Journal of Biotechnology 191 (2014) 54–63

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

A highly unusual polyketide synthase directs dawenol polyene biosynthesis in Stigmatella aurantiaca Corina Oßwald a , Nestor Zaburannyi a , Christian Burgard a , Thomas Hoffmann a , Silke C. Wenzel a,∗∗ , Rolf Müller a,b,∗ a Department of Microbial Natural Products, Helmholtz-Institute for Pharmaceutical Research Saarland, Helmholtz Centre for Infection Research & Pharmaceutical Biotechnology, Saarland University, 66123 Saarbrücken, Germany b German Centre for Infection Research (DZIF), Partner Site Hannover-Braunschweig, University Campus Building C2.3, 66123 Saarbrücken, Germany

a r t i c l e

i n f o

Article history: Received 3 April 2014 Received in revised form 17 July 2014 Accepted 25 July 2014 Available online 4 August 2014 Keywords: Dawenol Genome-mining PUFA-like polyketide synthase Iterative polyketide synthase Secondary lipid synthase

a b s t r a c t Enormous progress in the field of polyketide biosynthesis has led to the establishment of rules for general text book biosynthetic logic and consequently to the assumption that biosynthetic genes can be easily correlated with the corresponding natural products. However, non-textbook examples of polyketide assembly continue to be discovered suggesting the gene to product and product to gene predictions need improvement, especially as they are increasingly used in the post-genomic era. Here, we analyzed the genomic blueprint of a myxobacterial multi-producer of secondary metabolites, Stigmatella aurantiaca DW4/3-1, for its biosynthetic potential by genome-mining. In addition to the five polyketide synthase and/or nonribosomal peptide synthetase gene clusters of known function we identified a further 13 genomic regions exemplifying the enormous genetic potential for the production of additional chemical diversity by this strain. We show by gene inactivation and heterologous expression of the newly identified biosynthetic pathway for dawenol that the biosynthesis of this known polyene does not follow text book biosynthetic logic. Intriguingly, a genomic locus encoding an unusual polyketide synthase exhibiting similarity to gene loci involved in the formation of polyunsaturated fatty acids and secondary lipids was identified. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Among the prokaryotes, myxobacteria are not only prominent for their sophisticated ‘social’ lifestyle but also for production of structurally diverse natural products with potential uses in clinical therapy (Weissman and Müller, 2010; Wenzel and Müller, 2009b). The Gram-negative, soil-dwelling bacteria are increasingly recognized as multi-producers of secondary metabolites possessing giant chromosomes which are among the largest genomes known from bacteria. Only a few myxobacterial genomes have been completely deciphered so far including the chromosome of Sorangium cellulosum So ce56 that spans around 13 Mb (Schneiker et al.,

∗ Corresponding author at: Department of Microbial Natural Products, HelmholtzInstitute for Pharmaceutical Research Saarland, Helmholtz Centre for Infection Research & Pharmaceutical Biotechnology, Saarland University, 66123 Saarbrücken, Germany. Tel.: +49 68130270200. ∗∗ Corresponding author. Tel.: +49 68130270204. E-mail addresses: [email protected] (S.C. Wenzel), [email protected] (R. Müller). http://dx.doi.org/10.1016/j.jbiotec.2014.07.447 0168-1656/© 2014 Elsevier B.V. All rights reserved.

2007). Their rich and versatile potential for secondary metabolite production is reflected by the presence of numerous natural product biosynthetic gene clusters (Wenzel and Müller, 2009a), from which a typical myxobacterial genome usually harbors between 20 and 30 clusters (in some cases even more) producing several diverse natural product classes (e.g. polyketides, ribosomal and nonribosomal peptides, terpenoids). With increasing availability of genome sequence information from myxobacteria and various other microbes a trend emerged over the past decade: in almost all (if not all) species known to produce natural products a significant discrepancy between the number of identified secondary metabolite gene clusters and the number of compounds that have been isolated from the strains is observed (Bode and Müller, 2005). This realization has given great impetus to the ‘genome mining’ approach to natural product discovery (Challis, 2008) with the aim of fully exploiting this rich biosynthetic potential. Straightforward in silico analysis tools are applied for pathway prediction, optionally coupled to pathway engineering approaches, and combined with comprehensive secondary metabolome analysis techniques to finally link genes to products (Zerikly and Challis, 2009; Winter et al., 2011). The reverse path, from products to genes, is routinely

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

applied these days to study the biosynthesis of already known secondary metabolites by mining and correlating the (putative) biosynthetic pathway from genome data of the producer strain. Both approaches (from genes to products and vice versa) depend on reliable and straightforward in silico analysis tools for natural product gene cluster prediction. The currently most comprehensive resource for identifying and analyzing secondary metabolite biosynthetic pathways from microorganisms is the antiSMASH analysis tool (Blin et al., 2013). Among the different classes of natural products, special emphasis was put on improving automatic annotation and prediction of modular polyketide synthase (PKS) and nonribosomal peptide synthetase (NRPS) dependent pathways, which generate a diverse spectrum of compounds exhibiting broad biological activities (Staunton and Weissman, 2001; Hertweck, 2009; Marahiel et al., 1997; Marahiel, 2009). The involved modularly organized multi-enzymes define the sequence and chemical identity of the final polyketide/peptide product by the order of their catalytic units. According to the assembly line logic, the number and type of building blocks that are incorporated into the final product can be predicted as well as additional modifications by tailoring domains. Although the informative value of such tools is limited, e.g. regarding the exact determination of distinct substrate specificities or the reliable recognition of inactive catalytic domains, such predictions provide valuable information for ‘genome-mining’ approaches and can guide the discovery of unknown pathway products. However, the more information on such PKS/NRPS gene clusters emerges, the more it becomes clear that there are an increasing number of pathways which deviate from the ‘text book’ biosynthetic logic, particularly in myxobacteria (Wenzel and Müller, 2007). Such cases considerably complicate not only gene to product correlations, but also the reverse direction aiming at the correlation of already elucidated compound structures with annotated biosynthetic pathways which is nowadays regarded as trivial. Especially if the producer strain encodes multiple, putative secondary metabolite pathways and extensively employs ‘non-textbook’ biochemistry, assignments are often impossible without further analysis and experimental studies. Such a scenario is described in this study aiming to elucidate the genetic information required for dawenol production in the myxobacterial multi-producer Stigmatella aurantiaca DW4/3-1. Significant work has already been performed in the past to exploit the secondary metabolite biosynthetic potential of the myxobacterial model strain S. aurantiaca DW4/3-1, whose genome sequence was completely deciphered a few years ago (Huntley et al., 2011). In addition to a number of volatiles and potential pheromones (Plaga et al., 1998; Dickschat et al., 2005) the strain was reported to produce six (putative) PKS/NRPS-derived natural product families (see Fig. 1). Among them are the myxothiazoles (Silakowski et al., 1999), myxochromides (Wenzel et al., 2005), aurafurones (Kunze et al., 2005; Frank et al., 2007) and DKxanthenes (Meiser et al., 2008), whose biosynthetic pathways have already been identified from the DW4/3-1 chromosome as well as the siderophore myxochelin (Silakowski et al., 2001) whose pathway was not described from DW4/3-1 yet but from other myxobacteria (Silakowski et al., 2000; Gaitatzis et al., 2005). Additionally, the polyene metabolite dawenol, for which we aimed to identify its genetic blueprint in this work was isolated from this strain (Söker et al., 2003). Although initial bioactivity studies by Söker et al. (2003) against a small microbial test panel and a mouse fibroblast cell line did not show significant inhibitory effects of dawenol, we hypothesize that dawenol may exhibit other functions during myxobacterial growth and development, e.g. as described for DKxanthene by Meiser et al. (2008). The highly unusual putative polyketide structure of dawenol motivated us to identify and characterize its biosynthetic pathway. In order to achieve this goal we retrieved all (putative) PKS/NRPS

55

type biosynthetic gene clusters from published genome data of S. aurantiaca DW4/3-1 (Huntley et al., 2011) and screened them for potential dawenol biosynthetic gene clusters based on retrobiosynthetic considerations and feeding studies. Surprisingly, none of the pathways found matched the retro-biosynthetic predictions. To reduce the number of possible candidates a closely related dawenol producer was identified in our strain collection and analyzed for homologous secondary metabolite pathways. Based on gene inactivation studies and the establishment of a heterologous expression system we finally succeeded in identifying the gene set involved in dawenol production which encodes a highly unusual PKS system.

