Gene, 110 (1992) 235-238 © 1992 Elsevier Science Publishers B.V. All rights reserved. 0378-1119/92/$05.00
235
GENE 06233
A highly repetitive DNA sequence possibly unique to canids (Canisfamiliaris; dog; repetitive element; nucleotide sequence; short interspersed nucleotide element; interferon)
Michael F. Minnick*, Lisa C. Stillwell, Jill M. Heineman and Gary L. Stiegler Pacific Northwest Laboratories, Richland, WA 99352 (U.S.A.) Received by D.M. Skinner: 27 March 1991 Revised/Accepted: 3 July/16 October 1991 Received at publishers: 22 October 1991
SUMMARY
A short interspersed nucleotide (nt) element (SINE) was cloned from the genomic DNA of the domestic dog, Canis familiaris. Southern-blot analysis of canine DNA digested with four restriction endonucleases indicated that the SINE is widely dispersed throughout the genome. Hybridizations also indicated that the element may be unique to canids and is absent in a variety of other mammals, including members of four closely-related carnivore families. Three examples of the SINE have been located and sequenced. The 130-bp SINE contains putative RNA polymerase III transcriptional control sequences. The SINE is flanked at the 3' end by a (TC)s-repeat region followed by a poly(A) tract of 35-65 nt. Computer database searches located two homologous sequences with approx. 80% identity to the SINE. These sequences were located in untranslated regions of the canine genes encoding interferon-o~ and clotting factor IX.
Two general classes of repetitive elements occur in eukaryotic genomes. The first is arranged in multiple tandem repeats of a closely-related sequence family. These families occur in long contiguous stretches of DNA which exist as heterochromatin. Such satellite DNAs, as they are called, are located in chromosome centromeric regions (Brutlag, 1980; Miklos, 1985). A second class of repetitive element arises by retroposition. During retroposition RNA is reverse transcribed into multiple DNA copies which subsequently integrate into the chromosome to form retropseudogenes or shortand long-interspersed nt elements (SINEs and LINEs, re-
spectively) (Weiner et al., 1986). These repetitive elements are usually scattered throughout chromosomal DNA (Jelinek and Schmid, 1982). Very little is known regarding the function of SINEs and LINEs. SINEs are probably retropseudogenes originating from class Ill genes encoding small cytoplasmic RNAs including 7SL RNA (Ullu and Tschudi, 1984) and tRNAs (Daniels and Deininger, 1985). Although once thought of as nonfunctional, the evolutionary importance of retroposons has been suggested (Brosius, 1991). To date, most of the characterized SINEs are from rodents, primates and ungulates (Deininger, 1989). In this report we present data on the cloning and characterization of a SINE from the domestic dog, C. familiaris.
Correspondence to: Dr. G.L. Stiegler, Biology Department, Battelle, Pacific Northwest Laboratories, Mail Stop P7-56, Richland, WA 99352 (U.S.A.) Tel. (509)376-1914; Fax (509)376-9449 * Present address: Division of Biological Sciences, University of Montana, Missoula, MT 59812-1002 (U.S.A.) Tel. (406)243-5122.
Abbreviations: bp, base pair(s); EtdBr, ethidium bromide; kb, kilobase(s) or 1000 bp; LINE, long interspersed nt element; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; SDS, sodium dodecyl sulfate; SINE, short interspersed nt element; SSC, 0.15 M NaCI/0.015 M Na3'citrate pH 7.5; UWGCG, University of Wisconsin Genetics Computer Group.
INTRODUCTION
236 EXPERIMENTAL AND DISCUSSION
1
2
3
4
(a) Cloning of the repetitive element Genomic DNA from C. familiaris was digested to completion with BamHI and shotgun cloned into pUC19 (Yanisch-Perron et al., 1985) by standard methods (Maniatis et al., 1982). Recombinant DNA was transformed into E. cog DHS0c (Chung et al., 1989). Colony blots were screened under conditions which favored repetitive DNA detection using [~)2p]dCTP-labeled dog genomic DNA as the probe (Shen and Maniatis, 1980). A recombinant clone (pK9328) producing the most intense autoradiograph signal was further characterized. The pK9328 plasmid conrains a 956-bp BamHI insert (Fig. 1). The isolated insert was labeled (Feinberg and Vogelstein, 1984) and used to probe Southern blots of oligo-digested dog genomic DNA. An intense signal was produced throughout the blot, suggesting that the insert possessed a widely dispersed repetitive sequence (data not shown).
