A histone H3 lysine-27 methyltransferase complex represses lateral root formation in Arabidopsis thaliana.

Molecular Plant Advance Access published April 7, 2014

A Histone H3 Lysine-27 Methyltransferase Complex Represses Lateral Root Formation in A. thaliana Xiaofeng Gua,b, Tongda Xub,c and Yuehui Hea,b,c,1 a

Department of Biological Sciences, National University of Singapore, Singapore

b

Temasek Life Sciences Laboratory, Singapore

Shanghai Center for Plant Stress Biology, Shanghai Institutes for Biological Sciences, Chinese

Academy of Sciences, Shanghai, China

1

Corresponding author

Correspondence: Phone: +65 6872-7978 Fax: +65-6872-7007 E-mail: [email protected]

Running title: LR Initiation Repression by EMF-PRC2

Short Summary Lateral root founder cell establishment is essential for primary root branching. This work shows that a histone H3 lysine-27 methyltransferase complex functions to inhibit founder cell establishment during lateral root initiation in Arabidopsis thaliana.

1

Downloaded from http://mplant.oxfordjournals.org/ at National Chung Hsing University Library on April 11, 2014

c

ABSTRACT

Root branching or lateral root formation is crucial to maximize a root system acquiring nutrients and water from soil. A lateral root (LR) arises from asymmetric cell division of founder cells (FCs) in a pre-branch site of the primary root, and FC establishment is essential for lateral root formation. FCs are known to be specified from xylem pole pericycle cells, but the molecular genetic mechanisms underlying FC establishment are unclear. Here, we report that in

methyltransferase complex, functions to inhibit FC establishment during lateral root initiation. We found that functional loss of the PRC2 subunits EMF2 (for EMBRYONIC FLOWER 2) or CLF (for CURLY LEAF) leads to a great increase in the number of LRs formed in the primary root. The CLF H3K27 methyltransferase binds to chromatin of the auxin efflux carrier gene PIN FORMED 1 (PIN1), deposits the repressive mark H3K27me3 to repress its expression, and functions to downregulate auxin maxima in root tissues and inhibit FC establishment. Our findings collectively suggest that EMF2-CLF PRC2 acts to downregulate root auxin maxima and show that this complex represses LR formation in Arabidopsis.

Key words: Lateral root formation; Founder cell establishment; PRC2; PIN1; Auxin maximum

2


Arabidopsis thaliana a PRC2 (for Polycomb repressive complex 2) histone H3 lysine-27 (H3K27)

INTRODUCTION

The root system largely consists of the primary root and lateral roots (LRs). LRs are formed iteratively in an acropetal manner in the differential zone along the primary root. Root branching or LR formation is critical for maximizing a root system to acquire nutrients and water from soil, and under complex control by endogenous factors such as the phytohormone auxin and environmental factors such as nutrients and/or water availability (Benkova and Bielach, 2010;

A lateral root arises from asymmetric cell division of founder cells (FCs) at a pre-branch site of the primary root, and FC establishment is essential for LR formation. FCs are specified from xylem pole pericycle (XPP) cells that are primed to be competent for FC specification in the basal meristem just above the root tip (Benkova and Bielach, 2010; De Smet, 2012). FC priming involves self-sustained oscillations of auxin responsiveness and gene expression in the primary root oscillation zone above the root tip, and auxin plays a critical role for priming XPP cells (De Smet et al., 2007; Moreno-Risueno et al., 2010). An auxin response maximum in the protoxylem cell file of basal meristem has been proposed to prime neighboring XPP cells for FC specification, and auxin accumulation in the XPP cells is one of the earliest events in FC establishment (De Smet, 2012; Dubrovsky et al., 2008). Auxin is perceived by an F-box protein receptor in an ubiquitin ligase complex, and promotes interaction of the receptor with the AUXIN /INDOLE-3-ACETIC ACID (Aux/IAA) proteins that heterodimerize with AUXIN RESPONSE FACTOR (ARF) transcription factors to repress their activities; the auxin-mediated interaction targets an Aux/IAA for proteasomedependent degradation, and thus, frees ARFs for transcriptional activation of auxin-responsive genes (Benkova and Bielach, 2010; Chapman and Estelle, 2009). Recent studies in Arabidopsis have revealed that FC priming requires the IAA28 (for INDOLE-3-ACETIC ACID28)dependent auxin signaling (De Rybel et al., 2010). This signaling controls the expression of GATA TRANSCRIPTION FACTOR 23 (GATA23) in XPP cells, which is required for FC specification. Besides GATA23, other genes directly involved in FC establishment remain to be identified. Local auxin maxima and gradients in root tissues result predominantly from cell-to-cell polar auxin transport (Petrasek and Friml, 2009). Auxin is transported from shoot towards root 3


Casson and Lindsey, 2003; Petricka et al., 2012).

