3 mM aurintricarboxylic acid, 26 Ag/ml tRNA, 0.8% (w/v) SDS], and immediately extracted with phenol/chloroform/isoamyl alcohol (24:24: 1). Following ethanol precipitation, the reaction products were resuspended in 80% formamide, 1 x TBE and electrophoresed in denaturing polyacrylamide gels.
Template DNA Poly(dA-dT) was purchased from Pharmacia. The following maize mitochondrial clones were kindly provided by R.M.Mulligan (University of California, Irvine): pBHO.7, containing atpl 5' flanking sequences (Mulligan et al., 1991); pBBstO.3, containing atp9 3' flanking sequences; pHBsN1. 1, containing atp6 5' flanking sequences (R.M.Mulligan, personal communication); pTL42, containing 5' flanking sequences from cox3 (Mulligan et al., 1988a) and pHB650, containing rrnl8 (18S rRNA gene) 5' flanking sequences (Mulligan et al., 1988b). Clone pC2AT, containing a guanosine-free (G-less) cassette, was generously provided by R.Roeder (Sawadogo and Roeder, 1985). Clone pLSK2 contains a 0.3 kb Hindll -PstI fragment derived from the chlorophyll alb binding protein cDNA clone pAB96 (Coruzzi et al., 1983). Deletion mutants pBHO.7A-141, pBHO.7A-101, pBHO.7A-31, pBH0.7zA -19, pBHO.7A-3 and pBHO.7A+4 were generated by E.coli exonuclease III digestion of BamHI-linearized pBHO.7 (Henikoff, 1984).
1072
The deletion end point (relative to the transcription initiation site) is indicated by the clone number. Oligonucleotide-directed mutagenesis of pBHO.7 was performed according to standard methods (Ausubel et al., 1990). To generate pBHO.7A13nt, oligonucleotide BR 1I (TTAAGCCGAAAAGTCAAAGTGAACAAAG) was used. To generate pBHO.7/BR21, BR21 (CTTGTTATTATTAATATTAAAAGTAACGTATTA) was used. BR22 (GTGCCCAGGAATAAITTAAATTATTATTAA) was used to generate pBHO.7/BR22. To generate pBHO.7/BR21 +22, BR22 was used to mutagenize pBHO.7/BR2 1. The 11 nt insertion constructs were made by annealing BR 17 (AGCTATTAAAA) and its complement (BR18) to create an 11 bp fragment, and inserting it into: (i) the blunt-ended EcoRI site flanking the pBBstO.3 insert (after subcloning of the insert into Bluescript SK(-) from Stratagene); (ii) the blunt-ended Sacl site flanking the pC2AT insert; (iii) the SmaI site flanking the pLSK2 insert. The identity of all constructs was verified by sequence analysis. For use as in vitro transcription templates, plasmids were purified by CsCl density gradient centrifugation, digested with appropriate restriction endonucleases, phenol/chloroform extracted and precipitated with ethanol.
Primer extension Mitochondrial RNA (mtRNA) was isolated as described (Stern and Newton, 1985) and in vitro-synthesized atpl RNA was purified from transcription reactions, except that aurintricarboxylic acid was omitted in both cases. All RNA was treated with RNase-free DNase I (Promega). Primer extension analysis of maize mtRNA and in vitro synthesized atpi RNA using the atpl-specific primer BR1O (5'-TAGGGCCAGCCTGGCTCAAC-3') was performed according to standard methods (Ausubel et al., 1990) using Superscript MMLV reverse transcriptase (Bethesda Research Laboratories). Hybridizations were performed at 30°C (in vitro-synthesized RNA) or 50°C (mtRNA). Sequencing reactions were performed using end-labeled BR1O and double-stranded plasmid DNA (Ausubel et al., 1990).
Acknowledaements We thank Dr M.Gray, Dr R.M.Mulligan and Dr K.Newton for their interest and helpful advice, and Dr R.M.Mulligan and Dr R.Roeder for gifts of plasmid clones. Pioneer brand seed was generously provided by Dr M.Albertson of Pioneer Hi-Bred International, Inc. This work was supported by grants from the Cornell Biotechnology Program, which is sponsored by the New York State Science and Technology Foundation, a consortium of industries, the US Army Research Office and the National Science Foundation, from the Cornell National Science Foundation Plant Science Center, a unit in the US Department of Agriculture/Department of Energy/NSF Plant Science Centers Program and a unit of the Cornell Biotechnology Program, and from the Cooperative State Research Service, US Department of Agriculture, under agreement no. 91-37301-6419.
References Ausubel,F.M., Brent,R., Kingston,R.G., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (eds), (1990) Current Protocols in Molecular Biology. Green Publishing Associates and Wiley Interscience, New York. Bogenhagen,D.F. and Romanelli,M.F. (1988) Mol. Cell. Biol., 8, 2917-2924.
Bradford,M. (1976) Anal. Biochem., 72, 248-254. Christianson,T. and Rabinowitz,M. (1983) J. Biol. Chem., 258, 14025-14033. Clayton,D.A. (1991) Trends Biochem Sci., 16, 107-111. Constanzo,M.C. and Fox,T.D. (1990) Annu. Rev. Genet., 24, 91-113. Coruzzi,G., Broglie,R., Cashmore,A. and Chua,N.-H. (1983) J. Biol. Chem., 258, 1399-1402. Covello,P.S. and Gray,M.W. (1991) Curr. Genet., 20, 245-251. Elliott,D.J. and Jacobs,H.T. (1989) Mol. Cell. Biol., 9, 1069-1082. Finnegan,P.M. and Brown,G.G. (1990) Plant Cell, 2, 71-83. Greenberg,B.M., Narita,J.O., DeLuca-Flaherty,C., Gruissem,W., Rushlow,K.A. and Hallick,R.B. (1984) J. Biol. Chem., 259, 14880-14887. Hanic-Joyce,P.J. and Gray,M.W. (1991) Mol. Cell. Biol., 11, 2035-2039. Henikoff,S. (1984) Gene, 28, 351-359. Kennell,J.C. and Lambowitz,A.M. (1989) Mol. Cell. Biol., 9, 3603-3613. Kennell,J.C. and Pring,D.R. (1989) Mol. Gen. Genet., 216, 16-24. Levings,C.S.III and Brown,G.G. (1989) Cell, 56, 171-179. Lonsdale,D.M. (1989) In Stumpf,P.K. and Conn,E.E. (eds), The Biochemistry of Plants. Academic Press, New York, Vol. 15, pp. 229-294.