(b) Identification and nt sequence analysis of the S I N E The 956-bp BamHl insert of pK9328 was sequenced to determine if it contained tandem repeats as seen in satellite DNAs. Instead, the results showed a 130-bp inverted repeat beginning at both flanking BamHI sites of the insert (Fig. 1). To determine if the 130-bp repeat was the repetitive sequence, oligo-digested dog genomic DNA was blotted and probed with the 66-bp BamHI-SmaI inverted repeat subfragment (Fig. 1). Intense hybridization signals appeared as smears regardless of restriction endonuclease type (Fig. 2). Hybridization signals were not restricted to satellite bands which were plainly visible on EtdBr-stained agarose gels. Southern blot data show that the element is a SINE. The nt consensus sequence of the SINE was determined from the two inverted repeats in pK9328 and an element in a clone designated pBH I0 containing the intron between the first and second exon of canine N-ras (Fig. 3). The three elements have 92-969/0 nt identity with one another. Divergent sequences are a common SINE feature (Jelinek and Schmid, 1982). The 5' and 3' borders of the three sequenced SINEs and the two homologues from the database (discussed below) were distinguished by areas of extensive nt divergence. To confirm the assigned borders we B $ •..-..l~ I
I
A
~
I
III
IS
B I
I
2OO bp
Fig. 1. Partial restriction of the BamHl insert of pK9328. Solid bars indicate the 130-bp SINE inverted repeat positions. An arrow indicates the transcriptional direction of the pUC 19 lacZ~ gene. The 66-bp Ban)~ilSinai subfragment used as a SINE probe (Figs. 2, 4) is indicatef2 by a hatched bar. A, Alul; B, BamHl; N, Nsil, S, Smal.
23.1 -9.4-6.6-4.4--
2 . 3 ---2.0"-"
0.56 --
Fig, 2, Detectionofthe canine SINE by DNA-DNAhybridization. C.familiaris genomic DNA was purified from spleen by standard procedures (Maniatis et al., 1982),digested to completion with AluI, HaeIII, Pstl or Sau3AI (lanes 1-4, respectively),and then separatedon a 1% agarosegel. The gel was blotted to Gene Screen Flus as directed by the manufacturer (NEN). The BamHI-Smal subfragment of the SINE (see Fig. 1) served as the probe and was labeled with [2J2P]dCTP by the methods of Fein. berg and Vogelstein(1984). The probe was hybridized overnight at 50°C in 5 x SSC/5x Denhardt's mix/20mM Tris pH 8.0/! mM EDTA/I% SDS/20 #g per ml salmon spermDNA, Filters were subsequentlywashed 4 times for 30 min at 50°C in I x SSC/I ~ SDS, then autoradiographed. Phage AHindIII DNA size standards are given in kb on the left margin. The autoradiograph is shown. probed dog genomic blots as in Fig. 2 with synthetic oligos based on sequences flanking the SINE, but found no significant hybridization (data not shown). Taken as a whole, these data suggest that the entire SiNE is represented in
Fig. 1. Since retroposition is thought to require the reverse transcription of RNA polymerase III transcripts, we examined the SINE to determine if potential internal polymerase control regions were present. Putative A and B boxes are shown in Fig. 3. The putative A box of the SINE is very similar to the polymerase IIIA box consensus sequence 5 ' T G G C N N A G T N G G and contains the highly conserved T at the 5' end of the box and a G T G G C sequence at the 3' end. Likewise, the putative B box is very similar to the
237 BamHX
A Box
B Box
1 GGATCCCTGGGTGGCGCACGGTTTGGCGCCTGCCTTTGGCCAGGGCGTG 2 GGATCCCTGGGTGGCGCACGGTTTGGCGCCTGCCTTTGGCCAGGGCGTG GGATCCCTGGGTGGCTCA~GGTTTCGCATCTGT_CTTAGGCC~GGGCA__CG Sma2 1 ATCCTGGAGACCCGGGATCGAATCCCACATCGGGCTCCCGGTGCATGGA
Xnezon
2 ATCCTGGAGACCCGGGATCGAATCCCAC.~.TCGGGCTCCCGGTGCATGGA Zntzon
AT CCTGGAGACCC_AGGATA_.GA_GTCCCACATCGGGGTCCC~TGCATGGA
Z
GCCTGCTTCTCCCTCTGCCTGTGTCTCTGCG
2
GCG_TGCTTCTCCCTCTGCCTGTGTCTCTGT._G
Zmtzon G C C T G C T T C T C C C T C T G C C T G T G T C T C T G C ~
Fig. 3. The nt sequence of the 130-bp SINEs. The sequence for both strands of the repetitive element was determined in pK9328 ~ d pBH10 by the dideoxy chain-termination method (Sanger et al., 1977) using Sequenase Version 2.0 (U.S. Biochemical). Double-stranded DNA was primed with M 13 universal and reverse primers or alternativelywith synthetic 17-meroligos(AppliedBiosystemsDNA Synthesizer,model 380A). Template DNA was prepared by standard methods from E. coliDH50eby alkaline lysis, followed by an EtdBr-CsCI gradient centrifugation (Maniatis et ai., 1982). SINE sequences 1 and 2 are the inverted repeats from pK9328 and the intron SINE was determined from pBH 10. Sequence 1 is the referenceconsensus sequence for nt comparison and is assigned the EMBL accession No. X57357. The putative A and B boxes for RNA polymerase Ill transcriptional control are indicated. The nt differences between 1 and 2 are underscored, insertion is indicated by a boxed nt and deletion by a closed triangle. 