tip via the vascular cambium, and subsequently is re-directed to lateral cells and tissues. In Arabidopsis, the PIN-FORMED (PIN) family efflux carriers located at the plasma membrane mediate the polar auxin transport (PAT) in the primary root and LRs as well, and consist of PINFORMED 1 (PIN1), PIN2, PIN3, PIN4 and PIN7, among which the basal membrane-localized PIN1 in the stele plays a major role in transporting auxin towards the root tip (Petrasek and Friml, 2009). The abundance of PIN proteins plays an important role in the regulation of auxin transport. PIN expression is positively feedback regulated by auxin and requires PLETHORA genes (Blilou

upreguates the expression of a MADS-box transcription factor that directly promotes PIN1 and PIN4 expression (Garay-Arroyo et al., 2013). To date, the genes (if any) directly repress PIN expression in roots remain elusive. Covalent modifications of histone tails regulate eukaryotic gene expression. The evolutionarily-conserved Polycomb group (PcG) proteins function to repress developmental gene expression and thus regulate developmental processes in plants and animals (Schuettengruber et al., 2007). In Arabidopsis, the four core subunits of the animal PcG complex PRC2 (for Polycomb repressive complex 2) including two structural components known as Esc and Nurf55, the Zinc-finger protein Suppressor of zeste 12 [Su(z)12] and Enhancer of zeste [E(z), a histone H3 lysine-27 (H3K27) methyltransferase], are well conserved, and their homologs form several PRC2-like complexes (Butenko and Ohad, 2011). For instance, EMBRYONIC FLOWER2 [EMF2, a Su(z)12 homolog], CURLY LEAF [CLF, an E(z) homolog], MULTICOPY SUPPRESSOR OF IRA1 (a Nurf55 homolog) and FERTILIZATION INDEPENDENT ENDOSPERM (the Esc homolog) together form an EMF-PRC2 complex that plays multiple critical roles during vegetative devlepment (Bemer and Grossniklaus, 2012; Butenko and Ohad, 2011). PRC2s catalyze repressive H3K27 trimethylation (H3K27me3) mainly in genic regions including proximal promoter regions and gene bodies, to repress the expression of thousands genes in the Arabidopsis genome, majority of which are developmental genes (Bemer and Grossniklaus, 2012; Zhang et al., 2007). Arabidopsis root growth and development involves chromatin-based mechanisms. In the root tip, the slow-dividing quiescent center (QC) and surrounding stem cells form the root stem cell niche (SCN) (Petricka et al., 2012). The histone acetyltransferase known as GCN promotes the expression of root stem-cell transcription factors to maintain SCN (Kornet and Scheres, 4


et al., 2005; Chen et al., 2011; Vieten et al., 2005). Recently, it has been shown that auxin

2009). An Arabidopsis H3K4 methytransferase SET DOMAIN GROUP 2 is also required for SCN maintenance and functions to promote the growth of primary root and LRs (Yao et al., 2013); in contrast, the CLF H3K27 methyltransferase, functions to inhibit the stem cell activity in the primary root (Aichinger et al., 2011). Moreover, an ATP-dependent CHD3 chromatin remodeler, PICKLE, has been shown necessary for the expression of several root stem cell transcription factors and for the maintenance of stem cell activity (Aichinger et al., 2011). Additionally, histone deacetylation has been shown to be involved in the formation of root cortex

any, that mediate the FC establishment and LR initiation remain elusive. Here, we report that an EMF-CLF PRC2 complex inhibits FC establishment during LR initiation. We show that the CLF H3K27 methyltransferase directly binds to PIN1 chromatin, deposits H3K27me3 to represses PIN1 expression, and functions to downregulate auxin maxima in root cells and tissues, leading to proper root growth and development.

RESULTS

The EMF-PRC2 Subunit EMF2 Functions to Inhibit Arabidopsis Primary Root Growth and LR Formation EMF2, encoding an animal Su(z)12 homolog, plays an essential role in proper growth and development in Arabidopsis (Kim et al., 2010; Moon et al., 2003). Loss-of-function emf2 mutants skip vegetative phase and produce small inflorescence upon germination (Moon et al., 2003). To understand the biological role of EMF2 for vegetative development, we explored a vascular-specific promoter, the widely-used SUC2 (SUCROSE TRANSPORTER 2) promoter (Truernit and Sauer, 1995), to knock down EMF2 expression in vascular tissues such as leaf veins and the root vascular cylinder using double-stranded RNA interference (dsRNAi) approach with an EMF2-specific fragment (Figure 1A). Two independent transgenic lines homozygous for a single T-DNA locus, EMF2-RNAi-1 and EMF2-RNAi-2 were created. At seedling stage, these lines, compared to the parental line Col, exhibited curly leaves and longer primary roots (Figures 1B-C). Subsequently, we quantified EMF2 transcript levels in the roots of these RNAi lines and found that indeed EMF2 expression was knocked down by 60-70% (Figure 1D); this vascular 5


and root hairs (Cui and Benfey, 2009; Liu et al., 2013). To date, the chromatin mechanisms, if

RNAi-mediated strong suppression of EMF2 expression in roots is perhaps a little surprising, indicating that EMF2 may be expressed mainly in the vascular cylinder in roots. Next, we focused on the root phenotypes because the role of EMF2 in root development has not been described before. Further analysis revealed that compared with Col, more LRs were formed along the primary roots with increased lateral root primordium (LRP) density in these RNAi lines (Figures 1E-G). These data suggest that an EMF-PRC2 H3K27 methyltransferase complex acts to inhibit Arabidopsis root growth and development.