2. Materials and methods 2.1. Sequence analysis Complete genome sequence of S. aurantiaca DW4/3-1 was downloaded from GenBank database (accession code CP002271). Draft genome sequence of S. aurantiaca Sg a15 was obtained by the combination of 454 and Illumina technologies and raw data assembled with Newbler (Margulies et al., 2005) and Abyss-pe (Simpson et al., 2009) programs. Secondary metabolite potential of the strains S. aurantiaca DW4/3-1 and S. aurantiaca Sga15 was estimated by antiSMASH 2 (Blin et al., 2013) and putative borders of gene clusters were manually adjusted with respect to functional annotation. The dawenol biosynthetic gene cluster in Sg a15 was contained in three contigs which were later joined to form one sequence. Putative gene functions were assigned based on PFAM (Finn et al., 2014) and BLAST (Altschul et al., 1990) homology searches. 2.2. Strains and cultivation conditions S. aurantiaca DW4/3-1 wildtype (Qualls et al., 1978) and mutant strains were routinely cultivated in tryptone medium (1% tryptone, 0.2% MgSO4 ; pH adjusted to 7.2) and S. aurantiaca Sg a15 wildtype (W. Dawid, 1977; (Kunze et al., 1984)) and mutant strains in tryptone starch medium (1% tryptone, 1.19% HEPES, 0.4% soluble starch, 0.2% MgSO4 × 7H2 O; pH adjusted to 7.2) at 30 ◦ C. Production cultures of S. aurantiaca wildtype strains and their descendants were inoculated 1:50 and grown in 50 mL probion medium (0.1% probion, 0.2% peptone, 0.5% soluble starch, 0.05% MgSO4 × 7H2 O, 0.05% CaCl2 × 2H2 O, 0.2% glucose; pH adjusted to 7.6) supplemented with 2% XAD-16 adsorber resin (Rohm & Haas) in 300 mL shake flasks for 3–4 d at 30 ◦ C. Myxococcus xanthus DK1622 (Goldman et al., 2006) was used as heterologous host for dawenol production. Wildtype cultures and their mutants (harboring the dawenol biosynthetic pathway) were cultivated at 30 ◦ C in CTT medium (Kroos et al., 1986), for routine growth and production. Escherichia coli HS996 (Invitrogen) was used for plasmid amplification and cultivated in LB medium containing 5 g/L NaCl (Sambrook and Russell, 2001), at 30 ◦ C or 37 ◦ C. If necessary, 25–50 ␮g/mL kanamycin and/or 25 ␮g/mL chloramphenicol was added to the E. coli or myxobacterial cultures. 2.3. DNA isolation, manipulation and analysis Isolation of chromosomal DNA from S. aurantica DW4/3-1, S. aurantica Sg a15, M. xanthus DK1622 and mutants thereof was performed according to established methods (Neumann et al., 1992) for subsequent plasmid recovery or using the Gentra Puregene Yeast/Bact. Kit (Qiagen) for subsequent PCR verification experiments. An alkaline lysis method (Sambrook and Russell, 2001) was used to isolate and purify plasmid DNA from E. coli HS996. All enzymes (restriction endonucleases, shrimp alkaline phosphatase,

56

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

T4 DNA ligase and Taq polymerase) were obtained from Fermentas Life Sciences and were applied according to standard protocols (Sambrook and Russell, 2001). Oligonucleotides for PCR were obtained from Sigma Genosys. For cloning experiments, PCR products were purified by agarose gel electrophoresis and subsequent gel extraction with NucleoSpin Extract II Kit (Macherey–Nagel). 2.4. Inactivation of the dawenol gene cluster in S. aurantiaca DW4/3-1 and Sg a15 Constructs for gene inactivation were based on the pCRII® TOPO® vector system (Invitrogen) containing a homologous dawenol gene cluster fragment for homologous recombination. To inactivate the dawenol gene cluster in S. aurantiaca DW4/3-1, a 1.4 kb fragment was amplified from chromosomal DNA using the oligonucleotides Daw12 (5 -GCTCGTGGCTGGAGACAAG-3 ) and Daw18 (5 -GCCTCGGCATCCGACAAC-3 ) and Taq polymerase according to the manufacturer’s protocol (annealing temperature: 64 ◦ C; elongation time: 60 s; number of cycles: 30). The PCR product was subsequently cloned into pCRII® TOPO® (Invitrogen) resulting in plasmid pDaw5, which was electroporated into S. aurantiaca DW4/3-1 according to established protocols (Beyer et al., 1999). Resulting transformants, S. aurantiaca DW4/31::pDaw5, were selected on kanamycin and verified by colony PCR applying 1 ␮L cell lysate (colonies boiled for 10 min at 99 ◦ C in 500 ␮L H2 O). Taq polymerase according to the manufacturer’s protocol and three different combinations of oligonucleotides were used at an elongation time of 110 s and 35 cycles: Daw21 (5 GTGCAGCCAACTGCTC-3 )/Daw22 (5 -GGACACTCCCGCCTTC-3 ) at an annealing temperature of 57 ◦ C yielded a distinct 1.7 kb amplicon from wildtype DNA; Daw22/M13for (5 -GTAAAACGACGGCCAG3 ) at an annealing temperature of 55 ◦ C yielded a distinct 1.7 kb amplicon from mutant DNA; and Daw21/M13rev (5 CAGGAAACAGCTATGAC-3 ) at an annealing temperature of 50 ◦ C yielded a distinct 1.7 kb amplicon from mutant DNA. To inactivate the dawenol gene cluster in S. aurantiaca Sga15 a 1.5 kb fragment was amplified from chromosomal DNA using the oligonucleotides Daw34 (5 -GCCACATTCGCCAGGAAGACCG-3 ) and Daw35 (5 GACGCCTCGCGGAGCAACTGG-3 ) and Taq polymerase according to the manufacturer’s protocol (annealing temperature: 72 ◦ C; elongation time: 30 s; number of cycles: 30). The PCR product was subsequently cloned into pCRII® TOPO® (Invitrogen) resulting in plasmid pDaw7, which was electroporated into S. aurantiaca Sg a15 according to established protocols (Beyer et al., 1999). Resulting transformants, S. aurantiaca Sga15::pDaw7, were selected on kanamycin and verified by PCR analysis after chromosomal DNA isolation. Taq polymerase according to the manufacturer’s protocol and three different combinations of oligonucleotides were used at an elongation time of 110 s and 35 cycles: Daw38 (5 -CAACAGCACATCCACATGG-3 )/Daw39 (5 ATCGTGATGGGCTACCTGC-3 ) at an annealing temperature of 61 ◦ C yielded a distinct 1.7 kb amplicon from wildtype DNA; Daw38/M13 for (5 -GTAAAACGACGGCCAG-3 ) at an annealing temperature of 55 ◦ C yielded a distinct 1.7 kb amplicon from mutant DNA; and Daw39/M13revnew (5 -CACACAGGAAACAGCTATGAC-3 ) at an annealing temperature of 57 ◦ C yielded a distinct 1.7 kb amplicon from mutant DNA. 2.5. Subcloning and heterologous expression of the dawenol pathway from S. aurantiaca DW4/3-1 In order to integrate a vector into the downstream flanking region of the dawenol pathway a homologous fragment was amplified from genomic DNA of S. aurantiaca DW4/3-1 using Taq polymerase according to the manufacturer’s protocol. The 1.1 kb amplicon was generated with the oligonucleotides Daw32