5 ' - G G T T C G A N N C C boxB conse.~sus sequence (Deiningot, 1989). The four nt spacer size separating the putative A and B boxes of the SINE is probably suboptimal for transcriptional activity, although spacing between these regions can vary considerably (Deininger, 1989). Sequence analysis of the SINE flanking regions show that a (TC)s repeat is located 4-10 nt downstream from the 3' end. The (TC) repeat is followed by a poly(A) D N A tract of 35-65 nt. An occasional T interrupts the poly(A) sequence to form numerous (up to 14) T A A A T or TAAAAT direct repeats. A string of ten As is the longest uninterrupted poly(A) sequence observed. The 5 ' - T A A A A T repeats in the 3' flanking region have two direct repeat counterparts which occur in tandem 37 nt upstream (5') from the element in pBH 10. T A A A A T is also present in direct repeats which flank the human U3 snRNA retropseudogene (VanArsdell et al., 1981). The presence of a 3' poly(A) tail and remnants of direct repeats which flank the element is characteristic of SINEs (Deininger, 1989). Computer searches of EMBL and GenBank databases using U W G C G software (Devereux et al., 1984) located two sequences with approx. 8 0 ~ identity to the SINE. Both of the sequences are from untranslated regions of canine c D N A clones and include interferon-co with 8 4 ~ identity (Himmler et al., 1987) and clotting factor IX with 78To identity (Axelrod et al., 1990) to the SINE. The 3' sequences which flank the database homologues are similar to the 3' regions for the SINEs reported here; containing both the (TC)-repeat region followed by a poly(A) tract.
However, except for direct repeats, there is little conservation of 5' flanking sequences in any of the SINEs. We did not find significant homology to noncanid sequences in the databases, including well characterized SINEs such as the alu family. In addition, there was no significant homology to the major centromeric dog satellite DNAs (CFA-SAT) or grey fox DNAs (UCI-SAT) (Fanning, 1989).
(c) Specificity of the SINE to canids Dot blot analysis was done to determine if the element is common to a variety of other mammals. D N A of representative species from families belonging to the order Carnivora, supeffamily Canoidea, including Canidae (grey fox, dog), Ursidae (black bear), Procyonidae (raccoon), and Mustelidae (ferret) were probed. The order Carnivora, superfamily Feloidea was represented by the Felidae family (domestic cat). In addition we probed a variety of D N A s from human and rodents. At approx. 25 ~o DNA mismatch, only the canids and the recombinant pK9328 show hybridization signal (Fig. 4). Since grey fox and the domestic dog are the most distantly-related members of the Canidae family (Wayne and O'Brien, 1987), we hypothesize that more closely-related canids such as coyote or wolf also share the SINE, however this remains to be proven. Lack of hybridization to the human and rodent DNAs (Fig. 4) suggests that the SINE could serve as a probe for canine D N A transfected into commonly used human or rodent cell lines.
(d) Conclusions (1) The highly reiterated SINE is 130 bp in length, widely dispersed, and apparently located in untranslated regions of the dog genome. (2) The nt sequence of the SINE shows divergence from 4~o in pBH10 to 22% in clotting factor IX and contains putative A and B boxes with homology to the consensus sequences for internal transcriptional control of R N A polymerase III. The 3' end of the SINE is followed by a (TC)s repeat and a poly(A) tract interrupted by an occasional T residue to form numerous T A A A T and TAAAAT direct
!
2
3
4
5
6
7
8
g
10
II ~-~
Fig. 4. Specificityof the repetitive element to canids as determined by DNA-DNA hybridization.Genomic DNA was isolated from mammalian tissues or cell lines by standard protocols (Maniatis et al., 1982). Approx. 4 pg of each purified DNA was denatured in 100/al 0.4 M NaOH/0.6 M NaCl for 5 min at 25 °C then dot-blotted to Gone Screen Plus (NEN). The filter was neutralized in two 5 x SSC washes for 15 rain, and then probed and washed as in Fig. 2. DNA samples: I, domestic dog (spleen); 2, grey fox (Folu); 3, black bear (muscle); 4, raccoon (PL1UT); 5, ferret (Mpf); 6, domestic cat (ovary); 7, mouse (NIH3T3); 8, rat (L2); 9, Chinese hamster (CHO-K1); 10, human (placenta); 1I, the pK9328 recombinant. The autoradiograph is shown.