Consistent with the notion that an EMF-PRC2 complex acts to inhibit primary root growth, a recent study has revealed that another EMF-PRC2 subunit CLF acts to restrict meristematic growth in the Arabidopsis primary roots (Aichinger et al., 2011). We sought to determine whether CLF, like EMF2, plays a role in LR formation, and scored the number of LRs and LRPs per primary root in Col and clf-81 (a phenotypically-strong loss-of-function allele; Schubert et al., 2006). Starting from the sixth day after germination, the clf-81 mutant produced LRs twice as many as those in the wild type Col (Figure 2B). We further measured the LRP number per primary root, and found that starting from the fourth day after germination the clf mutant produced more LRPs along a primary root with higher LRP densities than Col (Figures 2C-D). In addition, starting from the sixth day after germination, the primary root length of clf was increasingly longer than Col (Figure 2E). The root phenotype of clf was fully rescued by a CLF fusion with GFP (GREEN FLUORESCENCE PROTEIN) in which the genomic CLF coding region with its promoter fused in frame with GFP (Supplemental Figure 1), confirming that the clf-81 mutation is responsible for the phenotype. Moreover, we examined a gain-of-function clf allele, clf-59, in the Ws background (Doyle and Amasino, 2009). In contrast to clf-81, clf-59 produced the shorter primary root and less LRs compared with wild type (Figures 2F-G). In addition, we found that a loss-of-function clf allele (clf-1) in the Ws background produced longer primary root and more LRs in the primary root than Ws (Figure 2H and data not shown). These data together demonstrate that CLF, like EMF2, inhibits the primary root growth and LR formation, uncovering a previously unknown role of CLF for LR formation control. In short, these findings together led us to conclude that the EMF2-CLF PRC2 complex functions to inhibit primary root growth and LR formation in Arabidopsis. 6


The EMF-PRC2 Subunit CLF, Like Its Partner EMF2, Functions to Inhibit LR Formation

CLF Acts upstream of the SOLITARY ROOT (SLR)/IAA14-ARF7-ARF19 Signaling Module to Control LR Formation LRP formation is initiated upon asymmetric cell division of FCs in the root differential zone. This division requires auxin and the SLR/IAA14-ARF7-ARF19-dependent auxin response module; SLR/IAA14 heterodimerizes with ARF7 or ARF19 to prevent these transcription factors from activating the expression of genes promoting FC division (Fukaki et al., 2002; Li et al.,

of-function SLR/IAA14 allele) in LR formation. The slr mutation blocks auxin-triggered FC division and thus LR formation (Fukaki et al., 2002). slr-1 fully suppressed LRP and LR formation along the clf primary root (Figure 3A and data not shown). Next, we examined the genetic interaction of clf-81 with arf7 and arf19, and found that loss of ARF7 and ARF19 function completely blocked LRP and LR formation in clf (Figure 3B). These results suggest that CLF acts upstream of the SLR/IAA14-ARF7-ARF19 signaling module to inhibit LR formation.

CLF Inhibits FC Establishment During FC establishment, XPP cells in the primary root oscillation zone above the root tip are primed to be specified as FCs that subsequently divide to form LRPs (De Smet, 2012). FCs are marked by static points of the auxin-response DR5 gene expression along a primary root (De Smet, 2012; Dubrovsky et al., 2008). We sought to determine whether more FCs /pre-branch sites are specified along the primary root of clf-81 mutant. Using the synthetic DR5-GUS auxin reporter (Ulmasov et al., 1997), a marker for endogenous auxin distribution, we found that the static DR5-expressing points increased along the primary root axis in clf compared with Col (Figure 4), consistent with that more LRs formed upon loss of CLF function. Hence, we conclude that CLF-PRC2 functions to inhibit the establishment of FCs.

CLF Is not ubiquitously Expressed in Roots, but preferentially in Cell-Dividing Tissues We further examined the spatial expression pattern of CLF. To this end, a 3.7-kb CLF genomic fragment including a 2.1-kb region upstream of the CLF transcription start site (TSS) plus 1.6-kb coding region was fused to the GUS reporter gene in frame, which was introduced in Col by transformation (Figure 5A). Histochemical staining of GUS activity and the CLF:GFP 7


2006; Okushima et al., 2007). We first examined the genetic interaction of clf-81 and slr (a gain-

expression analysis in the pCLF-CLF:GFP line revealed that CLF was not expressed in all root cell files, but strongly in meristematic tissues enriched with dividing cells such as the basal meristem where XPP cells are primed to be specified as FCs (Figures 5B and D). In addition, CLF was expressed in presumptive FCs and through LRP growth and organogenesis (Figures 5C-D). The strong expression of CLF in the basal meristem is consistent with its function to inhibit FC establishment.

Auxin plays a central role in root growth and development. The auxin maximum in the root tip is crucial for primary root meristem maintenance; in addition, auxin is involved in every step of LR initiation (Benkova and Bielach, 2010; De Smet, 2012). We asked whether CLF-PRC2 would function to downregulate auxin maxima in root tissues. A DR5-GFP line reporting auxin maxima (Benkova et al., 2003), was introduced into clf-81 by genetic crossing. Loss of CLF function caused an increase in GFP levels in the primary root tip including SCN (Figure 6 and Supplemental Figure 2A). Moreover, the GUS staining of Col and clf-81 seedlings expressing DR5-GUS revealed increased auxin maxima in the root tip including the entire meristematic zone and pre-branch sites of the clf-81 primary root, compared with the Col roots (Figure 4). With the phenotypically-strong loss-of-function clf-81 allele, our analysis uncovers that CLF acts to downregulate auxin maxima in root tips and pre-branch sites.