Maize mitochondrial transcription Michelotti,E.F. and Hajduk,S.L. (1987) J. Biol. Chem., 262, 927-932. Moore,A.L. and Proudlove,M.O. (1983) In Hall,J.L. and Moore,A.L. (eds), Isolation of Membranes and Organelles from Plant Cells. Academic Press, London, pp. 153-184. Mulligan,R.M., Lau,G.T. and Walbot,V. (1988a) Proc. Natl. Acad. Sci. USA, 85, 7998-8002. Mulligan,R.M., Maloney,A.P. and Walbot,V. (1988b) Mol. Gen. Genet., 211, 373-380. Mulligan,R.M., Leon,P. and Walbot,V. (1991) Mol. Cell. Biol., 11, 533-543. Newton,K.J. (1988) Annu. Rev. Plant Physiol. Plant Mol. Biol., 39, 503-532. Orozco,E.M., Mullet,J.E. and Chua,N.-H. (1985) Nucleic Acids Res., 13, 1283-1302. Osinga,K.A. and Tabak,H.F. (1982) Nucleic Acids Res., 10, 3617-3626. Pollard,V.W., Rohrer,S.P., Michelotti,E.F., Hancock,K. and Hajduk,S.L. (1990) Cell, 63, 783-790. Sawadogo,M. and Roeder,R.G. (1985) Proc. Natl. Acad. Sci. USA, 82, 4394-4398. Shinkel,A.H. and Tabak,H.F. (1989) Trends Genet., 5, 149-154. Stem,D.B. and Newton,K.J. (1985) Curr. Genet., 9, 395-405. Tzagoloff,A. and Myers,A.M. (1986) Annu. Rev. Biochem., 55, 249-285. Weil,P.A., Luse,D.S., Segall,J. and Roeder,R.G. (1979) Cell, 18, 469-484. Received on September 9, 1991; revised on November 18, 1991
1073
A conserved 1 1 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene William D.Rapp and David B.Stern Boyce Thompson Institute for Plant Research, Cornell University, Tower Road, Ithaca, NY 14853, USA Communicated by D.Lonsdale
To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atpl promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within -19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atpl 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Key words: in vitro transcription/promoter/mitochondrial DNA/maize
Introduction Mitochondrial DNA (mtDNA) encodes several components of the respiratory chain, the F I-Fo ATPase and the mitochondrial translational apparatus. The organization and expression patterns of mitochondrial genomes vary widely between animals, fungi and plants. The vertebrate mitochondrial genome is 16 kb in size and genome-length precursor RNAs are synthesized from both DNA strands from promoters within the D loop (Tzagoloff and Myers, 1986; Clayton, 1991). The Saccharomyces cerevisiae mitochondrial genome is 75 kb in size and transcription initiates at 20 copies of a highly conserved nonanucleotide sequence (Constanzo and Fox, 1990). Plant mitochondria differ from their animal and fungal counterparts in that their genomes are large and that numerous transcripts can be identified from individual genes (Newton, 1988; Levings and Brown, 1989; Lonsdale, 1989). These complex transcript patterns result from the recombinogenic properties of plant mtDNA, promoter multiplicity for many genes and post-transcriptional processing events. Transcriptional run-on experiments in maize have -
-
Oxford University Press
demonstrated that each promoter has a characteristic strength, with the ribosomal RNA promoters being the strongest (Finnegan and Brown, 1990; Mulligan et al., 1991). Inspection of sequences surrounding transcription initiation sites in maize, defined by guanylyl transferase capping experiments, identified a putative 11 nucleotide (nt) promoter element with a loose consensus sequence (Mulligan et al., 1991). In addition, the repeated motif G(A/T)3_4 is found upstream of this element in some genes and the number of copies of this motif can be roughly correlated with promoter strength as judged by run-on transcription. Despite the progress that has been achieved in the analysis of plant mitochondrial gene expression, the mechanisms of transcriptional regulation have remained elusive. In particular, the inability to transcribe plant mtDNA in vitro has precluded the functional definition of promoter and transcription termination elements. To determine the structure of maize mitochondrial promoters, we have developed an in vitro transcription system. Our transcription system is similar to one from wheat that was recently reported to initiate accurately at the cox2 promoter (HanicJoyce and Gray, 1991). We have used the maize in vitro transcription system to study initiation at the atpl promoter (atpl encodes the ce-subunit of the F1 -FO ATPase). We demonstrate an absolute requirement for the proposed consensus promoter; however, the G(A/T)3_4 motif is dispensable in vitro. This is the first reported functional analysis of a plant mitochondrial promoter.
Results Development of a maize mitochondrial in vitro transcription system Plasmid pBHO.7, which contains the maize mitochondrial atpl promoter, was used to monitor in vitro transcription (Figure IA; see Mulligan et al., 1991). Atpl was chosen because, based on run-on transcription assays, it is one of the most actively transcribed protein-coding genes. Also, the atpl gene appears to utilize a single promoter, in contrast to most other maize mitochondrial protein-coding genes analyzed thus far (Mulligan et al., 1988a, 1988b, 1991; Kennell and Pring, 1989). To isolate mitochondrial protein fractions possessing promoter-specific transcriptional activity, a lysate of isolated mitochondria was clarified to yield a membrane-free soluble protein fraction (S-100). The S-100 fraction displayed nonspecific transcriptional activity when double-stranded poly(dA -dT) was used as a template, as evidenced by the incorporation of [a-32P]UTP into high molecular weight RNA (data not shown). This activity was enriched in 20-30% and 30-50% (w/v) ammonium sulfate fractions of the S-100 fraction. However, neither the S-100 nor the ammonium sulfate fractions initiated transcription at the atpl promoter in pBHO.7. The transcriptionally active ammonium sulfate fractions
1065
W.D.Rapp and D.B.Stern
were combined and subjected to anion-exchange FPLC and proteins were eluted by step-wise increases in KCl concentration (see Materials and methods). The resultant fractions were then assayed for transcriptional activity using HindIII-linearized pBHO.7; we found that a transcript of -300 nt was synthesized using proteins that eluted with 0.3 M KCl (Figure IB, lane 0.3). This was close in size to the 298 nt transcript expected if transcription initiated accurately and terminated at the end of the linear template. No product of this size was synthesized when HindIlllinearized vector replaced pBHO.7 as template (data not shown). The heterogeneous RNA migrating above the 300 nt transcript was observed using linearized vector, indicating that this RNA results from non-specific transcription of vector DNA. Similar non-specific transcriptional activities observed in other in vitro transcription systems have been attributed to non-specific initiation by RNA polymerase at nicks or ends of linear templates, or to the partial dissociation of a specificity factor from a core polymerase (Weil et al., 1979; Orozco et al., 1985; Hanic-Joyce and Gray, 1991).