238 repeats. The 5' flanking sequences of the S I N E are poorly conserved but also contain direct repeats of T A A A A T . (3) Homologues to the S I N E were found in untranslated regions of canine b l o o d clotting factor IX a n d canine interferon-to sequences from the G e n B a n k database. (4) Since the S I N E is n o t detectable by hybridizations to D N A from representatives of closely-related carnivores or other mammals, it may be unique to the C a n i d a e family.
ACKNOWLEDGEMENTS This research was supported by the U.S. D e p a r t m e n t of Energy under contract No. D E - A C O 6 - 7 6 R L O 1830.
REFERENCES Axelrod, J.H., Read, M,S., Brinkhaus, K.M. and Verma, I.M.: Phenotypic correction of factor IX deficiency in skin fibroblasts of hemophilic dogs. Proc. Natl. Aead. Sci. USA 87 (1990) 5173-5177. Brosius, J.: Retroposons-seeds of evolution. Science 251 (1991) 753. Brutlag, D.L.: Molecular arrangement and evolution of heterochromatic DNA. Annu. Rev. Genet. 14 (1980) 121-144. Chung, C.T., Niemela, S.L. and Miller, R.H.: One-step preparation of competent Escherichia coil: transformation and storage of bacterial cells in the same solution. Prec. Natl. Acad. Sci. USA 86 (1989) 2172-2175. Daniels, G.R. and Deininger, P.L.: Several major mammalian SINE families are derived from tRNA genes. Nature 317 (1985) 819-822. Deininger, P.L.: SINEs: short interspersed repeated DNA elements in higher eucaryotes. In: Berg, D.E. and Howe, M.M. (Eds.), Mobile DNA. AmericanSoc. Microbiol.,Washington,DC, 1989,pp. 619-636. Devereux, J., Haeberli, P. and Smithies, O.: A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12 (1984) 387-395.
Fanning, 'r.G.: Molecular evolution of centromere-associated nucleotide sequences in two species of canids. Gene 85 (1989) 559-563. Feinberg, A.P. and Vogelstein, B.: A technique for radiolabelling DNA restriction endonuclease fragments to high specificactivity.Anal. Biochem. 137 ~!984) 266-267. Himmler, A., Hauptmann, R., Adolf, G.R. and Swetly, P.: Structure and ex[,ression in Escherichia coli ~f canine interferon-~ genes. J. Interferon Res. 7 (~987) 173-183. Jelinek, W.R. and Schmid, C.W.: Repetitive sequences in eukaryotic DN,'.~ and their expression. Annu. Rev. i]~ochem. 51 (1982) 813-844. Maniatis, 'F., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Miklos, G.L,G.: Localized highlyrepetitive DNA sequences in vertebrate and invertebrate ge•omes. In: Maclntyre, R.J. (Ed.), Molecular Evolutionary Genetics. Plenum, New York, 1985, pp. 241-321. Sanger, F., Nicklen, S. and Coulson A.R.: DNA sequencingwith chainterminating inhibitors. Prec. Natl. Acad. Sci. USA 74 (1977) 50~635467. Shen, C.K.J. and Maniatis, T.: The organk:a!ion of repetitive sequences in a cluster of rabbit/~-like globin genes. Cell 19 (1980) 379-391. ¢zybalski, W.: Use of cesium sulfate for equilibrium density gradient centrifugation. Methods Enzymol. 12B (1968) 330-360. Uil, E. and Tschudi, C.: Alu sequences are processed 7SL RNA genes. Nature 312 (1984) 171-172. VanArsdell, S.W., Denison, R.A., Bernstein, L.B., Weiner,A.M., Manser, T. and Ges~.eland,R.F.: Direct repeats flank three small nuclear RNA pseudogenes in the ~lman genome. Cell 26 (1981) I 1-17. Wayne, R.K. and O'Bfien, S..I.: Molecular phylogeny of the dog family (Canidae) based on isozyme genetic distance. Syst. Zool. 36 (1987) 339-355. Weiner, A.M., Deiningel, P.L. and Efstratiadis, A.: Nonviral retroposons: genes, pseudogenes and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55 0986) 631-661. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 phage cloning vectors and host strains: nucleotide sequences of the Ml3mpl9 and pUCI9 vectors. Gent 33 (1985) 103-119.
