GENOMICS14, 590-597 (1992)
A Human Dimorphism Resulting from Loss of an Alu MARY C. EDWARDSAND RICHARDA. GIBBS Institute for Molecular Genetics, Bay/or College of Medicine, One Baylor Plaza, Houston, Texas 77030 Received May 18, 1992; revised July 30, 1992
The molecular phylogeny of Alu and other repeated s e q u e n c e s i n t h e h u m a n g e n o m e p r o v i d e s c l u e s to events during primate evolution. A subclass of human A l u ' s h a s b e e n p r e v i o u s l y i d e n t i f i e d as d i m o r p h i c ins e r t i o n s w i t h i n m e m b e r s o f t h e m e d i u m r e i t e r a t i o n frequency (mer) class of repeats, reflecting the complicated sequence of insertion and radiation events leadi n g to t h e c u r r e n t h u m a n g e n o m e s t r u c t u r e . O n e d i m o r p h i c A l u is l o c a t e d w i t h i n a p r e v i o u s l y u n i d e n t i fied m e r f a m i l y m e m b e r , i n t h e first i n t r o n o f t h e h u man T4 (CD4) gene. The insertion (Alu+ allele) has a f r e q u e n c y o f a p p r o x i m a t e l y 70% i n E u r o p e a n s a n d A f r i c a n s a n d is h o m o z y g o u s i n 2 0 A s i a n s a m p l e s . P o l y m e r a s e c h a i n r e a c t i o n a m p l i f i c a t i o n , d i r e c t D N A sequencing, and Southern analysis using oligonucleotlde probes revealed that the Alu- allele was derived from the Alu+ allele by loss of part of the inserted sequence. Comparison with a tightly linked marker within the human genome and studies of baboon DNA samples revealed that the original insertion was a relatively early event in primate evolution, but that the Alu sequence l o s s l e a d i n g to t h e d i m o r p h i s m h a s o c c u r r e d m u c h m o r e recently. Loss of Alu insertions therefore represents one mechanism for the generation of human Alu d i m o r p h i s m s . © 1 9 9 2 Academic Press, Inc.
INTRODUCTION T h e A l u family of D N A sequences is one of the most a b u n d a n t classes of h u m a n S h o r t I N t e r s p e r s e d Elem e n t s (SINEs) of repetitive D N A (Weiner et al., 1986). Insertion of individual A l u ' s at new positions in the gen o m e has been directly observed (Wallace et al., 1991; Vidaud et al., 1989), which suggests t h a t these elements can evolve in a m a n n e r similar to other r e t r o t r a n s p o sons. D N A sequence c o m p a r i s o n s have inferred a molecular p h y l o g e n y of several A l u subfamilies (Britten et al., 1988; J u r k a a n d Smith, 1988; L a b u d a a n d Striker, 1989), including a human-specific (HS) group, t h a t are t r a n scriptionally a n d r e t r o t r a n s p o s i t i o n a l l y c o m p e t e n t (Britten et al., 1989; M a t e r a et al., 1990; B a t z e r and Deininger, 1991; Shen et al., 1991). T h e insertions of the H S family m e m b e r s are sometimes dimorphic, which has been i n t e r p r e t e d as reflecting a relatively recent his0888-7543/92 $5.00 Copyright© 1992by AcademicPress, Inc. All rights of reproductionin any formreserved.
tory of transposition, where the alleles w i t h o u t A l u inserts ( A l u - ) have n o t been replaced by the A l u + alleles c o n t a i n i n g the sequence (Batzer a n d Deininger, 1991). Analysis of h u m a n genomic D N A reveals an A l u elem e n t on average every 4 kb, a l t h o u g h some studies have d e m o n s t r a t e d a clustering effect ( S t o p p a - L y o n e t et al., 1990). W e identified six A l u sequences by D N A sequencing of a 13-kb }, clone insert s p a n n i n g exons 1, 2, and 3 of the h u m a n T 4 (CD4) gene. One A l u was of particular interest because a database search revealed flanking nucleotides t h a t were similar to sequences found within a simian retrovirus-like r e m n a n t ($71) t h a t h a d previously been isolated from a h u m a n genomic library using a retroviral probe ( W e r n e r et al., 1990). In $71, the region of CD4 homology a b r u p t l y divides pol and gag genelike sequences (Fig. 1). I n CD4 the A l u is inserted within the reiterated sequence, providing a structure t h a t is reminiscent of the m e m b e r s of the m e d i u m reiteration frequency (mer) class of repeat elements t h a t have also been characterized as c o n t a i n i n g A l u insertions (Batzer et al., 1990; K a p l a n et al., 1991). T o investigate the molecular organization of the sequences t h a t were similar in CD4 a n d $71, we constructed oligonucteotide primers c o m p l e m e n t a r y to the Alu, the $71 version of the repeat ( " S 7 1 - m e r " ) , the CD4 version ( " C D 4 - S 7 1 - m e r " ) , a n d unique flanking sequences within the CD4 intron. P o l y m e r a s e chain reaction (PCR), Southern, a n d sequencing analyses revealed aspects of their structural a n d genetic organization a n d suggest a m e c h a n i s m based u p o n A l u loss for the origin of this dimorphic A l u insertion. MATERIALS AND METHODS
Materials. A Xclone (Xhgl) containing the 5' portion of the human CD4 gene was kindly provided by Dr. Dan Littman. Anonymous YAC clones were provided by Dr. Craig Chinault and the Baylor College of Medicine Human Genome Center Cloning Core. Papio sp. baboon DNA and the "zoo blot" were provided by Dr. Paula Clemens. Human genomic DNA samples differentiated by race were provided by Dr. Ray Fenwick and Holly Hammond. Oligonucleotide primers and probes (Table 1) were synthesized on an Applied Biosystems 380B DNA synthesizer. Automated sequencing of X clone, khgl DNA was sequenced using a random "shotgun" approach to accumulate 90% of the sequence, followed by a directed strategy to close gaps and provide at least twofold coverage of all bases (Edwards et al., 1990). Individual sequences 590
591
Alu LOSS P O L Y M O R P H I S M CD4
23
~iiii!ilili~.~iiiiiiiiiiiiiiii~
$71
I
I 6
CCTG
......
CCCCTCCACACCTG
TGGGTATTTCTCGCAAGGTGGAGACAAGAGACTGAGAAAAGAAAT
. - -A ...................
AAGACACAGAGAAAGT -CAG-
-G-
-GC
G ......
ATC
......
. -T-
.ATAGAGGAATAAAAGTGGGCCCAGGGG .....
T ......
A- -G-
-CT
....
................
C- -.. A ......
- -G ..........
A .....
.....
CA--A
AGGAGAGGG
.........
A-T
....
CATAAATAAGTTTAAGGAAAGG .............
T ....
G ..................
..........
......
G- - -C-T
GCAGTTI'~CTCCTCTCTCA T ....
. .......
G--C-
GT ........
CCGC
TTT
CTGTCTCAGTC-C,
...........
AT-G...
GGGGAAAC
-A- -C ........
..........
G - -C-C
• *********** -AIu-> T G C A A G A A C T T T T C T ~ -T-
- -AC--A-
GCGCG
- -'I'CAAC
....
ACTACAGG
AGG
-A--C--G-CTT
GCAG ......
C-T-
A-.
.......
T- -A .......