However, since the synthesis of the 300 nt transcript is absolutely dependent upon atpl sequences and since initiation occurs precisely at the same site as atpl mRNA initiation in vivo (see below), this protein fraction can be used with confidence to investigate atpi promoter structure. In some preparations, protein that eluted with 0.2 M KCl also displayed a low level of atpl promoter-specific transcriptional activity (Figure iB, lane 0.2), but this fraction appeared to contain higher levels of non-specific transcriptional activity. Consequently, the 0.3 M KCl eluted fraction was used in all subsequent in vitro transcription experiments. Atp 1 transcription initiates accurately in vitro To establish that transcription initiates accurately at the atpi promoter in vitro, we first compared transcripts synthesized
using KpnI-linearized pBHO.7 with those synthesized using the HindIl-linearized template. KpnI cleaves pBHO.7 in the polylinker region 34 nt downstream of the HindlIl site (Figure IA). Thus, KpnI-linearized pBHO.7 should direct the synthesis of a 332 nt transcript. Figure 2 shows that transcripts of the expected sizes were indeed obtained using HindIII and KpnI-digested pBHO.7. To determine the precise site of transcription initiation in vitro, the 5' end of the 298 nt transcript was mapped by primer extension. An oligonucleotide complementary to the atpi sense strand was annealed to in vitro-synthesized RNA and to total RNA isolated from maize mitochondria, and cDNA synthesis was carried out using reverse transcriptase. Figure 3 shows that the primer extension products of in vitro-synthesized RNA and total maize mitochondrial RNA are identical (compare lanes 1 and 2). When in vitrosynthesized atpi RNA was treated with RNase A prior to hybridization with the primer, or when pBHO.7 template DNA was omitted from the in vitro transcription reaction,
4127
g_
311
Fig. 1. Assay of mitochondrial protein fractions for promoter-specific transcriptional activity. (A) pBHO.7 contains a 0.7 kb fragment from the 5' non-coding region of the maize mitochondrial atpl gene (Mulligan et al., 1991). The top arrow represents the atpl transcription initiation site. BamHI (B), HindlIl (H) and KpnI (K) restriction sites are indicated. The sizes of RNA molecules expected from initiation at the atpl promoter followed by transcriptional run-off of HindIII or KpnI linearized templates are indicated. (B) Proteins that eluted from a Pharmacia Mono-Q FPLC column in buffer containing 0.1, 0.2, 0.3 or 0.5 M KCI were assayed for promoter-specific transcriptional activity using HindIII-linearized pBH0.7 as a template (see Materials and methods). In vitro transcription products were electrophoresed in a 5% denaturing polyacrylamide gel. The arrow to the right indicates the 298 nt transcript. Mobilities of DNA size standards are indicated in nt.
1066
_k
332r
r
298 lrt.
249
Fig. 2. Run-off transcript analysis. pBHO.7 was linearized with HindlIl KpnI (see Figure IA) and used as a template in standard in vitro transcription reactions. Products were electrophoresed in a 5% denaturing polyacrylamide gel. Mobilities of DNA size standards are indicated in nt. HindIII and KpnI linearized templates direct the synthesis of 298 nt (lane H) and 332 nt (lane K) transcripts, respectively.
or
Maize mitochondrial transcription
no primer extension products were generated (Figure 3, lanes 3 and 4). This demonstrates that template-dependent RNA synthesis is occurring in vitro. Comparison of the primer extension products with the sequence ladder shows that the 5' ends of both the in vitro and in vivo-synthesized transcripts map to the previously identifed atpl transcription initiation site (Figure 3; Mulligan et al., 1991). This site lies within an 11 nt consensus sequence that was proposed to be a maize mitochondrial promoter element (Mulligan et al., 1991).
Upstream sequence requirements for atp 1 in vitro transcription To identify the extent of upstream sequences required for atpi transcription initiation, a series of 5' deletion constructs was generated (see Materials and methods; Figure 4A). Selected constructs were linearized and tested for their ability to direct transcription of a 298 nt RNA species as described above. Figure 4B shows that deletion of 5' non-transcribed
T
A
AT
A
T
TA
AT
T A _ J.-
AT TA T A AAA
_-sw.
_
TA T T
A
Fig. 3. Accurate in vitro transcription initiation at the atpi promoter. An end-labeled oligonucleotide (BRIO, see Materials and methods) was hybridized with maize mitochondrial RNA or with atpl RNA synthesized in vitro using HindUI linearized pBHO.7 as a template. Primers were extended using MMLV reverse transcriptase and electrophoresed in a 6% denaturing polyacrylamide gel. Lane 1, primer extension products from maize mitochondrial RNA; lane 2, primer extension products from in vitro-synthesized atpl RNA; lane 3, same as lane 2 except that RNA was treated with RNase A prior to hybridization with the primer; lane 4, same as lane 2 except pBHO.7 DNA was omitted from the in vitro transcription reaction.