CLF Represses the Expression of the Auxin Efflux Carrier Gene PIN1 in Roots Local root auxin maxima result predominantly from the carrier-dependent polar auxin transport from shoot to root tip (Petrasek and Friml, 2009). The auxin efflux carrier PIN1 plays an important role in the generation of auxin maximum in the root tip (Petrasek and Friml, 2009). We explored whether CLF could regulate PIN1 expression in roots. PIN1 transcript levels were quantified in the roots of Col, Ws, clf-1 and clf-81 seedlings by RT-qPCR. PIN1 expression was increased upon loss of CLF function in both clf-1 and clf-81 alleles (Figures 7A-B). To further confirm that the de-repression of PIN1 expression, we measured PIN1 protein levels in the clf-81 and Col roots expressing PIN1:GFP. The pPIN1-PIN1:GFP reporter line (Benkova et al., 2003) was introduced into clf-81 by crossing; indeed, PIN1:GFP levels increased in the primary root and LRPs as well in the clf mutant compared with Col (Figures 7C-E and Supplemental Figure 8


CLF Downregulates Auxin Maxima in the Primary Root Tip and Pre-branch Sites

2B). Interestingly, the spatial expression pattern of PIN1 in clf remained identical to that in Col: in the root stele and endodermis (Figure 7C). These data together show that CLF, presumably EMF2-CLF PRC2, downregulates PIN1 expression in roots.

CLF Binds to and Deposits H3K27me3 on PIN1 Chromatin to Repress PIN1 Expression in Roots We further investigated how CLF may repress PIN1 expression in roots using chromatin

roots expressing the functional CLF:GFP, and found that CLF was enriched on PIN1 chromatin around the transcript start site as well as in gene body (Figure 7F). PRC2 has been shown to catalyze H3K27me3 to repress target gene expression. Hence, we examined whether CLF mediates H3K27 trimethylation on PIN1 chromatin using Ws and clf-1 roots, and found that the levels of H3K27me3 were apparently decreased in clf-1 roots compared with those in Ws roots (Figure 7F and Supplemental Figure 3). Thus, CLF binds to PIN1 chromatin and deposits H3K27me3 to repress PIN1 expression in roots.

DISCUSSION

In this study, we have revealed a previously unsuspected inhibitory role of EMF2-CLF PRC2 in Arabidopsis LR formation. Functional loss of either EMF2 or CLF gives rise to a great increase in LRPs/LRs formed in primary roots. Further characterizations of CLF function show that this H3K27 methyltransferase binds to and mediates H3K27me3 on PIN1chromatin to repress PIN1 repression in roots, and functions to downregulate auxin maxima in root tissues and inhibit FC establishment. These findings collectively show that the repressive PRC2 complex plays a critical role in lateral root FC establishment, uncovering a repressive chromatin mechanism to inhibit LR FC formation in Arabidopsis. The PRC2 core subunits are highly conserved in vascular plants; it is likely that PRC2 complexes may be involved in the control of LR formation in other plants. The key events during the FC establishment include priming XPP cells to be competent for FC formation and FC specification in the basal meristem of primary root (De Smet, 2012). 9


immunoprecipitation (ChIP) assays. First, we carried out ChIP assays with anti-GFP using the

FC establishment involves a complex interplay between auxin levels and internal oscillatordriving periodic gene-expression oscillations in the oscillation zone above the primary root tip, and the auxin maximum is merging as a key factor to trigger FC formation (Benkova and Bielach, 2010; De Smet, 2012; Lavenus et al., 2013). Concerted actions of PIN1 with PIN3 and PIN7 in the stele of primary root pump auxin towards the root tip; subsequently, auxin is refluxed largely via PIN2 back into the basal meristem region located just above the root tip (Petrasek and Friml, 2009). Auxin flux in the basal meristem plays an important role for the priming of XPP cells

We show that CLF is strongly expressed in the stele of meristematic zone in the primary root, represses PIN1 expression, and acts to downregulate the auxin maximum in root tip. In the loss-of-function clf mutants, the increase of auxin maximum in the root tip is expected to result from an increased basipetal auxin flux passing through the basal meristem (due to an increase in PIN1 abundance), and may cause an elevated auxin reflux back into the basal meristem. In fact, we have observed an obvious increase of auxin maximum in the primary root meristematic zone of clf-81 (Figures 4 and 6A). This, very likely, is responsible for that more XPP cells (in the stele) are primed to develop into FCs in the primary roots upon disruption of CLF function. Of note, consistent with the notion of elevated auxin reflux in the clf mutants, we observed that PIN2 expression was moderately increased upon loss of CLF function (data not shown). In short, we postulate that EMF2-CLF PRC2 functions to downregulate auxin maxima in the oscillation zone above the primary root tip to inhibit FC establishment in Arabidopsis. Besides its role in LR FC establishment, CLF may function in LRP formation and LR growth and development. During LRP organogenesis (from Stage I through the last stage), CLF expression gradually increases (Figure 5C), indicating that CLF-PRC2 may play a role in LR growth and development. A recent study (Aichinger et al., 2011) and this study as well (Figures 2 and 4), have shown that CLF acts to reduce primary root meristem size and thus inhibit primary root growth. It is very likely that EMF2-CLF PRC2 may also act to inhibit LR growth.

10


(Lavenus et al., 2013; Lucas et al., 2008).