(5 -GATGTTTAAACTCGAATCCTGCAGGGCACAGGCGCGTCTATAGGGTGG-3 ) and Daw33 (5 -TAGTTAATTAAGCGCGAGGAGCATGCGCGAG-3 ) by applying combined annealing/elongation steps at 72 ◦ C for 120 s during 35 cycles. Cloning of the PCR product into pCRII® TOPO® (Invitrogen) resulted in construct pDaw9, which was transferred into S. aurantiaca DW4/3-1 by electroporation (Beyer et al., 1999) and transformants were selected on kanamycin. Chromosomal DNA from the S. aurantiaca DW4/3-1::pDaw9 mutants was digested with SdaI, and after purification by chloroform extraction and isopropanol precipitation, (re)ligated and transformed into E. coli HS996. Transformants were selected on kanamycin and analyzed by plasmid isolation and subsequent restriction analysis for the presence of correct constructs. The resulting plasmid, pDaw10, was further modified by ligation of a 2.2 kb PacI-zeoR -mx9-PacI cassette from pMyx12-zeo (S.C.W. et al., unpublished), into a unique PacI restriction site yielding the expression construct pDaw11. To generate a truncated version of pDaw11 the construct was transferred into E. coli GB05-red cells (Fu et al., 2012) and modified by integration of a chloramphenicol resistance gene cassette (cmR ) via Red/ET recombination (Zhang et al., 1998, 2000). The cmR cassette was amplified from pBACe3.6 (Frengen et al., 1999) using the oligonucleotides DawET-Cm-for (5 TGAGGCGCTCCGCCGGCGCAAGAGCTCGGGGCATGAAGCCGTACCTGTGACGGAAGATCACTTC-3 ) and DawET-Cm-rev (5 -GCGCGAGGAGCATGCGCGAGGGGCCCGCCGGGTGATGAACGTGGCGTCCGAGGCGTTTAAGGGCACCAATAAC-3 ) and Phusion polymerase (Thermo Scientific) according to the manufacturer’s protocol (annealing temperature: 55 ◦ C; elongation time: 60 s; number of cycles: 30). The 1 kb PCR product was purified and concentrated by ethanol precipitation and subsequently used for Red/ET recombination according to established procedures (Fu et al., 2012; Huo et al., 2012). After selection on LB amended with 25 ␮g/mL chloramphenicol and 25 ␮g/mL kanamycin transformants were verified by restriction analysis of the isolated plasmid DNA corresponding to the truncated expression construct pDaw12. Transformation of pDaw11 and pDaw12 into M. xanthus DK1622 by electroporation (Fu et al., 2008), and selection on kanamycin yielded M. xanthus DK1622::pDaw11 and M. xanthus DK1622::pDaw12 mutants harboring the putative dawenol pathway integrated into the Mx9 phage attachment site, which was verified by PCR analysis as described previously (Oßwald et al., 2012). For heterologous expression, 50 mL shake cultures of M. xanthus DK1622::pDaw11 and M. xanthus DK1622::pDaw12 mutants were grown in CTT media amended with 50 ␮g/mL kanamycin and 2% XAD-16 resin at 30 ◦ C for 3–4 days. 2.6. Dawenol production analysis In general, 50 mL shake cultures of the myxobacterial wild type strains and their descendants grown in the liquid media mentioned above were prepared with 2% XAD-16 resin for the production of secondary metabolites. Cells and adsorber resin were harvested after 3–4 days by centrifugation (8.000 rpm, 15 min, 20 ◦ C) and extracted twice with 2 × 50 mL of methanol/acetone (1:1, v/v). The solvent was completely removed under reduced pressure and dried extracts were dissolved in 500 ␮L of methanol. The solutions were subsequently centrifuged (13,000 rpm, 10 min, 20 ◦ C) prior to analysis by HPLC-MS. For dawenol analysis in the heterologous host M. xanthus DK1622, measurements were performed on a Dionex Ultimate 3000 RSLC system using a Waters BEH C18, 50 × 2.1 mm, 1.7 ␮m dp column by injection of 2 ␮L of methanolic sample. Separation was achieved by a linear gradient with (A) H2 O + 0.1% FA to (B) ACN + 0.1% FA at a flow rate of 600 ␮L/min and 45 ◦ C. The gradient was initiated by a 0.33 min isocratic step at 5% B, followed by an increase to 95% B in 9 min to end up with a 1 min flush step at 95% B before re-equilibration under the initial conditions. UV

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

and MS detection were performed simultaneously with dawenol showing good UV absorption at 360 nm. Coupling the HPLC to the MS was supported by an Advion Triversa Nanomate nano-ESI system attached to a Thermo Scientific Orbitrap. Full scan mass spectra were acquired in centroid mode ranging from 200 to 2000 m/z at a resolution of R = 15,000. MS/MS spectra were acquired at the same resolution upon isolating the dawenol [M+H]+ ion with a 2 m/z window and fragmentation by CID. For dawenol analysis in the native producers S. aurantiaca DW4/3-1 and Sga15, and mutants thereof see Supplementary data. 3. Results and discussion The main goal of this study was to identify the gene set involved in the production of the polyene metabolite dawenol (Söker et al., 2003) and thereby gain a deeper understanding of secondary metabolism via correlating biosynthetic gene clusters to their products in the myxobacterial multi-producer S. aurantiaca DW4/3-1.

57

genome sequence (Huntley et al., 2011) we aimed to re-analyze the in silico biosynthetic potential of this secondary metabolite multiproducer and to screen the sequence data for putative dawenol biosynthetic pathways. The recently developed automated pathway annotation tool antiSMASH 2 (Blin et al., 2013) was applied revealing 33 putative secondary metabolite biosynthetic gene clusters, 17 of which contain PKS and/or NRPS components (see Supplementary data, Table S1). After assignment of the previously published pathways from this strain as mentioned above, it turned out that gene cluster No. 23 from the primary antiSMASH output covers the DKxanthene biosynthetic pathway (No. 23-1 = No. 13 within the PKS/NRPS subset) (Meiser et al., 2008) plus additional NRPS information (No. 23-2 = No. 14 within the PKS/NRPS subset) and was henceforward regarded as two different pathways increasing the number of PKS/NRPS-type gene clusters from 17 to 18 (see Table 1). Among these 13 gene clusters have an unknown function including four PKS, five NRPS and four hybrid PKS/NRPS pathways.