235
GENE 06233
A highly repetitive DNA sequence possibly unique to canids (Canisfamiliaris; dog; repetitive element; nucleotide sequence; short interspersed nucleotide element; interferon)
Michael F. Minnick*, Lisa C. Stillwell, Jill M. Heineman and Gary L. Stiegler Pacific Northwest Laboratories, Richland, WA 99352 (U.S.A.) Received by D.M. Skinner: 27 March 1991 Revised/Accepted: 3 July/16 October 1991 Received at publishers: 22 October 1991
SUMMARY
A short interspersed nucleotide (nt) element (SINE) was cloned from the genomic DNA of the domestic dog, Canis familiaris. Southern-blot analysis of canine DNA digested with four restriction endonucleases indicated that the SINE is widely dispersed throughout the genome. Hybridizations also indicated that the element may be unique to canids and is absent in a variety of other mammals, including members of four closely-related carnivore families. Three examples of the SINE have been located and sequenced. The 130-bp SINE contains putative RNA polymerase III transcriptional control sequences. The SINE is flanked at the 3' end by a (TC)s-repeat region followed by a poly(A) tract of 35-65 nt. Computer database searches located two homologous sequences with approx. 80% identity to the SINE. These sequences were located in untranslated regions of the canine genes encoding interferon-o~ and clotting factor IX.
Two general classes of repetitive elements occur in eukaryotic genomes. The first is arranged in multiple tandem repeats of a closely-related sequence family. These families occur in long contiguous stretches of DNA which exist as heterochromatin. Such satellite DNAs, as they are called, are located in chromosome centromeric regions (Brutlag, 1980; Miklos, 1985). A second class of repetitive element arises by retroposition. During retroposition RNA is reverse transcribed into multiple DNA copies which subsequently integrate into the chromosome to form retropseudogenes or shortand long-interspersed nt elements (SINEs and LINEs, re-
spectively) (Weiner et al., 1986). These repetitive elements are usually scattered throughout chromosomal DNA (Jelinek and Schmid, 1982). Very little is known regarding the function of SINEs and LINEs. SINEs are probably retropseudogenes originating from class Ill genes encoding small cytoplasmic RNAs including 7SL RNA (Ullu and Tschudi, 1984) and tRNAs (Daniels and Deininger, 1985). Although once thought of as nonfunctional, the evolutionary importance of retroposons has been suggested (Brosius, 1991). To date, most of the characterized SINEs are from rodents, primates and ungulates (Deininger, 1989). In this report we present data on the cloning and characterization of a SINE from the domestic dog, C. familiaris.
Correspondence to: Dr. G.L. Stiegler, Biology Department, Battelle, Pacific Northwest Laboratories, Mail Stop P7-56, Richland, WA 99352 (U.S.A.) Tel. (509)376-1914; Fax (509)376-9449 * Present address: Division of Biological Sciences, University of Montana, Missoula, MT 59812-1002 (U.S.A.) Tel. (406)243-5122.
Abbreviations: bp, base pair(s); EtdBr, ethidium bromide; kb, kilobase(s) or 1000 bp; LINE, long interspersed nt element; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; SDS, sodium dodecyl sulfate; SINE, short interspersed nt element; SSC, 0.15 M NaCI/0.015 M Na3'citrate pH 7.5; UWGCG, University of Wisconsin Genetics Computer Group.
INTRODUCTION
236 EXPERIMENTAL AND DISCUSSION
1
2
3
4
(a) Cloning of the repetitive element Genomic DNA from C. familiaris was digested to completion with BamHI and shotgun cloned into pUC19 (Yanisch-Perron et al., 1985) by standard methods (Maniatis et al., 1982). Recombinant DNA was transformed into E. cog DHS0c (Chung et al., 1989). Colony blots were screened under conditions which favored repetitive DNA detection using [~)2p]dCTP-labeled dog genomic DNA as the probe (Shen and Maniatis, 1980). A recombinant clone (pK9328) producing the most intense autoradiograph signal was further characterized. The pK9328 plasmid conrains a 956-bp BamHI insert (Fig. 1). The isolated insert was labeled (Feinberg and Vogelstein, 1984) and used to probe Southern blots of oligo-digested dog genomic DNA. An intense signal was produced throughout the blot, suggesting that the insert possessed a widely dispersed repetitive sequence (data not shown).