AAG
C ......
T-A-A
................
C. CTTCCTCCq~PC
ACTAATCCTC
T .............
CGGCCT
CT ......
A- - -C ....
CA .......
T .....
CACACTGCC , . - .......
T ......
T AGTCTTGCTCTGTCGCCCAGGCq~GGAGTG
TTCACG
CAGTG
CCATTCTCCTGCCTCAGCCTCCCGAGT
CCACCACGCCCGGCTAATTTTTTTGTA~AGTAGAG
ATGGGGTT
CCCGCCTTGG
A C A T G ~ T G C-C-
AGCACAGGG -CA
..............
C ............
C---A
CCTCCC
AAAATGC
A *~CCATTAA ACCTT A ..............
........
TTGC-GACAAAAGTTACAGATTAACAGCATCTC G-T-GG
AACAATTTTTCTTAGTACAGATCAAAATGGAGTTTCTTATG G .....
G .......
.....................................................
CGCCCG
-C ......
T ........
CC TTCCCATGAGGcCATAT ................. C ..........
0.99). These correspond to the (CTTTT)7/Alu+, (CTTTT)12/Alu+ , and (CTTTT)s/Alu- haplotypes. e x p e c t e d size w e r e P C R a m p l i f i e d f r o m 2 o f 25 r a n d o m l y chosen clones (data not shown). As these YACs each r e p r e s e n t e d a p p r o x i m a t e l y 200 k b o f h u m a n D N A , t h e S71-mer element was estimated to be present at approxim a t e l y 1000 c o p i e s in t h e h u m a n g e n o m e . Human sequence S71-mer primers were used to PCR amplify a fragment of the equivalent length in humans f r o m b a b o o n D N A (Fig. 4b). A n a l y s i s o f t h e f r a g m e n t with an Alu+ probe at high stringency revealed a different pattern of hybridization between the two species (Fig. 4c). T h e h u m a n s e q u e n c e - s p e c i f i c p r i m e r s in t h e CD4 intron outside the S71-mer repeat also PCR amp l i f y b a b o o n D N A , p r o d u c i n g a f r a g m e n t t h a t is a p p r o x i m a t e l y 200 b p l a r g e r t h a n t h e h u m a n C D 4 A l u + allele. Hybridization of the Alu+ probe indicated the presence o f a n A l u i n s e r t i o n i n t h i s b a b o o n D N A (Fig. 4c). P C R o f both human and baboon DNA, with combinations of p r i m e r s w i t h i n a n d f l a n k i n g t h e S71-mer, d e m o n s t r a t e d t h a t t h e a d d i t i o n a l ~ 2 0 0 b p in t h e b a b o o n C D 4 - S 7 1 - m e r f r a g m e n t is i n t h e 3' s e c t i o n f o l l o w i n g t h e A l u i n s e r t i o n (data not shown).
594
EDWARDS AND GIBBS 5892
5890
RO 146
a MW
k l AlU-/-
I I:-~
FI~I:-I
?~
b A I Alu-/-
RO 124
I FZ-Z'm-I V-Z'2--I A
c A I AIU-/-
i I -+/--If
+/+ i
I A
kb
13l ~ 09"" 06""
F I G . 3. Southern blot hybridization of PCR-amplified S71-mer sequences. The schematic shows placement of the PCR primers 5890 and 5892 within the mer repeat to amplify other loci as well as the CD4 locus, and placement of probes specific for the Alu+ allele (R0124) and common to both the Alu+ and A l u - alleles (RO146). (a) Agarose gel showing (left to right) PCR product of four h u m a n genomic DNAs previously characterized as A l u - / - at the CD4-S71-mer site, two A l u + / - heterozygotes, and two A l u + / + homozygotes. A fragment of 930-bp predominates, corresponding to the expected size of multiple S71-mer family members without Alu insertions. As a size marker and control the P C R product of the },hgl clone containing CD4-S71-mer Alu+ allele is included (1227 bp). (b) Southern analysis of PCR products with the Alu+-specific probe shows multiple hybridization sites. (c) Southern analysis with the probe for the shared sequence between Alu+ and A l u alleles revealed hybridization only in the bands containing the CD4-S71-mer locus alleles.
Comparison of S71-mer Forms The sequences for the S71-mer reported by Werner et al. (1990) and the CD4 S71-mer differ at 16% of the nucleotide positions, including small gaps and single DNA base substitutions. PCR using primers specific to the S71-mer sequence produced an approximately 600bp band in human and baboon genomic DNA, while no amplification was observed in control reactions that contained CD4-S71-mer A l u + / + PCR product template. Southern blot analysis of these reactions with the A l u - probe revealed no A l u insertions into the S71-type S71-mer's (data not shown). DISCUSSION The first intron of the human CD4 locus contains a member of a novel mer-repeat family designated the S71-mer's. S71-mer's appear typical of other mer repeats that also have an abundance of 200-10,000 copies in the human genome and occasionally contain dimorphic A l u insertions (Batzer et al., 1990; Kaplan et al., 1991). One allelic form of the CD4-S71-mer contains a full-length A l u that has been inserted at some time in primate evolution and a second allelic form lacks the full-length Alu. The molecular analysis of the dimorphic A l u insertion within the CD4-S71-mer suggests a different sequence of events leading to this A l u polymorphism, in comparison to previous models. Others have interpreted dimorphic human A l u insertions as resulting from gain of an A l u in one allele and therefore representing relatively recent evolution. This " A l u gain" mechanism is likely at many sites, considering models for the mechanism of retrotransposition events and that de novo A l u insertions
that mutate human genes have now been identified (Vidaud et al., 1989; Wallace et al., 1991). The model fails to consider the stability of monomorphic A l u insertion sites, however, where an alternate mechanism of " A l u loss" could give rise to polymorphism. The primary evidence that supports a model of " A l u loss" at the human CD4-S71-mer locus is the identification of a " r e m n a n t " of an A l u sequence within the A l u allele. The remnant is identical to the A l u + allele over 30 nucleotides and a poly(A) sequence. One base position appears to be heterozygous for a C to T transition, but is within a CpG site, which is known to frequently mutate (Labuda and Striker, 1989). The m e t sequences flanking the A l u bases in each allele were also identical. Therefore the present structure of the locus is consistent with a model that includes a full-length A l u in the A l u - allele at some time in human evolution. In this case the key event in generating the A l u dimorphism would be the molecular rearrangemen t that led to the loss of the majority of the inserted A l u bases in a single individual, followed by an increase of the A l u - allele to the current gene frequency. The alternate possibility that the remnant shared by the Alu+ and A l u - alleles in CD4-S71-mer have an independent origin was addressed. Other S71-mer family members may also contain the truncated A l u and could be the precursors of a "parental" CD4-S71-mer that later had a full-length A l u insertion give rise to the polymorphism. In this case it should be possible to find members of the S71-mer family that also contained the remnant bases. Hybridization of A l u probes to amplified fragments revealed that other CD4-S71-mer like sequences in the human genome have A l u insertions. However, oligonucleotide probes that were specific for the
Alu LOSS POLYMORPHISM
595