3.1. In silico analysis of the biosynthetic potential of S. aurantiaca DW4/3-1

3.2. In silico mining for the dawenol biosynthetic pathway and feeding studies to decipher the pathway

In the order Myxococcales, S. aurantiaca DW4/3-1 represents one of the few species for which a complete genome sequence is reported (Huntley et al., 2011). The genome comprises 10.3 Mb and 8352 (putative) protein-coding sequences (CDS), only about half of which were automatically assigned to (putative) functions. A significant part of the genome is dedicated to secondary metabolite biosynthesis, which correlates well with the identification of multiple PKS/NRPS gene loci in previous studies when no genome data was available (Silakowski et al., 2001). A notable number of natural products (see Fig. 1) and corresponding biosynthetic pathways were already described from S. aurantiaca DW4/3-1 (Silakowski et al., 1999; Wenzel et al., 2005; Frank et al., 2007; Meiser et al., 2008). In an initial study on the draft genome data, 14 polyketide synthase (PKS) and nonribosomal peptide synthetase (NRPS) dependent pathways were detected and slightly correlated with biosynthetic products based on comparisons with previously published gene clusters of known function (Ronning and Nierman, 2007). After complete decryption of the S. aurantiaca DW4/3-1

To identify the genetic information required for dawenol production we first attempted to gain insight into the biosynthetic origin of this striking polyene metabolite. Structural features of dawenol indicate that it belongs to the class of reduced polyketides (Staunton and Weissman, 2001; Hertweck, 2009), which are assembled from short-chain activated carboxylic acids, like malonyl-CoA or methylmalonyl-CoA, via stepwise condensation. Each elongation step initially results in the formation of ␤-keto esters, which can optionally undergo reduction to the hydroxyl, dehydrated or even the completely saturated form. Methyl branches can be either directly introduced via incorporation of methylmalonyl-CoA or by the action of dedicated S-adenosylmethionine (SAM)-dependent methyl transferases that can subsequently modify incorporated extender units (e.g. malonyl-CoA) at position 2. According to polyketide assembly logic (stepwise head-to-tail linkage of C2 units until a chain of required length is reached) even-numbered carbon chains are generated and afterwards released from the polyketide synthase (PKS) yielding either cyclic or linear polyketide

Fig. 1. Secondary metabolites from S. aurantiaca DW4/3-1. Six PKS/NRPS-type compound families (plus additional volatiles and pheromones) have been reported to be produced by S. aurantiaca DW4/3-1 (for references see Section 1).

58

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

Table 1 Polyketide/Nonribosomal peptide biosynthetic gene clusters from S. aurantiaca DW4/3-1. Numbering

Loci

PKS/NRPS

Anti SMASHa

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

1 5 7 9 11 13 14 15 16 17 19 20 23-1b 23-2b 24 25 26 30

STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR

0024-STAUR 0027 0820-STAUR 0823 1142-STAUR 1144 1572-STAUR 1580 1684-STAUR 1690 3222-STAUR 3234 3530-STAUR 3548 3589-STAUR 3600 3982-STAUR 3985 4012, STAUR 4014-STAUR 4019 4149-STAUR 4161 4197-STAUR 4207 4826-STAUR 4842 4846-STAUR 4848 4990-STAUR 4992 5213-STAUR 5222 5281-STAUR 5284 6943-STAUR 6947

Type

Compounds

Presence in Sg a15

PKS/NRPS PKS/NRPS PKS/NRPS PKS PKS NRPS NRPS NRPS PKS PKS/NRPS PKS/NRPS PKS/NRPS PKS/NRPS NRPS NRPS PKS PKS NRPS

Unknown Unknown Myxochromide S (Wenzel et al., 2005) Dawenol (this work) Unknown Unknown Unknown Myxochelinc Unknown Myxothiazol (Silakowski et al., 1999) Unknown Unknown DKxanthene (Meiser et al., 2008) Unknown Unknown Aurafurone (Frank et al., 2007) Unknown Unknown

+ + + + + − + + − − + + + − + − + −

a

For primary antiSMASH result see Supplementary data (Table S1). Probably two clusters that are very close to each other, defined by antiSMASH as one. c The myxochelin gene cluster was described from S. aurantiaca Sg a15 (Silakowski et al., 2000), which is highly similar to PKS/NRPS loci No. 8 from S. aurantiaca DW4/3-1 that is also known to produce myxochelins (Silakowski et al., 2001). b

structures. The latter ones usually contain a terminal carboxylic acid group, which is generated during release from the enzyme via hydrolysis. Interestingly, this typical feature is not present in the dawenol structure and therefore it is not possible to clearly deduce the direction of polyketide chain assembly from retro-biosynthetic analysis. This question as well as the elucidation of incorporated extender units can be addressed by feeding experiments, which are usually performed with 13 C-labeled precursors followed by incorporation studies applying 13 C NMR spectroscopy on purified compounds. Unfortunately, unstable production and chemical instability of dawenol did not allow isolation of sufficient material for NMR analysis from feeding studies at a reasonable or affordable scale. Therefore, small scale feeding experiments coupled with subsequent HPLC-MS analytics were performed to obtain at least some hints on the biosynthetic origin of dawenol (data not shown). Three different types of labeled precursors were used: [1-13 C] acetate (to label acetyl-CoA starters and malonyl-CoA extender units), [1-13 C] propionate (to label propionyl-CoA starters and methylmalonyl-CoA extender units) and l-methionine-(methylD3) (to label methyl groups introduced by SAM-dependent methyl transferases). The obtained data suggest that the dawenol polyketide chain originates from acetate and propionate units as no label from methionine was incorporated. Although the exact number of acetate and propionate units could not be determined by HPLC-MS due to low incorporation rates three different scenarios on the biosynthetic origin of dawenol seemed plausible (see Fig. S3). These indicate the involvement of a 10-modular PKS system starting chain assembly either at position 1 (scenarios A and B) or 19 (scenario C). Biosynthesis also involves chain modification via acetylation (resulting in the incorporation of an additional acetate unit) as well as an unusual chain termination step (e.g. decarboxylation or reduction) that explains the lack of a terminal carboxyl group. Based on these retro-biosynthetic considerations and assuming that dawenol is the product of a modular PKS system we next screened the antiSMASH output for putative biosynthetic pathway candidates. However, none of the polyketide synthase gene clusters encode an assembly line which is consistent with the hypothesized biosynthesis scenario, even if several exceptions from

textbook biosynthetic logic are considered. Therefore, all four yet unassigned PKS pathways (No. 4, 5, 9 and 17, see Table 1) had to be considered as possible but unusual candidates. To obtain further evidence and for comparative reasons we aimed to identify additional dawenol producers for which shotgun genome data is available from our myxobacterial strain collection. Using Myxobase (Krug and Müller, 2014), secondary metabolome data of various myxobacteria were searched for mass spectra indicative of dawenol production which identified S. aurantiaca Sg a15 as alternative producer species. The Sg a15 draft genome sequence was submitted to antiSMASH (Blin et al., 2013) which was subsequently compared to the data obtained for S. aurantiaca DW4/3-1. Within the set of 18 PKS/NRPS gene clusters detected in the DW4/3-1 genome sequence 12 homologous pathways could be identified in Sg a15 including the dawenol gene cluster candidates No. 4, 5 and 17 (see Table 1). As no homolog for PKS pathway No. 9 is encoded in the S. aurantiaca Sg a15 genome, this gene cluster is obviously not involved in dawenol biosynthesis and was thus excluded from further analysis. Subsequently, we intended to apply experimental approaches to correlate dawenol production with the respective biosynthetic genes. 3.3. Identification of the dawenol biosynthetic pathway by gene inactivation Using genetic modification procedures which are usually not straightforward with myxobacteria (Kopp et al., 2004) but have already been established for S. aurantiaca DW4/3-1 and Sg a15 (Beyer et al., 1999), we aimed to identify the dawenol biosynthetic pathway by targeted gene inactivation experiments. Inactivation constructs targeting gene clusters No. 4, 5 and 17 (see Table 1) were generated and transferred into S. aurantiaca DW4/3-1. No correct mutants could be obtained for gene cluster No. 17 and the resulting inactivation strains of gene cluster No. 5 showed no effect in dawenol production (unpublished data). However, gene inactivation experiments targeting gene cluster No. 4 resulted in dawenol negative phenotypes and were performed according to the following procedure: a 1.4 kb fragment of S. aurantiaca DW4/3-1 gene STAUR 1574 was subcloned into a suicide vector to yield plasmid