Dideoxynucleotide sequencing reactions using the end-labeled primer and double-stranded pBHO.7 were run in adjacent lanes to allow the precise identification of the atpl RNA 5' ends. The sequence surrounding 5' ends is shown to the left. The in vivo transcription initiation site (arrow) and the conserved 11 nt motif (boxed sequence) are indicated (Mulligan et al., 1991).
sequences to within 19 nt of the transcription initiation site had no significant effect on in vitro transcriptional activity. Deletion of an additional 16 bp, however, reduced transcriptional activity by 90-95 % (Figure 4B; lane A -3). This deletion removes the first 2 nt of the consensus promoter. A deletion that extends 4 nt beyond the transcription initiation site abolished transcriptional activity (Figure 4B; lane z +4). As discussed above, it was previously proposed that the maize mitochondrial promoter consists of two elements, an 11 nt motif surrounding the transcription initiation site and an upstream G(A/T)3-4 motif that is present in one to several copies (Mulligan et al., 1991). Two G(A/T)3>4 sequences are found upstream of the atpl transcription initiation site, GTTAT at nucleotides -27 to -23 and GAAAA at -13 to -9. In pBHO.7A-19, the GTTAT sequence has been deleted, but a fortuitous G(A/T)3-4 sequence in the vector (GAATT) was brought into proximity of the initiation site (nucleotides -26 to -22) during the construction of this mutant. Therefore, while the observation that template pBHO.7A -19 supports accurate initiation allows us to conclude that there is not a requirement for specific sequences upstream of nucleotide -19, it does not allow us to draw any conclusions about the role of the G(A/T)3-4 repeats in promoting atpl transcription. Role of conserved motifs in promoting transcription To determine if the 11 nt and G(A/T)3-4 sequences are absolutely required for transcription initiation, these sequences were specifically deleted from or altered in the atpl promoter by oligonucleotide-directed mutagenesis. In pBHO.7A 13nt, the 11 nt consensus sequence, along with the 5' and 3' flanking nucleotides, has been deleted (Figure 5A). Figure 5B (left) shows that this 13 nt deletion abolished transcription initiation at the atpi promoter. We conclude that the deleted region contains an essential part of the atpl promoter. To determine if the two G(A/T)3-4 repeats immediately upstream of the 11 nt sequence are required for transcription initiation, these sequences were altered by nucleotide substitutions. In pBHO.7/BR21, the G(A/T)3_4 element located at nucleotides -13 to -9 was mutated and corresponding mutations were made to alter the G(A/T)3-4 element located at nucleotides -27 and -23 and generate pBHO.7/BR22 (Figure SA). In pBHO.7/BR21+22 both G(A/T)34 elements have been mutated. Figure SB (right) shows that pBHO.7, pBHO.7/BR21, pBHO.7/BR22 and pBHO.7/BR21+22 all directed similar levels of transcription (the differences in transcript levels seen in Figure SB were found not to be significant upon repetition of the experiment). Therefore, the G(A/T)34 repeats are not required for atpi promoter function in vitro, though we cannot rule out the possibility that these elements influence atpl transcription in vivo through an interaction with additional factor(s) that are not present in our transcription extract. Although the results presented in Figures 4 and 5 demonstrate that the 11 nt consensus motif includes sequences that are required for atpi transcription initiation, they do not prove that the 11 nt sequence alone constitutes a functional promoter. To determine if the atpl 11 nt consensus sequence is sufficient to promote transcription, an oligonucleotide with the same sequence (ACGTATTAAAA) was inserted upstream of three cloned DNA fragments that had no mitochondrial promoter activity (Figure 6A). In 1067
W.D.Rapp and D.B.Stern .A
-. 9?;AAA .f. .AA .. .1 A'.AAAIe GTATTAAA(AAAAAC p T A AA Ti '-"A TA AAA CAAAG. ;"AAAAc;TATA;. .CAAAG ...
A{xmT
A -'41
A A
.3 I
A 3. 4 3AC.AAAG ...A
A l ATTAAA CAAA G
L
CO
0
a
Kr-
i.
,--
I'4. +
nt 427
298 nt--
rn-rn
311
249
Fig. 4. Effects of 5' deletions on atpl transcription initiation in vitro. (A) The sequence of the atpl promoter region and the 5' deletion constructs described in Materials and methods are shown. The 11 nt (boxed) and G(A/T)3_4 (underlined) motifs are indicated, and an arrow indicates the transcription initiation site (+ 1). (B) pBHO.7 and the six 5' deletion constructs shown in Figure 4A were linearized with HindIII and used as templates in standard in vitro transcription reactions. Products were electrophoresed in a 4% denaturing polyacrylamide gel. Mobilities of DNA size standards are indicated in nt. The 298 nt atpl transcript is indicated.
p3'IR+ I1, the 11 bp sequence was inserted upstream of a fragment from the 3' non-coding region of the maize mitochondrial atp9 gene (R. M. Mulligan, personal communication). In p(-G) + I1, the 11 bp sequence was inserted upstream of a 'G-less' cassette (Sawadogo and Roeder, 1985), which encodes a 377 nt stretch of RNA devoid of G residues. In pCAB + 11, the 11 bp sequence was inserted upstream of a cDNA fragment corresponding to the 3' region of a pea chlorophyll a/b binding protein gene (Coruzzi et al., 1983). When assayed for in vitro activity, only p3'IR+ l I directed the synthesis of a transcript of the expected size (Figure 6B). Lane 3'IR shows that no discrete transcript was synthesized when the atp9 fragment alone was used as a template. Thus, although the 11 nt element alone does not appear to be sufficient to promote transcription initiation, it apparently contains enough of the promoter sequence to direct transcription initiation if placed in an appropriate sequence context (see Discussion). We cannot rule out, however, the possibility that transcriptionally inhibitory elements are fortuitously present in both p(-G)+l1 and pCAB+ 11.
1068
In vitro transcription initiation at the maize mitochondrial cox3 and atp6 promoters To determine if promoters other than atpl are active in our in vitro system, the promoters for the maize mitochondrial
encoding cytochrome oxidase subunit 3 (cox3) and ATPase subunit 6 (atp6) were tested. Three promoters for cox3 were previously mapped to a 1.4 kb fragment contained in clone pTL42 (Figure 7A; Mulligan et al., 1988a). The linearized clone was predicted to direct the synthesis of 215 and 175 nt transcripts, as well as a large transcript that could not be resolved in our gel system. As shown in Figure 7B (lane cox3), transcripts of the expected sizes were observed. We have confirmed by primer extension analysis that initiation in vitro and in vivo occurs at the same sites (A.Cobb, W.Rapp and D.Stern, unpublished data). Six promoters for atp6 have previously been mapped to a 1.1 kb fragment contained in clone pHBsN1. 1 (Figure 7A; R.M.Mulligan, personal communication). Figure 7B (lane atp6) shows that a predominant transcript of 330 nt was synthesized using this template. This was the size expected genes
-
Maize mitochondrial transcription
A. AA.-
L:7A::AAGCCALAAAGAfT7
ATTAAA -AA AAGT GT.T >, -v L A .AA CC GAAAAG ... AATGCCTT. TT A::AA:ATTAAAAG:AE-GTAAAAgA3A
AA: **.