METHODS

Plant Materials and Growth Conditions clf-1, clf-81, clf-59, slr-1, the DR5-GUS line, the DR5-GFP line, and the pPIN1-PIN1:GFP line were described previously (Benkova et al., 2003; Fukaki et al., 2002; Saleh et al., 2007; Schubert et al., 2006; Ulmasov et al., 1997). arf7 arf19 (CS24625) was obtained from the Arabidopsis Biological Resource Center. Plants were grown on vertically-positioned square plates of the half-

LRP Analysis Primary roots were fixed and cleared as described previously (Duan et al., 2013). Briefly, roots were cleared in a modified Hoyer’s solution (chloral hydrate:glycerol:water in the ratio of 8:1:2, W/V/V). Primordial were examined with a Leica DM 4500 B microscope equipped with Nomarski optics. The total number of LRPs was counted for each primary root, and LRP density was calculated by dividing the total number with the length of the LR formation zone.

RNA Analysis by RT-qPCR Total RNAs were extracted from the roots of seedlings grown on meshes laid on the half-MS medium in vertically-positioned plates, using the RNeasy Plus Mini Kit (Qiagen). To measure the transcript levels of EMF2 and PIN1, real-time quantitative PCR was performed on an ABI Prism 7900HT sequence detection system using a SYBR green PCR master mix as described previously (Gu et al., 2013). The primers used are specified in Supplemental Table 1.

Histochemical Staining of GUS Activity GUS staining was conducted as described previously (Malamy and Benfey, 1997). Briefly, seedlings were incubated in a fresh staining buffer at 37ºC for 2-8 h; after cleaning, the GUSstained root tissues were imaged with a Leica DM4500B equipped with Nomarski optics.

Quantification of GFP Fluorescence Intensity The fluorescence intensities of DR5-GFP and PIN1:GFP were quantified by ImageJ . Briefly, a rectangular region in each root-tip image was selected with the ROI tool (note that each selected 11


MS medium with 0.8% agar and 1% sucrose in long days (16-hr light/8-hr dark) at 22ºC.

region is positioned in the center of an image), and the gray value of each region was measured for integrated density. The value of integrated density was used to calculate the relative value of intensity.

Plasmid Construction For the creation of pSUC2-EMF2 (dsRNAi) vectors, the 35S promoter in pJawohl8-RNAi (accession no.: AF408413) was first replaced by the 1.0-kb AtSUC2 promoter, and subsequently binary vector pPZP212 (Hajdukiewicz et al., 1994). A 204-bp EMF2 fragment (part of the 17th exon) was placed downstream of the AtSUC2 promoter in the modified pPZP212 vector via Gateway technology (Invitrogen). To construct the pCLF-CLF:GFP plasmid, a 6.6-kb CLF genomic fragment including a 2.1-kb region upstream of TSS plus the entire 4.5-kb genomic coding sequence (without the stop codon) was inserted upstream of GFP (in frame) in the pMDC110 vector (Curtis and Grossniklaus, 2003). For pCLF-CLF:GUS construction, a 3.7-kb CLF genomic fragment including the 2.1-kb region upstream of TSS plus 1.6-kb genomic coding sequence was inserted upstream of GUS (in frame) in the pMDC162 vector (Curtis and Grossniklaus, 2003).

Chromatin Immunoprecipitation ChIP assays were performed as described previously with minor modifications (Johnson et al., 2002). Briefly, total chromatin was extracted from the roots of 10 to 12-day-old seedlings and immunoprecipitated with a Rabbit polyclonal anti-GFP (Abcam, Cat #: ab290), or antiH3K27me3 (Millipore, Cat #: 07-449). The amounts of PIN1 and the constitutively-expressed TUB8 fragments were quantified on an ABI Prism 7900HT sequence detection system using a SYBR Green PCR master mix. The constitutively-expressed TUB8 that lacks of H3K27me3 was used as the endogenous control. The primers used for PIN1 amplification are specified in Supplemental Table 1.

SUPPLEMENTARY DATA Supplementary Data are available at Molecular Plant Online. 12


the Gateway-compatible dsRNAi cassette driven by the AtSUC2 promoter were cloned into the

ACKNOWLEDGEMENTS We are indebted to Zoya Avramova, Justin Goodrich and Hidehiro Fukaki for the seeds of clf-1, clf-81 and slr-1, respectively. We thank Yizhong Wang for assistance. This work was supported by a grant from the Singapore Ministry of Education (AcRF Tier 2; MOE2013-T2-1-025) to Y.H., and partly by the Temasek Life Sciences Laboratory to Y.H. and T.X.


13

REFERENCES

Aichinger E., Villar C. B., Di Mambro R., Sabatini S., and Kohler C. (2011). The CHD3 chromatin remodeler PICKLE and Polycomb group proteins antagonistically regulate meristem activity in the Arabidopsis root. Plant Cell. 23, 1047-1060.

plant development. Curr Opin Plant Biol. 15, 523-529. Benkova E., and Bielach A. (2010). Lateral root organogenesis - from cell to organ. Curr Opin Plant Biol. 13, 677-683. Benkova E., et al. (2003). Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602. Blilou I., et al. (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature. 433, 39-44. Butenko Y., and Ohad N. (2011). Polycomb-group mediated epigenetic mechanisms through plant evolution. Biochim Biophys Acta. 1809, 395-406. Casson S. A., and Lindsey K. (2003). Genes and signalling in root development. New Phytologist. 158, 11-38. Chapman E. J., and Estelle M. (2009). Mechanism of auxin-regulated gene expression in plants. Annu Rev Genet. 43, 265-285. Chen M., et al. (2011). RopGEF7 regulates PLETHORA-dependent maintenance of the root stem cell niche in Arabidopsis. Plant Cell. 23, 2880-2894. Cui H., and Benfey P. N. (2009). Interplay between SCARECROW, GA and LIKE HETEROCHROMATIN PROTEIN 1 in ground tissue patterning in the Arabidopsis root. Plant J. 58, 1016-1027. 14