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

59

Fig. 2. Comparative analysis of the dawenol gene cluster loci in Stigmatella strains. Colinearity of dawenol biosynthetic gene clusters (black) located within non-homologous flanking regions (gray) on the chromosomes of S. aurantiaca DW4/3-1 and S. aurantiaca Sg a15.

pDaw5. Similarly, the suicide construct pDaw7 was constructed based on a 1.5 kb homologous fragment to target the corresponding gene (later designated daw3) from S. aurantiaca Sg a15. Both gene inactivation constructs were subsequently transferred into the two Stigmatella strains by electroporation. Correct integration of the gene inactivation constructs into the chromosome of the resulting transformants, S. aurantiaca DW4/3-1::pDaw5 and S. aurantiaca Sga15::pDaw7, were verified by PCR analysis. To investigate the effect of this genetic modification on dawenol production, the mutants were grown in parallel to the wildtype strains and the obtained culture extracts were analyzed by HPLC-MS. In contrast to the wildtype producers, no dawenol could be detected in the mutant extracts (see Supplementary data Figs. S4/S5) indicating that the targeted PKS gene locus No. 4 is indeed responsible for dawenol production. After the successful ‘product to gene locus correlation’ we next aimed to comprehensively determine which genes might be involved in dawenol biosynthesis by comparing the respective gene cluster regions in both Stigmatella strains. Due to the low quality of the Sg a15 draft genome sequence some manual input and additional sequencing was required for gap closing to join three sequence contigs in this region and to adjust the putative gene cluster borders with respect to functional annotation. As shown in Fig. 2 a strict colinearity over a sequence stretch of about 21 kb was observed which is flanked by unique sequences on both sites in each strain. This indicated that the dawenol biosynthetic pathway comprises nine genes, encoding seven PKS proteins plus a phosphopantetheinyl transferase (Ppt) for their posttranslational modification as well as a putative monooxygenase (Mox) as a modifying enzyme (see Table 2). Interestingly, all acyl carrier protein (ACP) domains harbor a conserved threonine instead of the active site serine, which is regarded as essential for posttranslational modifications to become catalytically active (Lambalot et al., 1996). We therefore speculate that posttranslational transfer

of the 4 -phosphopantetheinyl moiety of coenzyme A occurs at the hydroxyl group of threonine instead, which to our knowledge would represent the first deviation from the long standing paradigm that activation of NRPS, PKS and fatty acid synthases requires the presence of the active site serine residue. To obtain further insights if this highly unusual PKS system is indeed sufficient for dawenol production and to exclude the requirement for further enzyme activities, we aimed for heterologous expression of the proposed gene cluster region in a suitable heterologous host. 3.4. Subcloning of the dawenol pathway, heterologous expression and feeding studies in M. xanthus In order to mobilize the dawenol biosynthetic pathway from S. aurantiaca DW4/3-1, we attempted to subclone the respective chromosomal region via a plasmid recovery approach. This requires the construction of a suicide plasmid allowing for integration into the flanking region at one end of the pathway as well as the presence of a unique restriction site (not present in the chromosomal target region) located at the opposite side. The presence of a unique SdaI restriction site close to the proposed 5 end of the dawenol biosynthetic gene cluster enabled a cloning strategy via the integration of a suicide plasmid into the downstream flanking region of the pathway (see Fig. 3). We arranged to include about 10 kb adjacent DNA information, which encodes several enzymes possibly involved in dawenol biosynthesis. Homologs for most of these genes could also be identified in the shotgun genome data of S. aurantiaca Sg a15, which might implicate the occurrence of a dawenol ‘split gene cluster’ in this strain. Therefore, we decided to initially subclone the 10 kb elongated target fragment and to further analyze its importance by subsequent gene deletion studies. Transformation of S. aurantiaca DW4/3-1 wildtype with

Table 2 List of clustered genes in S. aurantiaca DW4/3-1 and S. aurantiaca Sg a15, which are sufficient for dawenol biosynthesis in M. xanthus DK1622. #

1 2 3 4 5 6 7 8 9 a

Annotation [domain organization]c

Gene locus in S. aurantiaca DW4/3-1a

Sg a15b

STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR STAUR

daw1 daw2 daw3 daw4 daw5 daw6 daw7 daw8 daw9

1572 (daw1) 1573 (daw2) 1574 (daw3) 1575 (daw4) 1576 (daw5) 1577 (daw6) 1578 (daw7) 1579 (daw8) 1580 (daw9)

Monooxygenase [Mox] Polyketide synthase [AT] Polyketide synthase [CLF-KS-AT] Polyketide synthase [ACP-ACP-ACP-ACP-ACP-KR] Polyketide synthase [Act-DH] Polyketide synthase [CLF-KS] Polyketide synthase [KS-KS-DH] 4 -phosphopantetheinyl transferase [Ppt] Polyketide synthase [DH]

Complete genome sequence available, GenBank accession code CP002271. Gene cluster sequence deposited in GenBank under accession code KJ682629. c ACP – acyl carrier protein (the active site serine seems to be functionally replaced by threonine in all ACPs), Act – acetyl transferase (PFAM hit: AAT – acyl-coenzyme A:6-aminopenicillanic acid acyl-transferase), AT – acyl transferase, CLF – chain length factor (detected as KS in which the active site cysteine is absent), DH – dehydratase, KR – ketoreductase, KS – ketosynthase, Mox – monooxygenase, Ppt – 4 -phosphopantetheinyl transferase. b

60

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

Fig. 3. Cloning strategy for the construction and engineering of expression plasmids for heterologous dawenol production in M. xanthus DK1622. Expression plasmid pDaw11 was generated by mobilizing a 32 kb region of the S. aurantica genome comprising the dawenol biosynthetic pathway and 10 kb adjacent chromosomal DNA by a plasmid recovery approach and subsequent cloning of a transfer cassette (zeoR -mx9) allowing for site specific integration into the host chromosome. Deletion of genes STAUR 15811589 by integration of a resistance gene (cmR ) resulted in the truncated expression construct pDaw12 only harboring genes daw1-9, which turned out to be sufficient for dawenol production.

plasmid pDaw9 followed by chromosomal integration via homologous recombination yielded strain S. aurantiaca DW4/3-1::pDaw9. Based on isolated chromosomal DNA from this mutant, the target region was successfully subcloned via plasmid recovery initiated by SdaI digestion and subsequent re-ligation. As shown in Fig. 3, the obtained plasmid pDaw10 was further modified by integration of a suitable transfer cassette harboring a zeocin resistance gene (zeoR ) as well as a bacteriophage Mx9 integrase gene (mx9, including attachment site) allowing for site-directed integration of the expression construct into the chromosome of the host strain M. xanthus DK1622 (Julien, 2003). After transfer of the resulting expression construct pDaw11 into the host, the obtained M. xanthus DK1622::pDaw11 mutant strains were verified for correct sitespecific integration of pDaw11 into the chromosomal Mx9 phage attachment site. Subsequent production analysis showed that the incorporated heterologous gene cluster, which is still under control of the native Stigmatella promoters, indeed qualifies M. xanthus for production of dawenol at detectable, but not tremendous yields. Due to the lack of a reference substance, chemical instability of the product (Söker et al., 2003), and unreliable production titers it was not possible to perform quantitative production analysis. However, it could be clearly shown via HPLC-MS analysis that dawenol is produced by M. xanthus DK1622::pDaw11 in contrast to M. xanthus DK1622 wildtype from which no dawenol could be detected (see Fig. 4). Next, a truncated version of the expression construct pDaw11 was generated by insertion of a chloramphenicol resistance gene via Red/ET recombination in order to delete the 10 kb chromosomal fragment downstream of gene STAUR 1580.