Haplotyping studies using a second highly polymorphic marker ( C T T T T ) n that is within 10 kb of the CD4RO104 ~K- R O 1 2 4 Ro105 S71-mer A l u insertion site also suggest that the A l u "-'" ~ ~ AIu ~ - allele arose subsequent to the A l u + form. Both the A l u + 5892 5891 5890 and A l u - alleles exhibit striking association with a subset of the alleles at the linked locus. However, the A l u + form is often associated with two of the linked alleles b c Baboon Human Baboon Human ( ( C T T T T ) 7 and (CTTTT)12), while the A l u - form is I I I I t I [ I I II I II MW I II I II strongly associated with only the ( C T T T T ) 8 allele. kb These data are compelling, as the sites of DNA polymorphisms containing short (2-5 bases) repeated sequences are frequently highly polymorphic and are therefore be1.3 lieved to undergo rapid molecular evolution (Edwards et 1.1 al., 1991b). The identification of a single ( C T T T T ) n al0 . 9 ~lele associated with the A l u - form therefore most likely 0.6,reflects the recent loss of the A l u in this background and insufficient time for new haplotypes to emerge. F I G . 4. S71-mer and associated Alu repeat complex is found in The amplification and hybridization of related seOld World monkey DNA. (a) A zooblot containing DNA of various quences from baboon DNA also support the model of an species reveals multiplicity of S71-mer in primates. Southern analysis early A l u insertion into the S71-mer-related sequences was performed on EcoRI-digested hamster, mouse, dog, baboon, and at the CD4 locus. Oligonucleotide primers complemenh u m a n DNA, as well as several invertebrate species DNAs (mammals shown only), using a PCR-amplified S71-mer probe (primers 5891 and tary to the human CD4 intron were used to amplify a 5892). At high-stringency conditions (65°C), hybridization is distinct discrete fragment from the baboon sample that cona n d exclusive to baboon and h u m a n DNA. (b) Alu-inclusive S71tained S71-mer sequences and included an A l u insertion. mer's are also present in baboon DNA. PCR using baboon DNA as Additional bases were also present in the fragment amtemplate and primers complementary to the S71-mer repeat (primers 5890 and 5892, reactions II) reveal a primary band the same length in plified from the baboon, however, and further studies are the baboon as in humans. The p a t t e r n of faint secondary bands is not required to reveal more details of the similarity between identical between the species. The h u m a n CD4 intron 1 primers the primate species. (RO104 and RO105, reactions I) amplify a fragment of approximately The molecular events that led to excision of the A l u 1.7 kb in the baboon. (c) Southern blot analysis of these reactions with the Alu+ probe (RO124) shows t h a t Alu elements are represented bases at the CD4-S71-mer site could involve cellular within S71-mers in baboons, and in the CD4 S71-mer locus specifimutational machinery or may specifically be related to cally. Reactions using an A l u + / - h u m a n DNA control template are the role of A l u as a transposable element. The data preincluded for comparison and demonstrate t h a t the Alu+ probe will not sented here do not distinguish between these possibilihybridize to an A l u - fragment. ties; however, it is noteworthy that the A l u deletion reA l u bases common to the A l u + and A l u - alleles showed stores the S71-mer flanking sequence and yields a struct h a t none of the amplified fragments apart from the ture that is similar to the 5'-truncated A l u fragments CD4-S71-mer site contained the remnant. Therefore an identified elsewhere in human DNA. These truncated A l u gain model that includes the presence of the A l u Alu's are usually attributed to aborted retrotransposir e m n a n t at this locus before the insertion of the full- tional events, but the identification of the CD4-S71-mer A l u remnant suggests that other truncated A l u fraglength A l u in the A l u + allele appears unlikely. T h e model of A l u loss at the CD4-S71-mer site is indi- ments in the human genome may have arisen from an rectly supported by studies of human allelic frequencies, A l u loss mechanism. The phylogenetic position of the CD4-S71-mer A l u linked markers, and other taxa. In European-origin and among other Alu's may influence the mechanism of genAfrican-origin Americans, the A l u - is present as approxeration of dimorphism at this site. A l u dimorphism in imately 20% of alleles, but was absent in DNA samples human populations has primarily been associated with from East Asians. While these data are not immediately the HS-2 A l u subfamily. One dimorphic non-HS Alu, consistent with current models of early divergence of the dissimilar to the A l u described here, has been noted preAsian and European lineages from the African lineage (Cavalli-Sforza et al., 1988; Nei and Livshits, 1989), they viously (Stoppa-Lyonet et al., 1990). A l u insertions may be influenced by the presumed admixture of ances- causing mutations at the cholinesterase gene locus and tral Asian and African populations to form the Euro- giving rise to neurofibromatosis type 1 have involved HS pean lineage (Bowcock et al., 1991) or the recent genetic and class IV Alu's (Muratani et al., 1991; Wallace et al., contribution of European descendants to African descen- 1991). The CD4-S71-mer A l u lacks bases that are diagdants in American populations (Reed, 1969). T h e pres- nostic for the HS family and is likely to be a member of ence of the A l u + allele at high frequency, and at homozy- an older subgroup. If the CD4-S71-mer A l u lacks the gosity in one of the racial groups, is consistent, however, structure and activities that allow the HS A l u family with the insertion as an earlier event in human evolution members to undergo frequent retrotransposition, then this site may be more likely to alter via alternative paththan the loss of A l u sequences in one allele. ~
a
596
EDWARDS AND GIBBS 8
b|i!ii~ii!!i!iiiiiiiiiiii!i!i!~iiiil ~iiiiiiiiiiiiiiiii!i!i!i!iiiiiiii!i!Nii!iiil |iiiiiiiiiiiiiiiiiiiiiiiiiii!iiiiiiiiiiii!i!iiiN
0). iiiiiiiii!iiiii!i!ii::!iii!iiiiiiii~
FIG. 5. Radiation of S71-mer forms in primates suggest an evolutionary sequence. (a) An Alu insertionless form of the repeat, includingthe $71 retrovirus-type and progenitor CD4-type, underwent radiation in primates. (b) The CD4-type radiated to multiple loci in primates. (e) A representative of the CD4-type acquired an Alu insertion and subsequently radiated to multiple sites, including the CD4 intron 1 locus, in primates. (d) Loss of the Alu at the CD4 locus creates alleles that are dimorphic in human populations. ways. A s e a r c h for a d d i t i o n a l p o l y m o r p h i s m s a m o n g non-HS Alu's may address this possibility. T h e s e q u e n c e of e v o l u t i o n a r y e v e n t s t h a t is m o s t l i k e l y to h a v e g i v e n rise to t h e c u r r e n t s t r u c t u r e of t h e C D 4 - S 7 1 - m e r locus is s u m m a r i z e d i n Fig. 5. A m o n g t h e m a n y e a r l y f o r m s of S 7 1 - m e r , o n e w a s i n s e r t e d i n t o t h e p r i m a t e g e n o m e a t t h e site of t h e $71 r e t r o v i r a l r e m n a n t a n d a n o t h e r a t t h e C D 4 locus. T h e p r e c i s e r e l a t i o n s h i p b e t w e e n these m e m b e r s c a n n o t be inferred, b u t the multiple forms suggest t h a t m e m b e r s w i t h o u t Alu insertions u n d e r w e n t r a d i a t i o n i n p r i m a t e s . T h e p h a s e of e v o l u t i o n a t w h i c h a n A l u i n s e r t i o n e v e n t o c c u r r e d m a y or m a y n o t p r e d a t e t h e i n s e r t i o n of t h e S 7 1 - m e r f a m i l y m e m b e r i n t o t h e C D 4 locus. S u b s e q u e n t l y t h e A l u s e q u e n c e was lost f r o m o n e of t h e C D 4 alleles to e v e n t u a l l y give rise to t h e d i m o r p h i s m d e s c r i b e d here. T h e e x a c t d a t e of t h e A l u loss is i n d e t e r m i n a t e ; h o w e v e r , t h e e v e n t w a s r e c e n t e n o u g h for t h e d i m o r p h i s m to b e e x p r e s s e d a t d i f f e r e n t f r e q u e n c i e s i n s e p a r a t e h u m a n p o p u l a t i o n s . T h i s suggests t h a t t h e A l u loss m a y h a v e o c c u r r e d a f t e r t h e earliest d i v e r g e n c e of t h e p o p u l a t i o n g r o u p s i n t h i s s t u d y , w h i c h is e s t i m a t e d to b e a p p r o x i m a t e l y 100,000 y e a r s ago ( K l e i n , 1989).