TA-TATAAAGCCGAAAAG;:AiTA
AAA3
:-.
.CA
-I..-
.-.
T CGATit AATTTAAA"TA::AT:AA"ATTAAAAGTPAG:A
B. Y..
NC
BR22 / BR2 1--2 2
N + " N
ccmx m m X
CII
o o
z m
U
Cd1 N
-
JA IA 3 nt
m
298 nt
o6O r_ m
m
N 5f
Fig. 5. Effects of oligonucleotide-directed mutations on atpl transcription initiation in vitro. (A) Oligonucleotides were used to direct a deletion (see line replacing nucleotides -6 to +7 in pBHO.7A13 nt) or nucleotide substitutions (indicated by asterisks) in pBHO.7. The 11 nt (boxed) and G(A/T)3-4 (underlined) motifs are indicated. (B) Standard in vitro transcription reactions were performed using HindHI-linearized pBHO.7A13 nt (left), and pBHO.7/BR21, pBHO.7/BR22 and pBHO.7/BR21 +22 (right). For comparison, identical reactions using pBHO.7 were performed with each experiment (lanes pBHO.7). The 298 nt atpl transcripts are indicated.
if transcription initiated at the distal promoter, which is also the most active of the atp6 promoters in vivo, as determined by the relative abundance of primary transcripts (R. M. Mulligan, personal communication). In addition, minor transcripts of -240 and 160 nt were synthesized, along with several others ranging from 270 to 300 nt. The 240 and 160 nt transcripts were of the sizes expected if transcription initiated at two of the other atp6 promoters mapped to pHBsN1. 1 (Figure 7A).
Discussion We have developed and exploited a maize mitochondrial in vitro transcription system that accurately initiates transcription at several cloned maize mitochondrial promoters. Our analysis of atpl distinguishes this plant mitochondrial promoter from mitochondrial promoters of other organisms. Unlike the atpl promoter, which appears to consist of a single sequence block, mammalian mitochondrial promoters span - 50 nt and are bipartite (Clayton, 1991). Although the atpl promoter bears some resemblance to the highly conserved octanucleotide and nonanucleotide promoters of Xenopus laevis and S. cerevisiae (discussed below), our and others' analyses suggest that plant
mitochondrial promoters are relatively fluid in sequence. Furthermore, transcription initiates at different positions within the maize consensus sequence (Mulligan et al., 1991), although a similar consensus sequence can also be formed based on alignments at the initiation site (Lonsdale, 1989). This is in contrast to S. cerevisiae, in which initiation usually occurs at the last nucleotide of the nonanucleotide consensus sequence (Osinga and Tabak, 1982; Christianson and Rabinowitz, 1983). In general, the maize atpl promoter appears to resemble X. laevis and S. cerevisiae mitochondrial promoters more closely than mammalian promoters. Atp 1 promoter structure Our deletion mutagenesis studies suggest that essential upstream atpl promoter sequences lie within 19 nt of the transcription initiation site. Deletion of sequences to within 3 nt of the initiation site reduced transcription by 90-95%. This deletion replaced the first 2 nt of a conserved 11 nt motif with vector sequences, but did not appear to alter the initiation site. When the first three transcribed nucleotides were deleted, no promoter activity was detected. These results establish that a critical region of the atpl promoter is located between -3 and + 3 nt relative to the initiation site and suggest that at least part of the sequence between 1069
W.D.Rapp and D.B.Stern
.,!
:: :.
...
;-ess cassette
d.
:. 1?
rct;
i
..
._.
'*
A PiEt_r cb co._._i cDNA
4-
U..
7x.
, ei .,
cn
1-i
1-
-:.
rL. .0
u 71
427
i.
1Ii
.V:
330 298 nt
loo.
:1 x.
Am*
239_
249 230 nt
'200
Fig. 6. In vitro transcription of 11 nt insertion constructs. (A) An 11 bp fragment (11 nt box) with a sequence matching the consensus promoter of atpl was inserted upstream of three different cloned DNA fragments. In p3'IR +11 the promoter fragment was inserted upstream of a 0.3 kb fragment from the 3' non-coding region of the maize mitochondrial atp9 gene. In p( -G) +1, the promoter fragment was inserted upstream of a synthetic 0.4 kb fragment that encodes a 377 nt RNA devoid of G residues (G-less cassette). In pCAB(+ 11), the promoter fragment was inserted upstream of a 0.3 kb pea chlorophyll alb binding protein cDNA. Arrows show sizes of RNAs predicted from transcriptional run-off to the end of templates linearized by the indicated restriction endonucleases (Sc, SacI; B, BamHI; H, HindlIl). (B) The 11 nt insertion constructs and the corresponding clones lacking the 11 nt inserts described in Figure 6A were linearized (at the restriction sites shown in Figure 6A) and tested as templates using standard in vitro transcription conditions. Electrophoresis and size standards are as in Figure 4. The arrow indicates the 230 nt transcript directed by p3'IR + l1 nt.