(b) Identification and nt sequence analysis of the S I N E The 956-bp BamHl insert of pK9328 was sequenced to determine if it contained tandem repeats as seen in satellite DNAs. Instead, the results showed a 130-bp inverted repeat beginning at both flanking BamHI sites of the insert (Fig. 1). To determine if the 130-bp repeat was the repetitive sequence, oligo-digested dog genomic DNA was blotted and probed with the 66-bp BamHI-SmaI inverted repeat subfragment (Fig. 1). Intense hybridization signals appeared as smears regardless of restriction endonuclease type (Fig. 2). Hybridization signals were not restricted to satellite bands which were plainly visible on EtdBr-stained agarose gels. Southern blot data show that the element is a SINE. The nt consensus sequence of the SINE was determined from the two inverted repeats in pK9328 and an element in a clone designated pBH I0 containing the intron between the first and second exon of canine N-ras (Fig. 3). The three elements have 92-969/0 nt identity with one another. Divergent sequences are a common SINE feature (Jelinek and Schmid, 1982). The 5' and 3' borders of the three sequenced SINEs and the two homologues from the database (discussed below) were distinguished by areas of extensive nt divergence. To confirm the assigned borders we B $ •..-..l~ I
I
A
~
I
III
IS
B I
I
2OO bp
Fig. 1. Partial restriction of the BamHl insert of pK9328. Solid bars indicate the 130-bp SINE inverted repeat positions. An arrow indicates the transcriptional direction of the pUC 19 lacZ~ gene. The 66-bp Ban)~ilSinai subfragment used as a SINE probe (Figs. 2, 4) is indicatef2 by a hatched bar. A, Alul; B, BamHl; N, Nsil, S, Smal.
23.1 -9.4-6.6-4.4--
2 . 3 ---2.0"-"
0.56 --
Fig, 2, Detectionofthe canine SINE by DNA-DNAhybridization. C.familiaris genomic DNA was purified from spleen by standard procedures (Maniatis et al., 1982),digested to completion with AluI, HaeIII, Pstl or Sau3AI (lanes 1-4, respectively),and then separatedon a 1% agarosegel. The gel was blotted to Gene Screen Flus as directed by the manufacturer (NEN). The BamHI-Smal subfragment of the SINE (see Fig. 1) served as the probe and was labeled with [2J2P]dCTP by the methods of Fein. berg and Vogelstein(1984). The probe was hybridized overnight at 50°C in 5 x SSC/5x Denhardt's mix/20mM Tris pH 8.0/! mM EDTA/I% SDS/20 #g per ml salmon spermDNA, Filters were subsequentlywashed 4 times for 30 min at 50°C in I x SSC/I ~ SDS, then autoradiographed. Phage AHindIII DNA size standards are given in kb on the left margin. The autoradiograph is shown. probed dog genomic blots as in Fig. 2 with synthetic oligos based on sequences flanking the SINE, but found no significant hybridization (data not shown). Taken as a whole, these data suggest that the entire SiNE is represented in
Fig. 1. Since retroposition is thought to require the reverse transcription of RNA polymerase III transcripts, we examined the SINE to determine if potential internal polymerase control regions were present. Putative A and B boxes are shown in Fig. 3. The putative A box of the SINE is very similar to the polymerase IIIA box consensus sequence 5 ' T G G C N N A G T N G G and contains the highly conserved T at the 5' end of the box and a G T G G C sequence at the 3' end. Likewise, the putative B box is very similar to the
237 BamHX
A Box
B Box
1 GGATCCCTGGGTGGCGCACGGTTTGGCGCCTGCCTTTGGCCAGGGCGTG 2 GGATCCCTGGGTGGCGCACGGTTTGGCGCCTGCCTTTGGCCAGGGCGTG GGATCCCTGGGTGGCTCA~GGTTTCGCATCTGT_CTTAGGCC~GGGCA__CG Sma2 1 ATCCTGGAGACCCGGGATCGAATCCCACATCGGGCTCCCGGTGCATGGA
Xnezon
2 ATCCTGGAGACCCGGGATCGAATCCCAC.~.TCGGGCTCCCGGTGCATGGA Zntzon
AT CCTGGAGACCC_AGGATA_.GA_GTCCCACATCGGGGTCCC~TGCATGGA
Z
GCCTGCTTCTCCCTCTGCCTGTGTCTCTGCG
2
GCG_TGCTTCTCCCTCTGCCTGTGTCTCTGT._G
Zmtzon G C C T G C T T C T C C C T C T G C C T G T G T C T C T G C ~
Fig. 3. The nt sequence of the 130-bp SINEs. The sequence for both strands of the repetitive element was determined in pK9328 ~ d pBH10 by the dideoxy chain-termination method (Sanger et al., 1977) using Sequenase Version 2.0 (U.S. Biochemical). Double-stranded DNA was primed with M 13 universal and reverse primers or alternativelywith synthetic 17-meroligos(AppliedBiosystemsDNA Synthesizer,model 380A). Template DNA was prepared by standard methods from E. coliDH50eby alkaline lysis, followed by an EtdBr-CsCI gradient centrifugation (Maniatis et ai., 1982). SINE sequences 1 and 2 are the inverted repeats from pK9328 and the intron SINE was determined from pBH 10. Sequence 1 is the referenceconsensus sequence for nt comparison and is assigned the EMBL accession No. X57357. The putative A and B boxes for RNA polymerase Ill transcriptional control are indicated. The nt differences between 1 and 2 are underscored, insertion is indicated by a boxed nt and deletion by a closed triangle. 