ACKNOWLEDGMENTS We thank Chris Povinelli, Bob Cottingham, Paula Clemens, Winston Hide, Bjorn Anderrson, Randy Smith, and Grant MacGregor for valuable discussions and reading the manuscript; Ray Fenwick, Holly Hammond, Dan Littman, and Paula Clemens for DNA samples; and Donna Muzny and Mike Metzker for technical help. This work was supported in part by Grants USPH U01 A130243 and RR06404 and from funds provided by the W. M. Keck Foundation.
REFERENCES Batzer, M. A., and Deininger, P. L. (1991). A human-specific subfamily of Alu sequences. Genomics 9: 481-487.
Batzer, M. A., Kilroy, G. E., Richard, P. E., Shaikh, T. H., Desselle, T. D., Hoppens, C. L., and Deininger, P. L. (1990). Structure and variability of recently inserted Alu family members. Nucleic Acids Res. 19: 698-699. Bowcock, A. M., Kidd, J. R., Mountain, J. L., Hebert, J. M., Carotenuto, L., Kidd, K. K., and Cavalli-Sforza, L. L. (1991). Drift, admixture and selection in human evolution: A study with DNA polymorphisms. Proc. Natl. Acad. Sci. USA 88: 839-843. Britten, R. J., Stout, D. B., and Davidson, E. H. (1988). Sources and evolution of human Alu repeated sequences. Proc. Natl. Acad. Sci. USA 85: 4770-4774. Britten, R. J., Stout, D. B., and Davidson, E. H. (1989). The current source of human Alu retroposons is a conserved gene shared with Old World monkey. Proc. Natl. Acad. Sci. USA 86: 3718-3722. Cavalli-Sforza, L. L., Piazza, A., Menozzi, P., and Mountain, J. (1988), Reconstruction of human evolution: Bringing together genetic, archaelogical, and linguistic data. Proc. Natl. Acad. Sci. USA 85: 6002-6006. Daniels, G. R., and Deininger, P. L. (1985). Integration site preferences of the Alu family and similar repetitive DNA sequences. Nucleic Acids Res. 13: 8939-8954. Deininger, P. L., and Slagel, V. K. (1988). Recently amplified Alu family members share a common parental Alu sequence. Mol. Cell Biol. 8: 4566-4569. Edwards, A., Voss, H., Rice, P., Civitello, A., Stegemann, J., Schwager, C., Zimmerman, J., Erfle, H., Caskey, C. T., and Ansorge, W. (1990). Automated DNA sequencing of the human HPRT locus. Genomics 6: 593-608. Edwards, A., Civitello, A., Hammond, H. A., and Caskey, C. T. (1991a). DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am. J. Hum. Genet. 49: 746-756. Edwards, M. C., Clemens, P. R., Tristan, M., Pizzuti, A., and Gibbs, R. A. (1991b). Pentanucleotide repeat length polymorphism at the human CD4 locus. Nucleic Acids Res. 19: 4791. Gibbs, R. A., Nguyen, P. N., and Caskey, C. T. (1991). Direct DNA sequencing of complementary DNA amplified by the polymerase chain reaction. In "Methods in Molecular Biology" (C. Matthew, Ed.), Humana, Clifton, NJ. Haft, L., Atwood, J. G., Dicesare, J., Katz, E., Picozza, E., Williams, J. F., and Woudenberg, T. (1991). A high-performance system for automation of the polymerase chain reaction. Biotechniques 10: 102-112. Jurka, J., and Smith, T. (1988). A fundamental division in the Alu
Alu LOSS POLYMORPHISM
family of repeated sequences. Proc. Natl. Acad. Sci. USA 85: 44754778. Kaplan, D. J., Jurka, J., Solus, J. F., and Duncan, C. H. (1991). Medium reiteration frequency repetitive sequences in the human genome. Nucleic Acids Res. 19: 4731-4738. Klein, R. G. (1989). In "The Human Revolution: Behavioral and Biological Perspectives on the Origins of Modern Humans" (P. Mellars and C. Stringer, Eds.), pp. 529-546. Edinburgh Univ. Press, Edinburgh. Labuda, D., and Striker, G. (1989). Sequence conservation in Alu evolution. Nucleic Acids Res. 17: 2477-2491. Matera, A. G., Helmann, U., and Schmid, C. W. (1990). A transpositionally and transcriptionally competent Alu subfamily. Mol. Cell Biol. 10: 5424-5432. Muratani, K., Hada, T., Yamamoto, Y., Kaneko, T., Shigeto, Y., Ohue, T., Furuyama, J., and Higashino, K. (1991). Inactivation of the cholinesterase gene by Alu insertion: Possible mechanism for human gene transposition. Proc. Natl. Acad. Sci. USA 88: 1131511319. Nei, M., and Livshits, G. (1989). Genetic relationships of Europeans, Asians and Africans and the origin of modern Homo sapiens. Hum. Hered. 39: 276-281.
597
Reed, T. E. (1969). Caucasian genes in American Negroes. Science 165: 762-768. Shen, M. R., Batzer, M. A., and Deininger, P. L. (1991). Evolution of the master Alu gene(s). J. Mol. Evol. 33: 311-320. Stoppa-Lyonet, D., Carter, P. E., Meo, T., and Tosi, M. (1990). Clusters of intragenic Alu repeats predispose the human C1 inhibitor locus to deleterious rearrangements. Proc. Natl. Acad. Sc£ USA 67: 1551-1555. Vidaud, M., Vidaud, D., Siguret, V., Lavergne, J. M., and Goossens, M. (1989). Mutational insertion of an Alu sequence causes hemophilia B. Am. J. Hum. Genet. 45: A226. Wallace, M. R., Andersen, L. B., Saulino, A. M., Gregory, P. E., Glover, T. W., and Collins, F. S. (1991). A de novo Alu insertion results in neurofibromatosis type 1. Nature 3 5 3 : 864-866. Weiner, A. M., Deininger, P. L., and Efstratiadis, A. (1986). Nonviral retroposons: Genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55: 631-661. Werner, T., Brack-Werner, R., Leib-Mosch, C., Backhaus, H., Erfle, V., and Hehlmann, R. (1990). $71 is a phylogenetically distinct human endogenous retroviral element with structural and sequence homology to Simian Sarcoma Virus (SSV). Virology 174: 225-238.