nucleotides -19 to -4 is important in determining promoter strength. We cannot rule out the possibility that the decreased promoter activity associated with pBHO.7A-3 is due to a negative effect by some region of the vector that was brought into proximity of the atpl promoter in the construction of this plasmid. However, the observation that the atpl sequence from nucleotides -5 to + 6 (11 nt sequence) was insufficient to promote transcription in two out of three contexts tested (Figure 6; discussed below) indicates that part
1070
Fig. 7. In vitro transcription of maize mitochondrial atp6 and cox3 genes. (A) pTL42 and pHBsN1.1 contain 1.4 kb and 1.1 kb fragments from the 5' non-coding regions of maize mitochondrial cox3 and atp6 genes, respectively. Sites of transcription initiation in vivo for cox3 (Mulligan et al., 1988a) and for atp6 (R.M.Mulligan, personal communication) are indicated by arrows above the boxes (for pHBsN 1.1, the two arrows closest to the BstNI site each represent a pair of closely spaced transcription initiation sites). The predicted sizes of in vitro run-off transcripts for KpnI-linearized pTL42 and Sacllinearized pHBsN1 .1 are indicated by arrows under the boxes. Restriction sites are Bg, BglIl; Bs, BstNI; H, HindIII; K, KpnI; and X, XAoI. (B) HindIII-linearized pBHO.7 (lane atpl, see also Figure IA), SacI-linearized pHBsN1.1 (lane atp6) and KpnI-linearized pTL42 (lane cox3) were transcribed in vitro, and the products were electrophoresed in a 4% polyacrylamide denaturing gel. Arrows indicate in vitro transcripts and their sizes. Sizes were assigned based on primer extension data of in vitro transcripts (Figure 3 for atpl; Cobb, Rapp and Stem, unpublished data, for cox3) and the assumption that transcription proceeds to the ends of the linear templates. For atp6 transcripts (marked with asterisks), primer extension analysis has not been performed and sizes are based on predicted mobilities and DNA size standards.
of the sequence outside of this region is also important for promoter activity. Two conserved sequence motifs near the transcription initiation sites of a number of maize mitochondrial genes have been postulated to function as promoter elements
Maize mitochondrial transcription Promoter
activity
atpl atpl atp9 cox3 cox3
TAAGCCGAAAAGTP ...TAATATTAAAAGTP ...CTTGATATCGAATI ACAGATGAGAAATC ACGGATGAGAATTC ...
G(A/T)3-4
mutant
3'IR + 11 nt (-355) (-315)
G-less + 11 nt cab cDNA + 11 nt
...
...
...
...
CGTATTAAAI
ACGTATTAAA1 ACGTATTAAA-
ACGTATCTTAC kCGTATTCAAA
ACAA ACAA kATT... 'TAT... ..TGG... ...
+
...
CTAGTGGATCCCCC1ACGTATTAAA7I3GGC... GGCCAGTGAATTC ACGTATTATT- CCAT...
Fig. 8. Comparison of sequences with promoter activity. The atpl promoter (clone pBHO.7), atpl promoter G(A/T)3-4 sequence mutant (clone pBHO.7/BR2 1), atp9 3' inverted repeat (IR) with atpl 11 nt sequence insert (clone p3' IR+ l1) and the two cox3 promoters (at nucleotides -355 and -315 relative to cox3 coding sequence; clone pTL42) all function as promoters in vitro (indicated by '+'). Constructs in which the atpl 11 nt sequence has been inserted upstream of a G-less cassette [p(-G) +11] or cab cDNA (pCAB + 11) do not display promoter activity (indicated by '-'). Arrows indicate transcription initiation sites (those without arrows have not been mapped). Sequences conforming to the conserved 11 nt motif are boxed. Conserved nucleotides upstream of the 11 nt motif in sequences with promoter activity are underlined.
(Mulligan et al., 1991). We found that deletion of the conserved 11 nt motif that surrounds the transcription initiation site abolished promoter activity. A similar motif surrounds wheat mitochondrial transcription initiation sites (Covello and Gray, 1991). The other conserved motif has the sequence G(A/T)3 4 and is repeated one to several times upstream of the initiation sites of most maize mitochondrial genes. However, altering either or both of the G(A/T)3-4 sequences had no affect on promoter activity, indicating that they are not elements of the core atpi promoter. Although the G(A/T)3-4 elements were not found to contribute to atpi promoter function in vitro, we also found that the 11 nt sequence alone was insufficient for promoter activity (Figure 6). Figure 8 shows a comparison of sequences that function as promoters in vitro with those that do not. In addition to containing a variant of the 11 nt consensus sequence, each functional promoter contains adenosine and thymidine residues 4 and 2 nt upstream of the 11 nt motif, respectively. This is also true for the strongest atp6 promoter (Figure 7). These bases are not found in the two sequences that did not function as promoters. We therefore suggest that a specific nucleotide must be present at one or both of these positions for efficient promoter function, and that the maize mitochondrial promoter may extend 4 nt or more upstream of the conserved 11 nt motif. We have not yet explored the possibility that sequences downstream of the 11 nt sequence also play a role in promoter function. Mitochondrial promoter heterogeneity Mitochondrial promoters have now been analyzed by in vitro transcription for plants, animals and fungi. One class of promoters, of which S. cerevisiae (Constanzo and Fox, 1990), Neurospora crassa (Kennell and Lambowitz, 1989), X. laevis (Bogenhagen and Romanelli, 1988), sea urchin (Elliot and Jacobs, 1989) and maize atpi are representative, consist of a single sequence block of 9-15 nt. The maize atpi promoter (AGTAACGTATTAAA) is most similar to the X. laevis consensus promoter (ACGTTATA), but distinct from that of S. cerevisiae [(A/T)TATAAGTA]. The significance of these comparisons awaits a more detailed analysis of the maize atpi and other plant mitochondrial -
promoters.