5 ' - G G T T C G A N N C C boxB conse.~sus sequence (Deiningot, 1989). The four nt spacer size separating the putative A and B boxes of the SINE is probably suboptimal for transcriptional activity, although spacing between these regions can vary considerably (Deininger, 1989). Sequence analysis of the SINE flanking regions show that a (TC)s repeat is located 4-10 nt downstream from the 3' end. The (TC) repeat is followed by a poly(A) D N A tract of 35-65 nt. An occasional T interrupts the poly(A) sequence to form numerous (up to 14) T A A A T or TAAAAT direct repeats. A string of ten As is the longest uninterrupted poly(A) sequence observed. The 5 ' - T A A A A T repeats in the 3' flanking region have two direct repeat counterparts which occur in tandem 37 nt upstream (5') from the element in pBH 10. T A A A A T is also present in direct repeats which flank the human U3 snRNA retropseudogene (VanArsdell et al., 1981). The presence of a 3' poly(A) tail and remnants of direct repeats which flank the element is characteristic of SINEs (Deininger, 1989). Computer searches of EMBL and GenBank databases using U W G C G software (Devereux et al., 1984) located two sequences with approx. 8 0 ~ identity to the SINE. Both of the sequences are from untranslated regions of canine c D N A clones and include interferon-co with 8 4 ~ identity (Himmler et al., 1987) and clotting factor IX with 78To identity (Axelrod et al., 1990) to the SINE. The 3' sequences which flank the database homologues are similar to the 3' regions for the SINEs reported here; containing both the (TC)-repeat region followed by a poly(A) tract.
However, except for direct repeats, there is little conservation of 5' flanking sequences in any of the SINEs. We did not find significant homology to noncanid sequences in the databases, including well characterized SINEs such as the alu family. In addition, there was no significant homology to the major centromeric dog satellite DNAs (CFA-SAT) or grey fox DNAs (UCI-SAT) (Fanning, 1989).
(c) Specificity of the SINE to canids Dot blot analysis was done to determine if the element is common to a variety of other mammals. D N A of representative species from families belonging to the order Carnivora, supeffamily Canoidea, including Canidae (grey fox, dog), Ursidae (black bear), Procyonidae (raccoon), and Mustelidae (ferret) were probed. The order Carnivora, superfamily Feloidea was represented by the Felidae family (domestic cat). In addition we probed a variety of D N A s from human and rodents. At approx. 25 ~o DNA mismatch, only the canids and the recombinant pK9328 show hybridization signal (Fig. 4). Since grey fox and the domestic dog are the most distantly-related members of the Canidae family (Wayne and O'Brien, 1987), we hypothesize that more closely-related canids such as coyote or wolf also share the SINE, however this remains to be proven. Lack of hybridization to the human and rodent DNAs (Fig. 4) suggests that the SINE could serve as a probe for canine D N A transfected into commonly used human or rodent cell lines.
(d) Conclusions (1) The highly reiterated SINE is 130 bp in length, widely dispersed, and apparently located in untranslated regions of the dog genome. (2) The nt sequence of the SINE shows divergence from 4~o in pBH10 to 22% in clotting factor IX and contains putative A and B boxes with homology to the consensus sequences for internal transcriptional control of R N A polymerase III. The 3' end of the SINE is followed by a (TC)s repeat and a poly(A) tract interrupted by an occasional T residue to form numerous T A A A T and TAAAAT direct
!
2
3
4
5
6
7
8
g
10
II ~-~
Fig. 4. Specificityof the repetitive element to canids as determined by DNA-DNA hybridization.Genomic DNA was isolated from mammalian tissues or cell lines by standard protocols (Maniatis et al., 1982). Approx. 4 pg of each purified DNA was denatured in 100/al 0.4 M NaOH/0.6 M NaCl for 5 min at 25 °C then dot-blotted to Gone Screen Plus (NEN). The filter was neutralized in two 5 x SSC washes for 15 rain, and then probed and washed as in Fig. 2. DNA samples: I, domestic dog (spleen); 2, grey fox (Folu); 3, black bear (muscle); 4, raccoon (PL1UT); 5, ferret (Mpf); 6, domestic cat (ovary); 7, mouse (NIH3T3); 8, rat (L2); 9, Chinese hamster (CHO-K1); 10, human (placenta); 1I, the pK9328 recombinant. The autoradiograph is shown.