A Human Dimorphism Resulting from Loss of an Alu MARY C. EDWARDSAND RICHARDA. GIBBS Institute for Molecular Genetics, Bay/or College of Medicine, One Baylor Plaza, Houston, Texas 77030 Received May 18, 1992; revised July 30, 1992
The molecular phylogeny of Alu and other repeated s e q u e n c e s i n t h e h u m a n g e n o m e p r o v i d e s c l u e s to events during primate evolution. A subclass of human A l u ' s h a s b e e n p r e v i o u s l y i d e n t i f i e d as d i m o r p h i c ins e r t i o n s w i t h i n m e m b e r s o f t h e m e d i u m r e i t e r a t i o n frequency (mer) class of repeats, reflecting the complicated sequence of insertion and radiation events leadi n g to t h e c u r r e n t h u m a n g e n o m e s t r u c t u r e . O n e d i m o r p h i c A l u is l o c a t e d w i t h i n a p r e v i o u s l y u n i d e n t i fied m e r f a m i l y m e m b e r , i n t h e first i n t r o n o f t h e h u man T4 (CD4) gene. The insertion (Alu+ allele) has a f r e q u e n c y o f a p p r o x i m a t e l y 70% i n E u r o p e a n s a n d A f r i c a n s a n d is h o m o z y g o u s i n 2 0 A s i a n s a m p l e s . P o l y m e r a s e c h a i n r e a c t i o n a m p l i f i c a t i o n , d i r e c t D N A sequencing, and Southern analysis using oligonucleotlde probes revealed that the Alu- allele was derived from the Alu+ allele by loss of part of the inserted sequence. Comparison with a tightly linked marker within the human genome and studies of baboon DNA samples revealed that the original insertion was a relatively early event in primate evolution, but that the Alu sequence l o s s l e a d i n g to t h e d i m o r p h i s m h a s o c c u r r e d m u c h m o r e recently. Loss of Alu insertions therefore represents one mechanism for the generation of human Alu d i m o r p h i s m s . © 1 9 9 2 Academic Press, Inc.
INTRODUCTION T h e A l u family of D N A sequences is one of the most a b u n d a n t classes of h u m a n S h o r t I N t e r s p e r s e d Elem e n t s (SINEs) of repetitive D N A (Weiner et al., 1986). Insertion of individual A l u ' s at new positions in the gen o m e has been directly observed (Wallace et al., 1991; Vidaud et al., 1989), which suggests t h a t these elements can evolve in a m a n n e r similar to other r e t r o t r a n s p o sons. D N A sequence c o m p a r i s o n s have inferred a molecular p h y l o g e n y of several A l u subfamilies (Britten et al., 1988; J u r k a a n d Smith, 1988; L a b u d a a n d Striker, 1989), including a human-specific (HS) group, t h a t are t r a n scriptionally a n d r e t r o t r a n s p o s i t i o n a l l y c o m p e t e n t (Britten et al., 1989; M a t e r a et al., 1990; B a t z e r and Deininger, 1991; Shen et al., 1991). T h e insertions of the H S family m e m b e r s are sometimes dimorphic, which has been i n t e r p r e t e d as reflecting a relatively recent his0888-7543/92 $5.00 Copyright© 1992by AcademicPress, Inc. All rights of reproductionin any formreserved.
tory of transposition, where the alleles w i t h o u t A l u inserts ( A l u - ) have n o t been replaced by the A l u + alleles c o n t a i n i n g the sequence (Batzer a n d Deininger, 1991). Analysis of h u m a n genomic D N A reveals an A l u elem e n t on average every 4 kb, a l t h o u g h some studies have d e m o n s t r a t e d a clustering effect ( S t o p p a - L y o n e t et al., 1990). W e identified six A l u sequences by D N A sequencing of a 13-kb }, clone insert s p a n n i n g exons 1, 2, and 3 of the h u m a n T 4 (CD4) gene. One A l u was of particular interest because a database search revealed flanking nucleotides t h a t were similar to sequences found within a simian retrovirus-like r e m n a n t ($71) t h a t h a d previously been isolated from a h u m a n genomic library using a retroviral probe ( W e r n e r et al., 1990). In $71, the region of CD4 homology a b r u p t l y divides pol and gag genelike sequences (Fig. 1). I n CD4 the A l u is inserted within the reiterated sequence, providing a structure t h a t is reminiscent of the m e m b e r s of the m e d i u m reiteration frequency (mer) class of repeat elements t h a t have also been characterized as c o n t a i n i n g A l u insertions (Batzer et al., 1990; K a p l a n et al., 1991). T o investigate the molecular organization of the sequences t h a t were similar in CD4 a n d $71, we constructed oligonucteotide primers c o m p l e m e n t a r y to the Alu, the $71 version of the repeat ( " S 7 1 - m e r " ) , the CD4 version ( " C D 4 - S 7 1 - m e r " ) , a n d unique flanking sequences within the CD4 intron. P o l y m e r a s e chain reaction (PCR), Southern, a n d sequencing analyses revealed aspects of their structural a n d genetic organization a n d suggest a m e c h a n i s m based u p o n A l u loss for the origin of this dimorphic A l u insertion. MATERIALS AND METHODS
Materials. A Xclone (Xhgl) containing the 5' portion of the human CD4 gene was kindly provided by Dr. Dan Littman. Anonymous YAC clones were provided by Dr. Craig Chinault and the Baylor College of Medicine Human Genome Center Cloning Core. Papio sp. baboon DNA and the "zoo blot" were provided by Dr. Paula Clemens. Human genomic DNA samples differentiated by race were provided by Dr. Ray Fenwick and Holly Hammond. Oligonucleotide primers and probes (Table 1) were synthesized on an Applied Biosystems 380B DNA synthesizer. Automated sequencing of X clone, khgl DNA was sequenced using a random "shotgun" approach to accumulate 90% of the sequence, followed by a directed strategy to close gaps and provide at least twofold coverage of all bases (Edwards et al., 1990). Individual sequences 590
591
Alu LOSS P O L Y M O R P H I S M CD4
23
~iiii!ilili~.~iiiiiiiiiiiiiiii~
$71
I
I 6
CCTG
......
CCCCTCCACACCTG
TGGGTATTTCTCGCAAGGTGGAGACAAGAGACTGAGAAAAGAAAT
. - -A ...................
AAGACACAGAGAAAGT -CAG-
-G-
-GC
G ......
ATC
......
. -T-
.ATAGAGGAATAAAAGTGGGCCCAGGGG .....
T ......
A- -G-
-CT
....
................
C- -.. A ......
- -G ..........
A .....
.....
CA--A
AGGAGAGGG
.........
A-T
....
CATAAATAAGTTTAAGGAAAGG .............
T ....
G ..................
..........
......
G- - -C-T
GCAGTTI'~CTCCTCTCTCA T ....
. .......
G--C-
GT ........
CCGC
TTT
CTGTCTCAGTC-C,
...........
AT-G...
GGGGAAAC
-A- -C ........
..........
G - -C-C
• *********** -AIu-> T G C A A G A A C T T T T C T ~ -T-
- -AC--A-
GCGCG
- -'I'CAAC
....
ACTACAGG
AGG
-A--C--G-CTT
GCAG ......
C-T-
A-.
.......
T- -A .......
AAG
C ......