The resulting expression construct, pDaw12, was consequently reduced to the set of nine genes (STAUR 1572-STAUR 1580) that was originally proposed to be sufficient for dawenol biosynthesis (see Fig. 2). After transfer of pDaw12 into the heterologous host and genotypic verification of the obtained mutants, dawenol production analysis was performed. Indeed, the compound could be detected in culture extracts of M. xanthus DK1622::pDaw12 indicating that the expressed gene cluster encodes all required catalytic activities for dawenol biosynthesis. However, we cannot explicitly rule out the involvement of additional host encoded enzymes. The establishment of a heterologous expression system allowed us to perform in depth feeding studies in order to decipher the biosynthetic origin of dawenol based on the three possible scenarios mentioned earlier (see Fig. S3). The dawenol isotope patterns observed after feeding different types of labeled acetate and propionate precursors were found in agreement with scenario A only (see Supplementary data). Therefore, we assume that dawenol polyketide chain assembly starts from position 1 using an acetyl-CoA starter and involves nine chain elongation rounds (2 × malonyl-CoA and 7 × methylmalonyl-CoA) whereas the ultimately incorporated propionate unit undergoes some modification (e.g. decarboxylation) resulting in a loss of C-1 (see Fig. 5). Other specific characteristics of dawenol biosynthesis are the Oacetylation (resulting in the incorporation of an additional acetate unit) and an unusual location of the C5/C6 double bond, which is not in accordance with standard polyketide reduction chemistry (as such would yield a double bond located between C6/C7).

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

61

4. Conclusion

Fig. 4. HPLC-MS analysis of dawenol production in M. xanthus DK1622 wild type and in heterologous expression mutants. Extracted ion chromatograms for m/z 427.32067, corresponding to the [M+H]+ ion of dawenol in M. xanthus DK1622 wild type and the mutants DK1622::pDaw11 and DK1622::pDaw12. Two peaks with identical m/z and identical fragmentation patterns indicate two isomers of dawenol most likely related to Z/E isomerism.

Although the multi-producer S. aurantiaca DW4/3-1 represents among the Myxococcales one of the few strains whose secondary metabolism has already been intensively studied over the last 15 years, most of its genome-encoded biosynthetic potential (33 secondary metabolite biosynthetic pathways according to AntiSMASH analysis) still awaits functional exploitation. Special emphasis was put on polyketide and nonribosomal peptide metabolites in the past as these compound classes usually exhibit promising biological activities with potential uses in clinical therapy (Wenzel and Müller, 2009b; Weissman and Müller, 2010). However, considering that the strain harbors 18 (putative) PKS and/or NRPS biosynthetic gene clusters and only six respective compound families are identified so far (see Fig. 1), there is still plenty unexplored potential for natural products discovery via genome mining approaches (see Fig. 6). In this study we applied reverse genome mining approaches to correlate the production of dawenol with the respective genetic information, an unexpected 21 kb PKS-type gene cluster. The encoded biosynthetic machinery exhibits similarities to microbial polyunsaturated fatty acid (PUFA) synthases that were originally described from marine microorganisms (Kaulmann and Hertweck, 2002; Napier, 2002; Wallis et al., 2002) and were recently discovered in myxobacteria representing the first characterized examples from terrestrial microbes (Gemperlein et al., 2014). These enzyme systems contain polyketide synthase (PKS) as well as fatty acid synthase (FAS) components directing the de novo biosynthesis of PUFAs via iterative condensation of acyl-CoA precursors and subsequent modifications. A similar iterative chain assembly strategy might be applied during dawenol production although there are some striking discrepancies: dawenol biosynthesis includes the incorporation of methylmalonyl-CoA extender units and lacks complete chain reduction steps correlated with the absence of enoyl reductase (ER) activity eventually resulting in the formation of a polymethylated polyene structure. Interestingly, all tandem carrier proteins of the dawenol biosynthetic machinery lack an active site serine all of which seem to be functionally replaced by threonine moieties. The unusual arrangement of the C5/C6 double bond probably results from isomerization of a putative C4/C5 or C6/C7 unsaturated polyketide intermediate or directly from dehydration of a putative OH group at C-6 aside from standard polyketide reduction chemistry (which would yield a C6/C7 double bond). Dehydrogenation of a saturated chain intermediate represents an alternative scenario for the generation of the C5/C6 double bond. The dawenol “polyketide chain” is decorated with an acetyl group, probably introduced by the putative Act domain of Daw5, and undergoes an unusual “front-end” modification explaining the lack of a terminal carboxyl group (see Fig. 5). We speculate that the putative

Fig. 5. Putative biosynthetic origin of dawenol deduced from feeding studies (see Supplementary data).

62

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63

Fig. 6. Biosynthetic potential of the myxobacterial multi-producer S. aurantiaca DW4/3-1. (a) Location of PKS, NRPS and mixed PKS/NRPS clusters on the chromosome of S. aurantiaca DW4/3-1; (b) Dawenol biosynthetic gene cluster, containing nine genes encoding an unusual PKS biosynthetic machinery.

monooxygenase Daw1 is involved in this process and might function in chain release probably including a Baeyer–Villiger type reaction as also proposed for aurafuron biosynthesis (Frank et al., 2007). In summary, we identified a highly unusual PKS system in charge of dawenol biosynthesis. The proteins encoded in the gene cluster show similarities to PUFA synthases and to recently reported “secondary lipid synthases” commonly found across numerous microbial phyla (Shulse and Allen, 2011). However, only a few such secondary lipid biosynthetic gene clusters could be correlated to products, e.g. phenolic lipid or heterocyst glycolipid alkyl chains (Campbell et al., 1997; Miyanaga et al., 2008), which exclusively originate from acetyl-CoA and malonyl-CoA precursors. Therefore, dawenol biosynthesis, to the best of our knowledge, represents the first branched chain compound assembly involving such enzyme systems while employing methylmalonyl-CoA. Due to the complexity of biosynthesis and our current lack of understanding of chain length control and reduction state, our ability to predict compound structures made by such iterative PKS systems is heavily limited. Obviously, dawenol is an example of a gene cluster product which could not have been predicted due to the polybranching of the polyketide chain and the lack of a terminal carboxyl function. Clearly, extended studies are required to gain deeper insight into the intriguing biosynthetic scenario which is now facilitated by the established heterologous expression system. Acknowledgments The authors would like to thank Anja Schwarz for skillful help with construction and transformation of pDaw12 and Katja Gemperlein and Kevin Sours for careful proofreading of the manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jbiotec. 2014.07.447. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Beyer, S., Kunze, B., Silakowski, B., Müller, R., 1999. Metabolic diversity in myxobacteria: identifcation of the myxalamid and the stigmatellin biosynthetic gene cluster of Stigmatella aurantiaca Sg a15 and a combined polyketide(poly)peptide gene cluster from the epothilone producing strain Sorangium cellulosum So ce90. Biochem. Biophys. Acta 1445, 185–195. Blin, K., Medema, M.H., Kazempour, D., Fischbach, M.A., Breitling, R., Takano, E., Weber, T., 2013. antiSMASH 2.0 – a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, W204–W212.