The bipartite mammalian mitochondrial promoters represent a second class. These promoters contain an upstream binding site for the essential mitochondrial transcription factor mtTF1 (Clayton, 1991). A possible third
promoter class would include those of trypanosome mitochondria. A promoter consisting of an inverted repeat
and a consensus sequence 5'-RYAYA-3' was proposed by Pollard et al. for several Trypanosoma brucei guide RNA genes (Pollard et al., 1990), but this is clearly not universal for trypanosome mitochondria (Michelotti and Hajduk, 1987). Thus, sequence and structural diversity appear to be hallmarks of mitochondrial promoter structure as well as mitochondrial genome structure. Specificity of mitochondrial RNA polymerase activity Promoter-specific initiation in maize mitochondrial extracts required several purification steps. The lack of transcriptional specificity with crude RNA polymerase fractions was also observed in a wheat mitochondrial extract, and there are several possible explanations (Hanic-Joyce and Gray, 1991). For example, specific initiation may be dependent on a threshold concentration of transcription factors that is only attained in the final purification step. Alternatively, an activity that promotes non-specific initiation, or one that inhibits specific initiation, may have been removed. Although we have demonstrated specific transcription initiation at the maize atpl, cox3 and atp6 promoters (Figure 7), we have not been able to obtain efficient transcription of the maize mitochondrial 18S rRNA gene (data not shown). This suggests that while our RNA polymerase preparation has a general role in transcribing protein-coding genes, rDNA transcription may be carried out by a modified or distinct RNA polymerase activity. In nuclei and chloroplasts, protein-coding and ribosomal RNA genes are transcribed by biochemically separable RNA polymerase activities. For example, in chloroplasts a 'transcriptionally active chromosome' (TAC) activity that preferentially transcribes rRNA genes remains membraneassociated during purification of the soluble (protein-coding gene transcribing) RNA polymerase (Greenberg et al., 1984). Thus, it is possible that our extract lacks essential components for rDNA transcription, although we cannot rule out the possibility that the construct used (pHB650; Mulligan et al., 1988b) lacks a critical promoter element. Since pHB650 includes -480 nt upstream of the 18S rRNA initiation site, however, we feel that this explanation is unlikely. We therefore speculate either that the maize mitochondrial 18S rRNA gene is transcribed by a modified RNA polymerase, or that essential transcriptional factors differ from those that transcribe protein-coding genes. Since rRNA must be synthesized at a high rate relative to mRNA 1071
W.D.Rapp and D.B.Stern
(given similar turnover rates), an 'ideal' promoter sequence alone may not be sufficient to impart the necessary transcriptional activity. Conclusions The maize mitochondrial in vitro transcription system will allow a detailed characterization of regulatory sequences and proteins involved in the transcription initiation process in plant mitochondria. The development of mammalian, amphibian and fungal mitochondrial in vitro transcription systems has allowed the discovery of fundamental differences in the mitochondrial transcriptional machinery in these organisms (Schinkel and Tabak, 1989). It will be of interest to discover to what extent the components of the plant mitochondrial transcription complex resemble those of these other organisms. In addition, plant mitochondrial in vitro systems should enable us to expand our understanding of the transcriptional and post-transcriptional mechanisms underlying the expression of cytoplasmic male sterility.
Materials and methods Preparation of transcription extracts Maize inbred line B73 and hybrid lines B73 x Mol7, Mol7 x B73 and Pioneer brand 3377 were germinated and grown in the dark for 3-4 days. Intact mitochondria were isolated from etiolated maize seedlings by differential centrifugation of a crude homogenate, followed by Percoll density gradient centrifugation (Moore and Proudlove, 1983). The transcription extract was isolated according to a modification of the method used to isolate wheat mitochondrial transcriptional activity (Hanic-Joyce and Gray, 1991). Briefly, mitochondria were lysed in the presence of 1 M KCl and 0.5% Triton X-100. Centrifugation of the lysate at 100 000 g yielded a membranefree soluble protein fraction (S-100). The S-100 fraction was subjected to ammonium sulfate fractionation, and the 20-30% and 30-50% (w/v) ammonium sulfate fractions were combined and subjected to anion-exchange FPLC using a Pharmacia Mono-Q column. Proteins that bound in Buffer A [10 mM Tris-HCI pH 8.0, 50 mM KCI, 1 mM DTT, 0.1 mM EDTA, 7.5 % (w/v) glycerol] were eluted by KCI concentrations of 0. 1, 0.2, 0.3, 0.5 and 1.0 M. Protein concentrations were determined by the Bradford assay (Bradford, 1976). The fractions were dialyzed against Buffer A containing 10 mM KCI, concentrated using a Centricon microconcentrator (Amicon), rapidly frozen and stored at -80°C. In general, hybrid lines yielded transcription extracts with a higher specific activity. In vitro transcription reactions Standard in vitro transcription reactions contained 10 mM Tris-HCI pH 7.9, 10 mM MgCl2, 1 mM DTT, 0.5 mM each ATP, CTP and GTP, 25 jiM UTP, 10 /Ci [a-32P]UTP (800 Ci/mmol) and 40 U RNasin (Promega). Template DNA was added to a final concentration of 50 ,ug/ml, and 10-100 ag of protein per 12.5 ,1l reaction was included. Reactions were incubated at 30°C for 30 min and terminated by the addition of 37.5 itl stop mix [4.8 M urea, 0.4 M sodium acetate, 5.3 mM aurintricarboxylic acid, 26 Ag/ml tRNA, 0.8% (w/v) SDS], and immediately extracted with phenol/chloroform/isoamyl alcohol (24:24: 1). Following ethanol precipitation, the reaction products were resuspended in 80% formamide, 1 x TBE and electrophoresed in denaturing polyacrylamide gels.
Template DNA Poly(dA-dT) was purchased from Pharmacia. The following maize mitochondrial clones were kindly provided by R.M.Mulligan (University of California, Irvine): pBHO.7, containing atpl 5' flanking sequences (Mulligan et al., 1991); pBBstO.3, containing atp9 3' flanking sequences; pHBsN1. 1, containing atp6 5' flanking sequences (R.M.Mulligan, personal communication); pTL42, containing 5' flanking sequences from cox3 (Mulligan et al., 1988a) and pHB650, containing rrnl8 (18S rRNA gene) 5' flanking sequences (Mulligan et al., 1988b). Clone pC2AT, containing a guanosine-free (G-less) cassette, was generously provided by R.Roeder (Sawadogo and Roeder, 1985). Clone pLSK2 contains a 0.3 kb Hindll -PstI fragment derived from the chlorophyll alb binding protein cDNA clone pAB96 (Coruzzi et al., 1983). Deletion mutants pBHO.7A-141, pBHO.7A-101, pBHO.7A-31, pBH0.7zA -19, pBHO.7A-3 and pBHO.7A+4 were generated by E.coli exonuclease III digestion of BamHI-linearized pBHO.7 (Henikoff, 1984).