T-A-A
................
C. CTTCCTCCq~PC
ACTAATCCTC
T .............
CGGCCT
CT ......
A- - -C ....
CA .......
T .....
CACACTGCC , . - .......
T ......
T AGTCTTGCTCTGTCGCCCAGGCq~GGAGTG
TTCACG
CAGTG
CCATTCTCCTGCCTCAGCCTCCCGAGT
CCACCACGCCCGGCTAATTTTTTTGTA~AGTAGAG
ATGGGGTT
CCCGCCTTGG
A C A T G ~ T G C-C-
AGCACAGGG -CA
..............
C ............
C---A
CCTCCC
AAAATGC
A *~CCATTAA ACCTT A ..............
........
TTGC-GACAAAAGTTACAGATTAACAGCATCTC G-T-GG
AACAATTTTTCTTAGTACAGATCAAAATGGAGTTTCTTATG G .....
G .......
.....................................................
CGCCCG
-C ......
T ........
CC TTCCCATGAGGcCATAT ................. C ..........
0.99). These correspond to the (CTTTT)7/Alu+, (CTTTT)12/Alu+ , and (CTTTT)s/Alu- haplotypes. e x p e c t e d size w e r e P C R a m p l i f i e d f r o m 2 o f 25 r a n d o m l y chosen clones (data not shown). As these YACs each r e p r e s e n t e d a p p r o x i m a t e l y 200 k b o f h u m a n D N A , t h e S71-mer element was estimated to be present at approxim a t e l y 1000 c o p i e s in t h e h u m a n g e n o m e . Human sequence S71-mer primers were used to PCR amplify a fragment of the equivalent length in humans f r o m b a b o o n D N A (Fig. 4b). A n a l y s i s o f t h e f r a g m e n t with an Alu+ probe at high stringency revealed a different pattern of hybridization between the two species (Fig. 4c). T h e h u m a n s e q u e n c e - s p e c i f i c p r i m e r s in t h e CD4 intron outside the S71-mer repeat also PCR amp l i f y b a b o o n D N A , p r o d u c i n g a f r a g m e n t t h a t is a p p r o x i m a t e l y 200 b p l a r g e r t h a n t h e h u m a n C D 4 A l u + allele. Hybridization of the Alu+ probe indicated the presence o f a n A l u i n s e r t i o n i n t h i s b a b o o n D N A (Fig. 4c). P C R o f both human and baboon DNA, with combinations of p r i m e r s w i t h i n a n d f l a n k i n g t h e S71-mer, d e m o n s t r a t e d t h a t t h e a d d i t i o n a l ~ 2 0 0 b p in t h e b a b o o n C D 4 - S 7 1 - m e r f r a g m e n t is i n t h e 3' s e c t i o n f o l l o w i n g t h e A l u i n s e r t i o n (data not shown).
594
EDWARDS AND GIBBS 5892
5890
RO 146
a MW
k l AlU-/-
I I:-~
FI~I:-I
?~
b A I Alu-/-
RO 124
I FZ-Z'm-I V-Z'2--I A
c A I AIU-/-
i I -+/--If
+/+ i
I A
kb
13l ~ 09"" 06""
F I G . 3. Southern blot hybridization of PCR-amplified S71-mer sequences. The schematic shows placement of the PCR primers 5890 and 5892 within the mer repeat to amplify other loci as well as the CD4 locus, and placement of probes specific for the Alu+ allele (R0124) and common to both the Alu+ and A l u - alleles (RO146). (a) Agarose gel showing (left to right) PCR product of four h u m a n genomic DNAs previously characterized as A l u - / - at the CD4-S71-mer site, two A l u + / - heterozygotes, and two A l u + / + homozygotes. A fragment of 930-bp predominates, corresponding to the expected size of multiple S71-mer family members without Alu insertions. As a size marker and control the P C R product of the },hgl clone containing CD4-S71-mer Alu+ allele is included (1227 bp). (b) Southern analysis of PCR products with the Alu+-specific probe shows multiple hybridization sites. (c) Southern analysis with the probe for the shared sequence between Alu+ and A l u alleles revealed hybridization only in the bands containing the CD4-S71-mer locus alleles.
Comparison of S71-mer Forms The sequences for the S71-mer reported by Werner et al. (1990) and the CD4 S71-mer differ at 16% of the nucleotide positions, including small gaps and single DNA base substitutions. PCR using primers specific to the S71-mer sequence produced an approximately 600bp band in human and baboon genomic DNA, while no amplification was observed in control reactions that contained CD4-S71-mer A l u + / + PCR product template. Southern blot analysis of these reactions with the A l u - probe revealed no A l u insertions into the S71-type S71-mer's (data not shown). DISCUSSION The first intron of the human CD4 locus contains a member of a novel mer-repeat family designated the S71-mer's. S71-mer's appear typical of other mer repeats that also have an abundance of 200-10,000 copies in the human genome and occasionally contain dimorphic A l u insertions (Batzer et al., 1990; Kaplan et al., 1991). One allelic form of the CD4-S71-mer contains a full-length A l u that has been inserted at some time in primate evolution and a second allelic form lacks the full-length Alu. The molecular analysis of the dimorphic A l u insertion within the CD4-S71-mer suggests a different sequence of events leading to this A l u polymorphism, in comparison to previous models. Others have interpreted dimorphic human A l u insertions as resulting from gain of an A l u in one allele and therefore representing relatively recent evolution. This " A l u gain" mechanism is likely at many sites, considering models for the mechanism of retrotransposition events and that de novo A l u insertions
that mutate human genes have now been identified (Vidaud et al., 1989; Wallace et al., 1991). The model fails to consider the stability of monomorphic A l u insertion sites, however, where an alternate mechanism of " A l u loss" could give rise to polymorphism. The primary evidence that supports a model of " A l u loss" at the human CD4-S71-mer locus is the identification of a " r e m n a n t " of an A l u sequence within the A l u allele. The remnant is identical to the A l u + allele over 30 nucleotides and a poly(A) sequence. One base position appears to be heterozygous for a C to T transition, but is within a CpG site, which is known to frequently mutate (Labuda and Striker, 1989). The m e t sequences flanking the A l u bases in each allele were also identical. Therefore the present structure of the locus is consistent with a model that includes a full-length A l u in the A l u - allele at some time in human evolution. In this case the key event in generating the A l u dimorphism would be the molecular rearrangemen t that led to the loss of the majority of the inserted A l u bases in a single individual, followed by an increase of the A l u - allele to the current gene frequency. The alternate possibility that the remnant shared by the Alu+ and A l u - alleles in CD4-S71-mer have an independent origin was addressed. Other S71-mer family members may also contain the truncated A l u and could be the precursors of a "parental" CD4-S71-mer that later had a full-length A l u insertion give rise to the polymorphism. In this case it should be possible to find members of the S71-mer family that also contained the remnant bases. Hybridization of A l u probes to amplified fragments revealed that other CD4-S71-mer like sequences in the human genome have A l u insertions. However, oligonucleotide probes that were specific for the
Alu LOSS POLYMORPHISM
595