Bode, H.B., Müller, R., 2005. The impact of bacterial genomics on natural product research. Angew. Chem. Int. Ed. 44, 6828–6846. Campbell, E.L., Cohen, M.F., Meeks, J.C., 1997. A polyketide-synthase-like gene is involved in the synthesis of heterocyst glycolipids in Nostoc punctiforme strain ATCC 29133. Arch. Microbiol. 167, 251–258. Challis, G.L., 2008. Genome mining for novel natural product discovery. J. Med. Chem. 51, 2618–2628. Dickschat, J.S., Bode, H.B., Wenzel, S.C., Müller, R., Schulz, S., 2005. Biosynthesis and identification of volatiles released by the myxobacterium Stigmatella aurantiaca. ChemBioChem 6, 2023–2033. Finn, R.D., Bateman, A., Clements, J., Coggill, P., Eberhardt, R.Y., Eddy, S.R., Heger, A., Hetherington, K., Holm, L., Mistry, J., Sonnhammer, E.L., Tate, J., Punta, M., 2014. Pfam: the protein families database. Nucleic Acids Res. 42, D222–D230. Frank, B., Wenzel, S.C., Bode, H.B., Scharfe, M., Blöcker, H., Müller, R., 2007. From genetic diversity to metabolic unity: studies on the biosynthesis of aurafurones and aurafuron-like structures in myxobacteria and streptomycetes. J. Mol. Biol. 374, 24–38. Frengen, E., Weichenhan, D., Zhao, B., Osoegawa, K., van Geel, M., de Jong, P.J., 1999. A modular, positive selection bacterial artificial chromosome vector with multiple cloning sites. Genomics 58, 250–253. Fu, J., Bian, X., Hu, S., Wang, H., Huang, F., Seibert, P.M., Plaza, A., Xia, L., Müller, R., Stewart, A.F., Zhang, Y., 2012. Full-length RecE enhances linear-linear homologous recombination and facilitates direct cloning for bioprospecting. Nat. Biotechnol. 30, 440–446. Fu, J., Wenzel, S.C., Perlova, O., Wang, J., Gross, F., Tang, Z., Yin, Y., Stewart, A.F., Müller, R., Zhang, Y., 2008. Efficient transfer of two large secondary metabolite pathway gene clusters into heterologous hosts by transposition. Nucleic Acids Res. 36, e113. Gaitatzis, N., Kunze, B., Müller, R., 2005. Novel insights into siderophore formation in myxobacteria. ChemBioChem 6, 365–374. Gemperlein, K., Rachid, S., Garcia, R., Wenzel, S.C., Müller, R., 2014. Polyunsaturated fatty acid biosynthesis in myxobacteria: different PUFA synthases and their product diversity. Chem. Sci. 5, 1733–1741, Epub ahead of print. Goldman, B.S., Nierman, W.C., Kaiser, D., Slater, S.C., Durkin, A.S., Eisen, J., Ronning, C.M., Barbazuk, W.B., Blanchard, M., Field, C., Halling, C., Hinkle, G., Iartchuk, O., Kim, H.S., Mackenzie, C., Madupu, R., Miller, N., Shvartsbeyn, A., Sullivan, S.A., Vaudin, M., Wiegand, R., Kaplan, H.B., 2006. Evolution of sensory complexity recorded in a myxobacterial genome. Proc. Natl. Acad. Sci. U.S.A. 103, 15200–15205. Hertweck, C., 2009. The biosynthetic logic of polyketide diversity. Angew. Chem. Int. Ed. Engl. 48, 4688–4716. Huntley, S., Hamann, N., Wegener-Feldbrügge, S., Treuner-Lange, A., Kube, M., Reinhardt, R., Klages, S., Müller, R., Ronning, C.M., Nierman, W.C., Sogaard-Andersen, L., 2011. Comparative genomic analysis of fruiting body formation in myxococcales. Mol. Biol. Evol. 28, 1083–1097. Huo, L., Rachid, S., Stadler, M., Wenzel, S.C., Müller, R., 2012. Synthetic biotechnology to study and engineer ribosomal bottromycin biosynthesis. Chem. Biol. 19, 1278–1287. Julien, B., 2003. Characterization of the integrase gene and attachment site for the Myxococcus xanthus bacteriophage Mx9. J. Bacteriol. 185, 6325–6330. Kaulmann, U., Hertweck, C., 2002. Biosynthesis of polyunsaturated fatty acids by polyketide synthases. Angew. Chem. Int. Ed. 41, 1866. Kopp, M., Irschik, H., Gross, F., Perlova, O., Sandmann, A., Gerth, K., Müller, R., 2004. Critical variations of conjugational DNA transfer into secondary metabolite multiproducing Sorangium cellulosum strains So ce12 and So ce56: development of a mariner-based transposon mutagenesis system. J. Biotechnol. 107, 29–40. Kroos, L., Kuspa, A., Kaiser, D., 1986. A global analysis of developmentally regulated genes in Myxococcus xanthus. Dev. Biol. 117, 252–266. Krug, D., Müller, R., 2014. Secondary metabolomics: the impact of mass spectrometry-based approaches on the discovery and characterization of microbial natural products. Nat. Prod. Rep., http://dx.doi.org/10.1039/C3NP70127A.