1072
The deletion end point (relative to the transcription initiation site) is indicated by the clone number. Oligonucleotide-directed mutagenesis of pBHO.7 was performed according to standard methods (Ausubel et al., 1990). To generate pBHO.7A13nt, oligonucleotide BR 1I (TTAAGCCGAAAAGTCAAAGTGAACAAAG) was used. To generate pBHO.7/BR21, BR21 (CTTGTTATTATTAATATTAAAAGTAACGTATTA) was used. BR22 (GTGCCCAGGAATAAITTAAATTATTATTAA) was used to generate pBHO.7/BR22. To generate pBHO.7/BR21 +22, BR22 was used to mutagenize pBHO.7/BR2 1. The 11 nt insertion constructs were made by annealing BR 17 (AGCTATTAAAA) and its complement (BR18) to create an 11 bp fragment, and inserting it into: (i) the blunt-ended EcoRI site flanking the pBBstO.3 insert (after subcloning of the insert into Bluescript SK(-) from Stratagene); (ii) the blunt-ended Sacl site flanking the pC2AT insert; (iii) the SmaI site flanking the pLSK2 insert. The identity of all constructs was verified by sequence analysis. For use as in vitro transcription templates, plasmids were purified by CsCl density gradient centrifugation, digested with appropriate restriction endonucleases, phenol/chloroform extracted and precipitated with ethanol.
Primer extension Mitochondrial RNA (mtRNA) was isolated as described (Stern and Newton, 1985) and in vitro-synthesized atpl RNA was purified from transcription reactions, except that aurintricarboxylic acid was omitted in both cases. All RNA was treated with RNase-free DNase I (Promega). Primer extension analysis of maize mtRNA and in vitro synthesized atpi RNA using the atpl-specific primer BR1O (5'-TAGGGCCAGCCTGGCTCAAC-3') was performed according to standard methods (Ausubel et al., 1990) using Superscript MMLV reverse transcriptase (Bethesda Research Laboratories). Hybridizations were performed at 30°C (in vitro-synthesized RNA) or 50°C (mtRNA). Sequencing reactions were performed using end-labeled BR1O and double-stranded plasmid DNA (Ausubel et al., 1990).
Acknowledaements We thank Dr M.Gray, Dr R.M.Mulligan and Dr K.Newton for their interest and helpful advice, and Dr R.M.Mulligan and Dr R.Roeder for gifts of plasmid clones. Pioneer brand seed was generously provided by Dr M.Albertson of Pioneer Hi-Bred International, Inc. This work was supported by grants from the Cornell Biotechnology Program, which is sponsored by the New York State Science and Technology Foundation, a consortium of industries, the US Army Research Office and the National Science Foundation, from the Cornell National Science Foundation Plant Science Center, a unit in the US Department of Agriculture/Department of Energy/NSF Plant Science Centers Program and a unit of the Cornell Biotechnology Program, and from the Cooperative State Research Service, US Department of Agriculture, under agreement no. 91-37301-6419.
References Ausubel,F.M., Brent,R., Kingston,R.G., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (eds), (1990) Current Protocols in Molecular Biology. Green Publishing Associates and Wiley Interscience, New York. Bogenhagen,D.F. and Romanelli,M.F. (1988) Mol. Cell. Biol., 8, 2917-2924.
Bradford,M. (1976) Anal. Biochem., 72, 248-254. Christianson,T. and Rabinowitz,M. (1983) J. Biol. Chem., 258, 14025-14033. Clayton,D.A. (1991) Trends Biochem Sci., 16, 107-111. Constanzo,M.C. and Fox,T.D. (1990) Annu. Rev. Genet., 24, 91-113. Coruzzi,G., Broglie,R., Cashmore,A. and Chua,N.-H. (1983) J. Biol. Chem., 258, 1399-1402. Covello,P.S. and Gray,M.W. (1991) Curr. Genet., 20, 245-251. Elliott,D.J. and Jacobs,H.T. (1989) Mol. Cell. Biol., 9, 1069-1082. Finnegan,P.M. and Brown,G.G. (1990) Plant Cell, 2, 71-83. Greenberg,B.M., Narita,J.O., DeLuca-Flaherty,C., Gruissem,W., Rushlow,K.A. and Hallick,R.B. (1984) J. Biol. Chem., 259, 14880-14887. Hanic-Joyce,P.J. and Gray,M.W. (1991) Mol. Cell. Biol., 11, 2035-2039. Henikoff,S. (1984) Gene, 28, 351-359. Kennell,J.C. and Lambowitz,A.M. (1989) Mol. Cell. Biol., 9, 3603-3613. Kennell,J.C. and Pring,D.R. (1989) Mol. Gen. Genet., 216, 16-24. Levings,C.S.III and Brown,G.G. (1989) Cell, 56, 171-179. Lonsdale,D.M. (1989) In Stumpf,P.K. and Conn,E.E. (eds), The Biochemistry of Plants. Academic Press, New York, Vol. 15, pp. 229-294.
Maize mitochondrial transcription Michelotti,E.F. and Hajduk,S.L. (1987) J. Biol. Chem., 262, 927-932. Moore,A.L. and Proudlove,M.O. (1983) In Hall,J.L. and Moore,A.L. (eds), Isolation of Membranes and Organelles from Plant Cells. Academic Press, London, pp. 153-184. Mulligan,R.M., Lau,G.T. and Walbot,V. (1988a) Proc. Natl. Acad. Sci. USA, 85, 7998-8002. Mulligan,R.M., Maloney,A.P. and Walbot,V. (1988b) Mol. Gen. Genet., 211, 373-380. Mulligan,R.M., Leon,P. and Walbot,V. (1991) Mol. Cell. Biol., 11, 533-543. Newton,K.J. (1988) Annu. Rev. Plant Physiol. Plant Mol. Biol., 39, 503-532. Orozco,E.M., Mullet,J.E. and Chua,N.-H. (1985) Nucleic Acids Res., 13, 1283-1302. Osinga,K.A. and Tabak,H.F. (1982) Nucleic Acids Res., 10, 3617-3626. Pollard,V.W., Rohrer,S.P., Michelotti,E.F., Hancock,K. and Hajduk,S.L. (1990) Cell, 63, 783-790. Sawadogo,M. and Roeder,R.G. (1985) Proc. Natl. Acad. Sci. USA, 82, 4394-4398. Shinkel,A.H. and Tabak,H.F. (1989) Trends Genet., 5, 149-154. Stem,D.B. and Newton,K.J. (1985) Curr. Genet., 9, 395-405. Tzagoloff,A. and Myers,A.M. (1986) Annu. Rev. Biochem., 55, 249-285. Weil,P.A., Luse,D.S., Segall,J. and Roeder,R.G. (1979) Cell, 18, 469-484. Received on September 9, 1991; revised on November 18, 1991
1073