Haplotyping studies using a second highly polymorphic marker ( C T T T T ) n that is within 10 kb of the CD4RO104 ~K- R O 1 2 4 Ro105 S71-mer A l u insertion site also suggest that the A l u "-'" ~ ~ AIu ~ - allele arose subsequent to the A l u + form. Both the A l u + 5892 5891 5890 and A l u - alleles exhibit striking association with a subset of the alleles at the linked locus. However, the A l u + form is often associated with two of the linked alleles b c Baboon Human Baboon Human ( ( C T T T T ) 7 and (CTTTT)12), while the A l u - form is I I I I t I [ I I II I II MW I II I II strongly associated with only the ( C T T T T ) 8 allele. kb These data are compelling, as the sites of DNA polymorphisms containing short (2-5 bases) repeated sequences are frequently highly polymorphic and are therefore be1.3 lieved to undergo rapid molecular evolution (Edwards et 1.1 al., 1991b). The identification of a single ( C T T T T ) n al0 . 9 ~lele associated with the A l u - form therefore most likely 0.6,reflects the recent loss of the A l u in this background and insufficient time for new haplotypes to emerge. F I G . 4. S71-mer and associated Alu repeat complex is found in The amplification and hybridization of related seOld World monkey DNA. (a) A zooblot containing DNA of various quences from baboon DNA also support the model of an species reveals multiplicity of S71-mer in primates. Southern analysis early A l u insertion into the S71-mer-related sequences was performed on EcoRI-digested hamster, mouse, dog, baboon, and at the CD4 locus. Oligonucleotide primers complemenh u m a n DNA, as well as several invertebrate species DNAs (mammals shown only), using a PCR-amplified S71-mer probe (primers 5891 and tary to the human CD4 intron were used to amplify a 5892). At high-stringency conditions (65°C), hybridization is distinct discrete fragment from the baboon sample that cona n d exclusive to baboon and h u m a n DNA. (b) Alu-inclusive S71tained S71-mer sequences and included an A l u insertion. mer's are also present in baboon DNA. PCR using baboon DNA as Additional bases were also present in the fragment amtemplate and primers complementary to the S71-mer repeat (primers 5890 and 5892, reactions II) reveal a primary band the same length in plified from the baboon, however, and further studies are the baboon as in humans. The p a t t e r n of faint secondary bands is not required to reveal more details of the similarity between identical between the species. The h u m a n CD4 intron 1 primers the primate species. (RO104 and RO105, reactions I) amplify a fragment of approximately The molecular events that led to excision of the A l u 1.7 kb in the baboon. (c) Southern blot analysis of these reactions with the Alu+ probe (RO124) shows t h a t Alu elements are represented bases at the CD4-S71-mer site could involve cellular within S71-mers in baboons, and in the CD4 S71-mer locus specifimutational machinery or may specifically be related to cally. Reactions using an A l u + / - h u m a n DNA control template are the role of A l u as a transposable element. The data preincluded for comparison and demonstrate t h a t the Alu+ probe will not sented here do not distinguish between these possibilihybridize to an A l u - fragment. ties; however, it is noteworthy that the A l u deletion reA l u bases common to the A l u + and A l u - alleles showed stores the S71-mer flanking sequence and yields a struct h a t none of the amplified fragments apart from the ture that is similar to the 5'-truncated A l u fragments CD4-S71-mer site contained the remnant. Therefore an identified elsewhere in human DNA. These truncated A l u gain model that includes the presence of the A l u Alu's are usually attributed to aborted retrotransposir e m n a n t at this locus before the insertion of the full- tional events, but the identification of the CD4-S71-mer A l u remnant suggests that other truncated A l u fraglength A l u in the A l u + allele appears unlikely. T h e model of A l u loss at the CD4-S71-mer site is indi- ments in the human genome may have arisen from an rectly supported by studies of human allelic frequencies, A l u loss mechanism. The phylogenetic position of the CD4-S71-mer A l u linked markers, and other taxa. In European-origin and among other Alu's may influence the mechanism of genAfrican-origin Americans, the A l u - is present as approxeration of dimorphism at this site. A l u dimorphism in imately 20% of alleles, but was absent in DNA samples human populations has primarily been associated with from East Asians. While these data are not immediately the HS-2 A l u subfamily. One dimorphic non-HS Alu, consistent with current models of early divergence of the dissimilar to the A l u described here, has been noted preAsian and European lineages from the African lineage (Cavalli-Sforza et al., 1988; Nei and Livshits, 1989), they viously (Stoppa-Lyonet et al., 1990). A l u insertions may be influenced by the presumed admixture of ances- causing mutations at the cholinesterase gene locus and tral Asian and African populations to form the Euro- giving rise to neurofibromatosis type 1 have involved HS pean lineage (Bowcock et al., 1991) or the recent genetic and class IV Alu's (Muratani et al., 1991; Wallace et al., contribution of European descendants to African descen- 1991). The CD4-S71-mer A l u lacks bases that are diagdants in American populations (Reed, 1969). T h e pres- nostic for the HS family and is likely to be a member of ence of the A l u + allele at high frequency, and at homozy- an older subgroup. If the CD4-S71-mer A l u lacks the gosity in one of the racial groups, is consistent, however, structure and activities that allow the HS A l u family with the insertion as an earlier event in human evolution members to undergo frequent retrotransposition, then this site may be more likely to alter via alternative paththan the loss of A l u sequences in one allele. ~
a
596
EDWARDS AND GIBBS 8
b|i!ii~ii!!i!iiiiiiiiiiii!i!i!~iiiil ~iiiiiiiiiiiiiiiii!i!i!i!iiiiiiii!i!Nii!iiil |iiiiiiiiiiiiiiiiiiiiiiiiiii!iiiiiiiiiiii!i!iiiN
0). iiiiiiiii!iiiii!i!ii::!iii!iiiiiiii~
FIG. 5. Radiation of S71-mer forms in primates suggest an evolutionary sequence. (a) An Alu insertionless form of the repeat, includingthe $71 retrovirus-type and progenitor CD4-type, underwent radiation in primates. (b) The CD4-type radiated to multiple loci in primates. (e) A representative of the CD4-type acquired an Alu insertion and subsequently radiated to multiple sites, including the CD4 intron 1 locus, in primates. (d) Loss of the Alu at the CD4 locus creates alleles that are dimorphic in human populations. ways. A s e a r c h for a d d i t i o n a l p o l y m o r p h i s m s a m o n g non-HS Alu's may address this possibility. T h e s e q u e n c e of e v o l u t i o n a r y e v e n t s t h a t is m o s t l i k e l y to h a v e g i v e n rise to t h e c u r r e n t s t r u c t u r e of t h e C D 4 - S 7 1 - m e r locus is s u m m a r i z e d i n Fig. 5. A m o n g t h e m a n y e a r l y f o r m s of S 7 1 - m e r , o n e w a s i n s e r t e d i n t o t h e p r i m a t e g e n o m e a t t h e site of t h e $71 r e t r o v i r a l r e m n a n t a n d a n o t h e r a t t h e C D 4 locus. T h e p r e c i s e r e l a t i o n s h i p b e t w e e n these m e m b e r s c a n n o t be inferred, b u t the multiple forms suggest t h a t m e m b e r s w i t h o u t Alu insertions u n d e r w e n t r a d i a t i o n i n p r i m a t e s . T h e p h a s e of e v o l u t i o n a t w h i c h a n A l u i n s e r t i o n e v e n t o c c u r r e d m a y or m a y n o t p r e d a t e t h e i n s e r t i o n of t h e S 7 1 - m e r f a m i l y m e m b e r i n t o t h e C D 4 locus. S u b s e q u e n t l y t h e A l u s e q u e n c e was lost f r o m o n e of t h e C D 4 alleles to e v e n t u a l l y give rise to t h e d i m o r p h i s m d e s c r i b e d here. T h e e x a c t d a t e of t h e A l u loss is i n d e t e r m i n a t e ; h o w e v e r , t h e e v e n t w a s r e c e n t e n o u g h for t h e d i m o r p h i s m to b e e x p r e s s e d a t d i f f e r e n t f r e q u e n c i e s i n s e p a r a t e h u m a n p o p u l a t i o n s . T h i s suggests t h a t t h e A l u loss m a y h a v e o c c u r r e d a f t e r t h e earliest d i v e r g e n c e of t h e p o p u l a t i o n g r o u p s i n t h i s s t u d y , w h i c h is e s t i m a t e d to b e a p p r o x i m a t e l y 100,000 y e a r s ago ( K l e i n , 1989).