Bemer M., and Grossniklaus U. (2012). Dynamic regulation of Polycomb group activity during

Curtis M. D., and Grossniklaus U. (2003). A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol. 133, 462-469. De Rybel B., et al. (2010). A novel aux/IAA28 signaling cascade activates GATA23-dependent specification of lateral root founder cell identity. Curr Biol. 20, 1697-1706. De Smet I. (2012). Lateral root initiation: one step at a time. New Phytol. 193, 867-873.

meristem of Arabidopsis. Development. 134, 681-690. Doyle M. R., and Amasino R. M. (2009). A single amino acid change in the Enhancer of zeste ortholog CURLY LEAF results in vernalization-independent, rapid flowering in Arabidopsis. Plant Physiol. 151, 1688-1697. Duan L., et al. (2013). Endodermal ABA signaling promotes lateral root quiescence during salt stress in Arabidopsis seedlings. Plant Cell. 25, 324-341. Dubrovsky J. G., et al. (2008). Auxin acts as a local morphogenetic trigger to specify lateral root founder cells. Proc Natl Acad Sci U S A. 105, 8790-8794. Fukaki H., Tameda S., Masuda H., and Tasaka M. (2002). Lateral root formation is blocked by a gain-of-function mutation in the SOLITARY-ROOT/IAA14 gene of Arabidopsis. Plant J. 29, 153-168. Garay-Arroyo A., et al. (2013). The MADS transcription factor XAL2/AGL14 modulates auxin transport during Arabidopsis root development by regulating PIN expression. Embo J. 32, 2884-2895. Gu X., et al. (2013). Arabidopsis FLC clade members form flowering-repressor complexes coordinating responses to endogenous and environmental cues. Nat Commun. 4, 1947.

15


De Smet I., et al. (2007). Auxin-dependent regulation of lateral root positioning in the basal

Hajdukiewicz P., Svab Z., and Maliga P. (1994). The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol. 25, 989-994. Johnson L., Cao X., and Jacobsen S. (2002). Interplay between two epigenetic marks: DNA methylation and histone H3 lysine 9 methylation. Curr Biol. 12, 1360-1367. Kim S. Y., Zhu T., and Sung Z. R. (2010). Epigenetic regulation of gene programs by EMF1

Kornet N., and Scheres B. (2009). Members of the GCN5 histone acetyltransferase complex regulate PLETHORA-mediated root stem cell niche maintenance and transit amplifying cell proliferation in Arabidopsis. Plant Cell. 21, 1070-1079. Lavenus J., et al. (2013). Lateral root development in Arabidopsis: fifty shades of auxin. Trends Plant Sci. 18, 450-458. Li J., Dai X., and Zhao Y. (2006). A role for AUXIN RESPONSE FACTOR 19 in auxin and ethylene signaling in Arabidopsis. Plant Physiol. 140, 899-908. Liu C., Li L. C., Chen W. Q., Chen X., Xu Z. H., and Bai S. N. (2013). HDA18 affects cell fate in Arabidopsis root epidermis via histone acetylation at four kinase genes. Plant Cell. 25, 257-269. Lucas M., Godin C., Jay-Allemand C., and Laplaze L. (2008). Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J Exp Bot. 59, 55-66. Malamy J. E., and Benfey P. N. (1997). Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development. 124, 33-44. Moon Y. H., et al. (2003). EMF genes maintain vegetative development by repressing the flower program in Arabidopsis. Plant Cell. 15, 681-693.

16


and EMF2 in Arabidopsis. Plant Physiol. 152, 516-528.

Moreno-Risueno M. A., Van Norman J. M., Moreno A., Zhang J., Ahnert S. E., and Benfey P. N. (2010). Oscillating gene expression determines competence for periodic Arabidopsis root branching. Science. 329, 1306-1311. Okushima Y., Fukaki H., Onoda M., Theologis A., and Tasaka M. (2007). ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis.

Petrasek J., and Friml J. (2009). Auxin transport routes in plant development. Development. 136, 2675-2688. Petricka J. J., Winter C. M., and Benfey P. N. (2012). Control of Arabidopsis root development. Annu Rev Plant Biol. 63, 563-590. Saleh A., Al-Abdallat A., Ndamukong I., Alvarez-Venegas R., and Avramova Z. (2007). The Arabidopsis homologs of Trithorax (ATX1) and Enhancer of zeste (CLF) establish 'bivalent chromatin marks' at the silent AGAMOUS locus. Nucleic Acids Res. 35, 62906296. Schubert D., et al. (2006). Silencing by plant Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine 27. Embo J. 25, 4638-4649. Schuettengruber B., Chourrout D., Vervoort M., Leblanc B., and Cavalli G. (2007). Genome regulation by Polycomb and Trithorax proteins. Cell. 128, 735-745. Truernit E., and Sauer N. (1995). The promoter of the Arabidopsis thaliana SUC2 SUCROSEH+ SYMPORTER gene directs expression of beta-Glucuronidase to the phloem: evidence for phloem loading and unloading by SUC2. Planta. 196, 564-570.