C. Oßwald et al. / Journal of Biotechnology 191 (2014) 54–63 Kunze, B., Kemmer, T., Höfle, G., Reichenbach, H., 1984. Stigmatellin, a new antibiotic from Stigmatella aurantiaca (Myxobacterales). I. Production, physico-chemical and biological properties. J. Antibiot. 37, 454–461. Kunze, B., Reichenbach, H., Müller, R., Höfle, G., 2005. Aurafuron A and B, new bioactive polyketides from Stigmatella aurantiaca and Archangium gephyra (myxobacteria). J. Antibiot. 58, 244–251. Lambalot, R.H., Gehring, A.M., Flugel, R.S., Zuber, P., LaCelle, M., Marahiel, M.A., Reid, R., Khosla, C., Walsh, C.T., 1996. A new enzyme superfamily – the phosphopantetheinyl transferases. Chem. Biol. 3, 923–936. Marahiel, M.A., 2009. Working outside the protein-synthesis rules: insights into non-ribosomal peptide synthesis. J. Pept. Sci. 15, 799–807. Marahiel, M.A., Stachelhaus, T., Mootz, H.D., 1997. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem. Rev. 97, 2651–2674. Margulies, M., Egholm, M., Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka, J., Braverman, M.S., Chen, Y.J., Chen, Z., Dewell, S.B., Du, L., Fierro, J.M., Gomes, X.V., Godwin, B.C., He, W., Helgesen, S., Ho, C.H., Irzyk, G.P., Jando, S.C., Alenquer, M.L., Jarvie, T.P., Jirage, K.B., Kim, J.B., Knight, J.R., Lanza, J.R., Leamon, J.H., Lefkowitz, S.M., Lei, M., Li, J., Lohman, K.L., Lu, H., Makhijani, V.B., McDade, K.E., McKenna, M.P., Myers, E.W., Nickerson, E., Nobile, J.R., Plant, R., Puc, B.P., Ronan, M.T., Roth, G.T., Sarkis, G.J., Simons, J.F., Simpson, J.W., Srinivasan, M., Tartaro, K.R., Tomasz, A., Vogt, K.A., Volkmer, G.A., Wang, S.H., Wang, Y., Weiner, M.P., Yu, P., Begley, R.F., Rothberg, J.M., 2005. Genome sequencing in microfabricated high-density picolitre reactors. Nature 437, 376–380. Meiser, P., Weissman, K.J., Bode, H.B., Krug, D., Dickschat, J.S., Sandmann, A., Müller, R., 2008. DKxanthene biosynthesis – understanding the basis for diversityoriented synthesis in myxobacterial secondary metabolism. Chem. Biol. 15, 771–781. Miyanaga, A., Funa, N., Awakawa, T., Horinouchi, S., 2008. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis. Proc. Natl. Acad. Sci. U.S.A. 105, 871–876. Napier, J.A., 2002. Plumbing the depths of PUFA biosynthesis: a novel polyketide synthase-like pathway from marine organisms. Trends Plant Sci. 7, 51–54. Neumann, B., Pospiech, A., Schairer, H.U., 1992. Rapid isolation of genomic DNA from Gram negative bacteria. Trends Genet. 8, 332–333. Oßwald, C., Zipf, G., Schmidt, G., Maier, J., Bernauer, H.S., Müller, R., Wenzel, S.C., 2012. Modular construction of a functional artificial epothilone polyketide pathway. ACS Synth. Biol. 95, http://dx.doi.org/10.1021/sb300080t, Epub ahead of print. Plaga, W., Stamm, I., Schairer, H.U., 1998. Intercellular signaling in Stigmatella aurantiaca: purification and characterization of stigmolone, a myxobacterial pheromone. Proc. Natl. Acad. Sci. U.S.A. 95, 11263–11267. Qualls, G.T., Stephens, K., White, D., 1978. Light-stimulated morphogenesis in the fruiting myxobacterium Stigmatella aurantiaca. Science 201, 444–445. Ronning, C.M., Nierman, W.C., 2007. The genomes of Myxococcus xanthus and Stigmatella aurantiaca. In: Whitworth, D. (Ed.), Myxobacteria: Multicellularity and Differentiation. ASM Press, Chicago, pp. 285–298. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schneiker, S., Perlova, O., Kaiser, O., Gerth, K., Alici, A., Altmeyer, M.O., Bartels, D., Bekel, T., Beyer, S., Bode, E., Bode, H.B., Bolten, C.J., Choudhuri, J.V., Doss, S., Elnakady, Y.A., Frank, B., Gaigalat, L., Goesmann, A., Groeger, C., Gross, F., Jelsbak, L., Jelsbak, L., Kalinowski, J., Kegler, C., Knauber, T., Konietzny, S., Kopp,

63

M., Krause, L., Krug, D., Linke, B., Mahmud, T., Martinez-Arias, R., McHardy, A.C., Merai, M., Meyer, F., Mormann, S., Munoz-Dorado, J., Perez, J., Pradella, S., Rachid, S., Raddatz, G., Rosenau, F., Rückert, C., Sasse, F., Scharfe, M., Schuster, S.C., Suen, G., Treuner-Lange, A., Velicer, G.J., Vorhölter, F.J., Weissman, K.J., Welch, R.D., Wenzel, S.C., Whitworth, D.E., Wilhelm, S., Wittmann, C., Blöcker, H., Pühler, A., Müller, R., 2007. Complete genome sequence of the myxobacterium Sorangium cellulosum. Nat. Biotechnol. 25, 1281–1289. Shulse, C.N., Allen, E.E., 2011. Widespread occurrence of secondary lipid biosynthesis potential in microbial lineages. PLoS ONE 6, http://dx.doi.org/10.1371/journal.pone.0020146. Silakowski, B., Kunze, B., Müller, R., 2001. Multiple hybrid polyketide synthase/nonribosomal peptide synthetase gene clusters in the myxobacterium Stigmatella aurantiaca. Gene 275, 233–240. Silakowski, B., Kunze, B., Nordsiek, G., Blöcker, H., Höfle, G., Müller, R., 2000. The myxochelin iron transport regulon of the myxobacterium Stigmatella aurantiaca Sg a15. Eur. J. Biochem. 267, 6476–6485. Silakowski, B., Schairer, H.U., Ehret, H., Kunze, B., Weinig, S., Nordsiek, G., Brandt, P., Blöcker, H., Höfle, G., Beyer, S., Müller, R., 1999. New lessons for combinatorial biosynthesis from myxobacteria: the myxothiazol biosynthetic gene cluster of Stigmatella aurantiaca DW4/3-1. J. Biol. Chem. 274, 37391–37399. Simpson, J.T., Wong, K., Jackman, S.D., Schein, J.E., Jones, S.J.M., Birol, I., 2009. ABySS: a parallel assembler for short read sequence data. Genome Res. 19, 1117–1123. Söker, U., Kunze, B., Reichenbach, H., Höfle, G., 2003. Dawenol, a new polyene metabolite from the myxobacterium Stigmatella aurantiaca. Z. Naturforsch. B 58, 1024–1026. Staunton, J., Weissman, K.J., 2001. Polyketide biosynthesis: a millennium review. Nat. Prod. Rep. 18, 380–416. Wallis, J.G., Watts, J.L., Browse, J., 2002. Polyunsaturated fatty acid synthesis: what will they think of next? Trends Biochem. Sci. 27, 467–473. Weissman, K.J., Müller, R., 2010. Myxobacterial secondary metabolites: bioactivities and modes-of-action. Nat. Prod. Rep. 27, 1276–1295. Wenzel, S.C., Kunze, B., Höfle, G., Silakowski, B., Scharfe, M., Blöcker, H., Müller, R., 2005. Structure and biosynthesis of myxochromides S1-3 in Stigmatella aurantiaca: evidence for an iterative bacterial type I polyketide synthase and for module skipping in nonribosomal peptide biosynthesis. ChemBioChem 6, 375–385. Wenzel, S.C., Müller, R., 2009a. The impact of genomics on the exploitation of the myxobacterial secondary metabolome. Nat. Prod. Rep. 26, 1385–1407. Wenzel, S.C., Müller, R., 2007. Myxobacterial natural product assembly lines: fascinating examples of curious biochemistry. Nat. Prod. Rep. 24, 1211–1224. Wenzel, S.C., Müller, R., 2009b. The biosynthetic potential of myxobacteria and their impact on drug discovery. Curr. Opin. Drug Discov. Dev. 12, 220–230. Winter, J.M., Behnken, S., Hertweck, C., 2011. Genomics-inspired discovery of natural products. Curr. Opin. Chem. Biol. 15, 22–31. Zerikly, M., Challis, G.L., 2009. Strategies for the discovery of new natural products by genome mining. ChemBioChem 10, 625–632. Zhang, Y., Buchholz, F., Muyrers, J.P., Stewart, F.A., 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123–128. Zhang, Y., Muyrers, J.P.P., Testa, G., Stewart, A.F., 2000. DNA cloning by homologous recombination in Escherichia coli. Nat. Biotechnol. 18, 1314–1317.