ACKNOWLEDGMENTS We thank Chris Povinelli, Bob Cottingham, Paula Clemens, Winston Hide, Bjorn Anderrson, Randy Smith, and Grant MacGregor for valuable discussions and reading the manuscript; Ray Fenwick, Holly Hammond, Dan Littman, and Paula Clemens for DNA samples; and Donna Muzny and Mike Metzker for technical help. This work was supported in part by Grants USPH U01 A130243 and RR06404 and from funds provided by the W. M. Keck Foundation.
REFERENCES Batzer, M. A., and Deininger, P. L. (1991). A human-specific subfamily of Alu sequences. Genomics 9: 481-487.
Batzer, M. A., Kilroy, G. E., Richard, P. E., Shaikh, T. H., Desselle, T. D., Hoppens, C. L., and Deininger, P. L. (1990). Structure and variability of recently inserted Alu family members. Nucleic Acids Res. 19: 698-699. Bowcock, A. M., Kidd, J. R., Mountain, J. L., Hebert, J. M., Carotenuto, L., Kidd, K. K., and Cavalli-Sforza, L. L. (1991). Drift, admixture and selection in human evolution: A study with DNA polymorphisms. Proc. Natl. Acad. Sci. USA 88: 839-843. Britten, R. J., Stout, D. B., and Davidson, E. H. (1988). Sources and evolution of human Alu repeated sequences. Proc. Natl. Acad. Sci. USA 85: 4770-4774. Britten, R. J., Stout, D. B., and Davidson, E. H. (1989). The current source of human Alu retroposons is a conserved gene shared with Old World monkey. Proc. Natl. Acad. Sci. USA 86: 3718-3722. Cavalli-Sforza, L. L., Piazza, A., Menozzi, P., and Mountain, J. (1988), Reconstruction of human evolution: Bringing together genetic, archaelogical, and linguistic data. Proc. Natl. Acad. Sci. USA 85: 6002-6006. Daniels, G. R., and Deininger, P. L. (1985). Integration site preferences of the Alu family and similar repetitive DNA sequences. Nucleic Acids Res. 13: 8939-8954. Deininger, P. L., and Slagel, V. K. (1988). Recently amplified Alu family members share a common parental Alu sequence. Mol. Cell Biol. 8: 4566-4569. Edwards, A., Voss, H., Rice, P., Civitello, A., Stegemann, J., Schwager, C., Zimmerman, J., Erfle, H., Caskey, C. T., and Ansorge, W. (1990). Automated DNA sequencing of the human HPRT locus. Genomics 6: 593-608. Edwards, A., Civitello, A., Hammond, H. A., and Caskey, C. T. (1991a). DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am. J. Hum. Genet. 49: 746-756. Edwards, M. C., Clemens, P. R., Tristan, M., Pizzuti, A., and Gibbs, R. A. (1991b). Pentanucleotide repeat length polymorphism at the human CD4 locus. Nucleic Acids Res. 19: 4791. Gibbs, R. A., Nguyen, P. N., and Caskey, C. T. (1991). Direct DNA sequencing of complementary DNA amplified by the polymerase chain reaction. In "Methods in Molecular Biology" (C. Matthew, Ed.), Humana, Clifton, NJ. Haft, L., Atwood, J. G., Dicesare, J., Katz, E., Picozza, E., Williams, J. F., and Woudenberg, T. (1991). A high-performance system for automation of the polymerase chain reaction. Biotechniques 10: 102-112. Jurka, J., and Smith, T. (1988). A fundamental division in the Alu
Alu LOSS POLYMORPHISM
family of repeated sequences. Proc. Natl. Acad. Sci. USA 85: 44754778. Kaplan, D. J., Jurka, J., Solus, J. F., and Duncan, C. H. (1991). Medium reiteration frequency repetitive sequences in the human genome. Nucleic Acids Res. 19: 4731-4738. Klein, R. G. (1989). In "The Human Revolution: Behavioral and Biological Perspectives on the Origins of Modern Humans" (P. Mellars and C. Stringer, Eds.), pp. 529-546. Edinburgh Univ. Press, Edinburgh. Labuda, D., and Striker, G. (1989). Sequence conservation in Alu evolution. Nucleic Acids Res. 17: 2477-2491. Matera, A. G., Helmann, U., and Schmid, C. W. (1990). A transpositionally and transcriptionally competent Alu subfamily. Mol. Cell Biol. 10: 5424-5432. Muratani, K., Hada, T., Yamamoto, Y., Kaneko, T., Shigeto, Y., Ohue, T., Furuyama, J., and Higashino, K. (1991). Inactivation of the cholinesterase gene by Alu insertion: Possible mechanism for human gene transposition. Proc. Natl. Acad. Sci. USA 88: 1131511319. Nei, M., and Livshits, G. (1989). Genetic relationships of Europeans, Asians and Africans and the origin of modern Homo sapiens. Hum. Hered. 39: 276-281.
597
Reed, T. E. (1969). Caucasian genes in American Negroes. Science 165: 762-768. Shen, M. R., Batzer, M. A., and Deininger, P. L. (1991). Evolution of the master Alu gene(s). J. Mol. Evol. 33: 311-320. Stoppa-Lyonet, D., Carter, P. E., Meo, T., and Tosi, M. (1990). Clusters of intragenic Alu repeats predispose the human C1 inhibitor locus to deleterious rearrangements. Proc. Natl. Acad. Sc£ USA 67: 1551-1555. Vidaud, M., Vidaud, D., Siguret, V., Lavergne, J. M., and Goossens, M. (1989). Mutational insertion of an Alu sequence causes hemophilia B. Am. J. Hum. Genet. 45: A226. Wallace, M. R., Andersen, L. B., Saulino, A. M., Gregory, P. E., Glover, T. W., and Collins, F. S. (1991). A de novo Alu insertion results in neurofibromatosis type 1. Nature 3 5 3 : 864-866. Weiner, A. M., Deininger, P. L., and Efstratiadis, A. (1986). Nonviral retroposons: Genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55: 631-661. Werner, T., Brack-Werner, R., Leib-Mosch, C., Backhaus, H., Erfle, V., and Hehlmann, R. (1990). $71 is a phylogenetically distinct human endogenous retroviral element with structural and sequence homology to Simian Sarcoma Virus (SSV). Virology 174: 225-238.