17


Plant Cell. 19, 118-130.

Ulmasov T., Murfett J., Hagen G., and Guilfoyle T. J. (1997). Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell. 9, 1963-1971. Vieten A., et al. (2005). Functional redundancy of PIN proteins is accompanied by auxindependent cross-regulation of PIN expression. Development. 132, 4521-4531.

is required for proper Arabidopsis root growth and development. PLoS ONE. 8, e56537. Zhang X., et al. (2007). Whole-genome analysis of histone H3 lysine 27 trimethylation in Arabidopsis. PLoS Biol. 5, e129.

18


Yao X., Feng H., Yu Y., Dong A., and Shen W. H. (2013). SDG2-mediated H3K4 methylation

19


Figure 1. EMF2 Knockdown Causes Increased Primary Root Growth and LR Formation. (A) EMF2 gene structure. Exons are represented by black boxes; the blue bar indicates the 204-bp region used to knock down EMF2 expression. (B) Phenotypes of EMF2-knockdown lines (single-locus T3 homozygotes). Shown are 10-d-old seedlings. (C) Primary root length of the indicated seedlings. 20-23 10-d-old seedlings were scored for each line; error bars indicate standard deviation (SD). (D) Relative EMF2 transcript levels in the primary roots of indicated lines. The transcripts were quantified by RT-qPCR, and normalized to the endogenous control TUBULIN2 (TUB2); relative expression to Col is presented; error bars for SD of three measurements. (E) LR number per primary root of the indicated seedlings. 20-23 10-d-old seedlings were scored for each line; bars for SD. (F-G) LRP number per primary root (F) and LRP density (G) of the indicated seedlings. 20-21 10-d-old seedlings were scored for each line; bars for SD. (C, E-G) Double asterisks indicate statistically significant differences (p < 0.01) in the means between Col and EMF2-RNAi-1 or EMF2-RNAi-2, as revealed by a two-tailed Student’s t-test.

20


Figure 2. CLF Inhibits Primary Root Growth and LR Formation. (A) Phenotypes of 10-d-old Col and clf-81 seedlings. (B) LR number per primary root of Col and clf-81seedlings from 4 to 12 days after germination (DAG). 20 seedlings were scored for each line; bars for SD. One of the two biological replicates with similar results is presented. (C-D) LRP number per primary root (C) and LRP density (D) of Col and clf-81 seedlings from 4 to 12 DAG. 15-16 seedlings were scored for each line; bars for SD. (E) Primary root length of Col and clf-81seedlings from 4 to 12 DAG. 20 seedlings were scored for each line; bars for SD. (F-G) Primary root length (F) and LR number per primary root (G) of Ws and clf-59 (a gain-of-function allele) seedlings at 10 DAG. 17-20 seedlings were scored for each line. (H) LR number per primary root of Ws and clf-1 seedlings at 10 DAG. 20 seedlings were scored for each line. (F-H) Asterisks indicate statistically significant differences (* for p < 0.05; ** for p < 0.01) in the means between Ws and a clf mutant, as revealed by two-tailed Student’s t-test; bars for SD.

21


Figure 3. Genetic Interactions of CLF with SLR, ARF7 and ARF19. (A-B) Phenotypes of the indicated seedlings at 10 DAG.

22


Figure 4. GUS Staining of Col and clf-81 Primary Roots Expressing DR5-GUS. Ten 8-d-old seedlings for each genotype were stained for 2 h and examined. Arrows mark pre-branch sites with black arrows for LRPs and white ones for presumptive founder cells (FCs); EZ for elongation zone, MZ for meristematic zone, and white scale bars for 0.5 mm.

23


Figure 5. CLF Spatial Expression Patterns in Roots. (A) Schematic drawings of pCLFCLF:GUS. Black boxes indicate CLF exons, and the blue box represents GUS. Note that the 2.1kb fragment upstream of the CLF TSS consists of a promoter region and part of an upstream gene. (B-C) Histochemical staining of GUS activity in the primary root (B) and lateral root primordial at various stages (C). The primary roots of 6-day-old CLF:GUS seedlings were stained for 2 h except for the Stage I primordial stained for 8 h, and nine independent lines were stained. (D) The CLF:GFP expression pattern in the fully-functional pCLF-CLF:GFP line (in the clf-81 background).

24


Figure 6. Analysis of the DR5-GFP Auxin Maximum Reporter in Col and clf Primary Roots. (A-B) Auxin maxima (A) and relative GFP intensity (B) in Col and clf root tips expressing DR5GFP. Primary roots from 6-d-old seedlings were stained with propidium iodide, and the GFP fluorescence was imaged with a Carl Zeiss Exciter 5 Confocal microscope and its intensity was quantified by ImageJ. The fluorescence intensities of 8-9 primary roots were measured for each line, and relative intensity to the Col line expressing DR5-GFP is presented; error bars for SD. Scale bars denote 50 µm, whereas the broken line indicates GFP fluorescence along the central axis of root meristematic zone.