238 repeats. The 5' flanking sequences of the S I N E are poorly conserved but also contain direct repeats of T A A A A T . (3) Homologues to the S I N E were found in untranslated regions of canine b l o o d clotting factor IX a n d canine interferon-to sequences from the G e n B a n k database. (4) Since the S I N E is n o t detectable by hybridizations to D N A from representatives of closely-related carnivores or other mammals, it may be unique to the C a n i d a e family.
ACKNOWLEDGEMENTS This research was supported by the U.S. D e p a r t m e n t of Energy under contract No. D E - A C O 6 - 7 6 R L O 1830.
REFERENCES Axelrod, J.H., Read, M,S., Brinkhaus, K.M. and Verma, I.M.: Phenotypic correction of factor IX deficiency in skin fibroblasts of hemophilic dogs. Proc. Natl. Aead. Sci. USA 87 (1990) 5173-5177. Brosius, J.: Retroposons-seeds of evolution. Science 251 (1991) 753. Brutlag, D.L.: Molecular arrangement and evolution of heterochromatic DNA. Annu. Rev. Genet. 14 (1980) 121-144. Chung, C.T., Niemela, S.L. and Miller, R.H.: One-step preparation of competent Escherichia coil: transformation and storage of bacterial cells in the same solution. Prec. Natl. Acad. Sci. USA 86 (1989) 2172-2175. Daniels, G.R. and Deininger, P.L.: Several major mammalian SINE families are derived from tRNA genes. Nature 317 (1985) 819-822. Deininger, P.L.: SINEs: short interspersed repeated DNA elements in higher eucaryotes. In: Berg, D.E. and Howe, M.M. (Eds.), Mobile DNA. AmericanSoc. Microbiol.,Washington,DC, 1989,pp. 619-636. Devereux, J., Haeberli, P. and Smithies, O.: A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12 (1984) 387-395.
Fanning, 'r.G.: Molecular evolution of centromere-associated nucleotide sequences in two species of canids. Gene 85 (1989) 559-563. Feinberg, A.P. and Vogelstein, B.: A technique for radiolabelling DNA restriction endonuclease fragments to high specificactivity.Anal. Biochem. 137 ~!984) 266-267. Himmler, A., Hauptmann, R., Adolf, G.R. and Swetly, P.: Structure and ex[,ression in Escherichia coli ~f canine interferon-~ genes. J. Interferon Res. 7 (~987) 173-183. Jelinek, W.R. and Schmid, C.W.: Repetitive sequences in eukaryotic DN,'.~ and their expression. Annu. Rev. i]~ochem. 51 (1982) 813-844. Maniatis, 'F., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Miklos, G.L,G.: Localized highlyrepetitive DNA sequences in vertebrate and invertebrate ge•omes. In: Maclntyre, R.J. (Ed.), Molecular Evolutionary Genetics. Plenum, New York, 1985, pp. 241-321. Sanger, F., Nicklen, S. and Coulson A.R.: DNA sequencingwith chainterminating inhibitors. Prec. Natl. Acad. Sci. USA 74 (1977) 50~635467. Shen, C.K.J. and Maniatis, T.: The organk:a!ion of repetitive sequences in a cluster of rabbit/~-like globin genes. Cell 19 (1980) 379-391. ¢zybalski, W.: Use of cesium sulfate for equilibrium density gradient centrifugation. Methods Enzymol. 12B (1968) 330-360. Uil, E. and Tschudi, C.: Alu sequences are processed 7SL RNA genes. Nature 312 (1984) 171-172. VanArsdell, S.W., Denison, R.A., Bernstein, L.B., Weiner,A.M., Manser, T. and Ges~.eland,R.F.: Direct repeats flank three small nuclear RNA pseudogenes in the ~lman genome. Cell 26 (1981) I 1-17. Wayne, R.K. and O'Bfien, S..I.: Molecular phylogeny of the dog family (Canidae) based on isozyme genetic distance. Syst. Zool. 36 (1987) 339-355. Weiner, A.M., Deiningel, P.L. and Efstratiadis, A.: Nonviral retroposons: genes, pseudogenes and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55 0986) 631-661. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 phage cloning vectors and host strains: nucleotide sequences of the Ml3mpl9 and pUCI9 vectors. Gent 33 (1985) 103-119.