25


Figure 7. CLF directly Represses PIN1 Expression in Roots. (A-B) Relative PIN1 transcript levels in the roots of indicated seedlings at 6 DAG. The transcripts were quantified by RT-qPCR, and normalized to TUB2; bars for SD of triple measurements. (C-D) The abundance of PIN1:GFP protein in the primary roots (C) and LRPs (D) of 6-d-old Col and clf-81 seedlings expressing pPIN1-PIN1:GFP. (E) Relative GFP intensity in Col and clf root tips expressing PIN1:GFP. The fluorescence intensities of 7-8 primary roots were measured for each line, and relative intensity to the Col line expressing PIN1:GFP is presented; bars for SD. (F) ChIP analysis of CLF enrichment and H3K27me3 state at the PIN1 locus in roots. Immunoprecipitated genomic fragments were quantified by qPCR, and normalized to the endogenous control TUBULIN8 (TUB8). The fold enrichments of CLF:GFP protein in each examined PIN1 region over control (Col) are shown, with error bars for SD of three biological repeats. With regard to the H3K27me3 levels in each examined region in clf-1, they were normalized to Ws (wild type), with error bars indicating SD of three measurements; a biological repeat is shown in Supplemental Figure 3.

Supplemental Figure Legends

Supplemental Figure 1. Rescue of clf-81 by the pCLF-CLF:GFP. (A) Phenotypes of 10-d-old Col, clf-81 and a transgenic line of clf-81 expressing a single-locus CLF:GFP (T3 homozygote). (B-C) Primary root length (B), and LR number per primary root (C) of the indicated seedlings at

Supplemental Figure 2. Analyses of DR5-GFP (A) and PIN1:GFP (B) in Col and clf-81 Primary Roots with the Same Length. 15-mm main roots in (A) and 16-mm main roots in (B); bar for 50 µm.

Supplemental Figure 3. A Biological Repeat of the H3K27me3 ChIP Analysis Presented in Figure 7F.

1


10 DAG. At least 21 seedlings were scored for each line; bars for SD.


2


3


4

Supplemental Table 1. List of Primers Used in This Study Experiments Amplified regions Forward (F) and reverse (R) primers RT-qPCR

F: CGATTACTCCACCGCTACGAACG R: GCCTGCGTCGTTTTGTTGCTTAT

EMF2

F: CCTGTTGAACTCTACAATATCATTCAACGC R: GGAATAATTTTTGAGTTTGTACCCCAGC

PIN1-I

F: CAAGATGAGCGATCAAAGGATTGAATAG R: CCAAAGACTTTGTGGGTGGAGATAAAAG

PIN1-II

F: CAGCAAACAGTTTTAGCTTCATTAACAAAATAT R: TAATCATCTTTTGTTCGCCGGAGAA

PIN1-III

F: TTTCATTATCAATCTGGAGGAAGTGGTG R: CAGAGATCTTAACGTCCTTTTGATGATCG

PIN1-IV

F: CTTTTTTACCTTGTTTATGTTTCAGTAGACTTCC R: TTGCTTTTTGGTTAATTTAAGTTTATACACTGTT

5


ChIP-qPCR

PIN1

Arabidopsis thaliana RALF1 opposes brassinosteroid effects on root cell elongation and lateral root formation.

Lateral root initiation in Arabidopsis thaliana: a force awakens.

Chrysanthemum transcription factor CmLBD1 direct lateral root formation in Arabidopsis thaliana.

DNA damage inhibits lateral root formation by up-regulating cytokinin biosynthesis genes in Arabidopsis thaliana.

HISTONE DEACETYLASE 9 represses seedling traits in Arabidopsis thaliana dry seeds.

The histone H3 variant H3.3 regulates gene body DNA methylation in Arabidopsis thaliana.

Megakaryocytic leukemia 1 directs a histone H3 lysine 4 methyltransferase complex to regulate hypoxic pulmonary hypertension.

Histone lysine methyltransferase SDG8 is involved in brassinosteroid-regulated gene expression in Arabidopsis thaliana.

Arabidopsis thaliana mitogen-activated protein kinase 6 is involved in seed formation and modulation of primary and lateral root development.

Genomic organization and nucleotide sequences of two histone H3 and two histone H4 genes of Arabidopsis thaliana.

The histone H3 lysine 9 methyltransferase DIM-5 modifies chromatin at frequency and represses light-activated gene expression.

Histone methyltransferase Setd8 represses Gata2 expression and regulates erythroid maturation.

histone interaction in the H3 - H4 complex.

The circadian clock rephases during lateral root organ initiation in Arabidopsis thaliana.

Holocarboxylase synthetase 1 physically interacts with histone h3 in Arabidopsis.

The PHD-finger module of the Arabidopsis thaliana defense regulator EDM2 can recognize triply modified histone H3 peptides.

IAA14 gene function in Arabidopsis thaliana.

Glucose control of root growth direction in Arabidopsis thaliana.

Knockdown of the partner protein OsNAR2.1 for high-affinity nitrate transport represses lateral root formation in a nitrate-dependent manner.

Interaction between HY1 and H2O2 in auxin-induced lateral root formation in Arabidopsis.

Profiling of secondary metabolites in root exudates of Arabidopsis thaliana.

Hydraphile synthetic ion channels alter root architecture in Arabidopsis thaliana.

MEDIATOR25 Regulates Lateral Root Formation via Auxin Signaling in Arabidopsis.

Auxin Resistant1 and PIN-FORMED2 Protect Lateral Root Formation in Arabidopsis under Iron Stress.