HUMAN VACCINES & IMMUNOTHERAPEUTICS 2016, VOL. 12, NO. 7, 1670–1677 http://dx.doi.org/10.1080/21645515.2016.1141159
RESEARCH PAPER
A multistage mycobacterium tuberculosis subunit vaccine LT70 including latency antigen Rv2626c induces long-term protection against tuberculosis Xun Liua,b, Jinxiu Penga,b, Lina Huc, Yanping Luoa, Hongxia Niua,b, Chunxiang Baia,b, Qian Wanga, Fei Lia,b, Hongjuan Yua, Bingxiang Wangc, Huiyu Chena, Ming Guod, and Bingdong Zhua,b a
Gansu Provincial Key Laboratory of Evidence Based Medicine and Clinical Translation & Lanzhou Center for Tuberculosis Research, School of Basic Medical Sciences, Lanzhou University, Lanzhou, China; bInstitute of Pathogen Biology, School of Basic Medical Sciences, Lanzhou University, Lanzhou, China; cLanzhou Institute of Biological Products, Lanzhou, China; dABSL-3 Lab, Wuhan University, Wuhan, China
ABSTRACT
ARTICLE HISTORY
To develop an effective subunit vaccine which could target tubercle bacilli with different metabolic states and provide effective protective immunity, we fused antigens ESAT6, Ag85B, peptide 190–198 of MPT64, and Mtb8.4 mainly expressed by proliferating bacteria and latency-associated antigen Rv2626c together to construct a multistage protein ESAT6-Ag85B-MPT64(190–198)-Mtb8.4-Rv2626c (LT70 for short) with the molecular weight of 70 kDa. The human T-cell responses to LT70 and other antigens were analyzed. The immune responses of LT70 in the adjuvant of DDA and Poly I:C and its protective efficacy against Mycobacterium tuberculosis (M. tuberculosis) infection in C57BL/6 mice were evaluated. The results showed that LT70 was stably produced in Escherichia coli and could be purified by successive salting-out and chromatography. LT70 could be strongly recognized by human T cells from TB patients and persons who are supposed latently infected with M. tuberculosis. The subunit vaccine LT70 generated strong antigenspecific humoral and cell-mediated immunity, and induced higher protective efficacy (5.41§0.37 Log10 CFU in lung) than traditional vaccine Bacillus Calmette-Guerin (6.01§0.33 Log10 CFU) and PBS control (6.53§0.26 Log10 CFU) at 30 weeks post vaccination (10 weeks post-challenge) against M. tuberculosis infection (p < 0.05). These findings suggested that LT70 would be a promising subunit vaccine candidate against M. tuberculosis infection.
Received 28 October 2015 Revised 22 December 2015 Accepted 8 January 2016
Introduction Mycobacterium tuberculosis (M. tuberculosis) is the causative agent of human tuberculosis (TB), a disease that is estimated to cause nearly 9 million people felling ill and 1.5 million people death worldwide every year.1 Moreover, there are about 2 billion people around the world infected with M. tuberculosis, and more than 90% of them are in latent infection. Reactivation of latent infection is considered as a cause of tuberculosis.2 Bacille Calmette-Guerin (BCG), an attenuated vaccine derived from Mycobacterium bovis, is the only vaccine available against TB.3 However, despite its protection against TB in children, BCG failed to protect adults against M. tuberculosis infection and reactivation of latent infection. Thus, novel vaccines that could provide more robust and longer protection than BCG or have the capability to boost BCG-primed immunity are urgently needed. The protein subunit vaccine is generally well tolerated and relatively safe.4 Some protein subunit vaccines, such as M72 5 and H56,6 in suitable adjuvants have been reported to induce Th1-type cell-mediated immune responses and provide effective protection against TB.7 Some of them are in clinical trials.8,9 However, most of the current subunit vaccines in clinical trials are based on antigens produced by replicating bacilli.6,10
KEYWORDS
LT70; mycobacterium tuberculosis; protective efficacy; Rv2626c; subunit vaccine
Because the infected bacteria always consist of varying growing and non-growing subpopulations which can interconvert with each other,11 ideal vaccines should not only provide protection against replicating bacteria, but also target dormant bacteria.12 Therefore novel subunit vaccine should include antigens from different stages of bacteria.6,9,13,14 There are several antigens that have been proven to have high immunogenicity. The 6 kDa early secreted antigenic target (ESAT-6), a virulence factor of M. tuberculosis, acts alone or combines with CFP10 to modulate host immune responses.15,16 ESAT-6-containing vaccines could induce strong immune responses and provide protective efficacy against TB.6,17 The Ag85 complex is a 30–32 kDa family of 3 proteins (Ag85A, Ag85B, and Ag85C), possesses enzymatic mycolyl-transferase activity involved in biogenesis of cord factor and in the coupling of mycolic acids to cell wall.18 By virtue of their strong Th1-type cytokine inducing potential the Ag85 components are among the most promising vaccine antigens now. Many of the novel TB vaccines tested in preclinical and clinical trials, are composed of Ag85 components, encoded by recombinant viral vectors or expressed as recombinant fusion proteins.19,20 Mtb8.4 elicited Th1 responses in murine and human cells.21
CONTACT Bingdong Zhu [email protected] Institute of Pathogen Biology, School of Basic Medical Sciences, Lanzhou University, 199 West Donggang Road, Lanzhou 730000, China. Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/khvi. © 2016 Taylor & Francis
HUMAN VACCINES & IMMUNOTHERAPEUTICS
Immunization with Mtb8.4 recombinant protein also induced strong CD8C cytotoxic T lymphocyte (CTL) responses and provided effective protection against M. tuberculosis challenge.22 In our previous study, we constructed a fusion protein ESAT6-Ag85B-MPT64(190–198)Mtb8.4 (EAMM), which was proved to be the most effective protein among the 8 fusion proteins constructed in our lab.23 However, there is no latency antigen included in it. Further study showed that the combination of EAMM and another fusion protein Mtb10.4-HspX (MH) consisting of a dormancy-related antigen HspX provided higher protective efficacy than EAMM or MH alone.23 Besides that, a hypothetical protein Rv2626c has been shown to be up-regulated in hypoxic conditions of an in vitro M. tuberculosis latency model.24 Further studies in the lung of M. tuberculosis infected mice showed that the expression of Rv2626c increased at the terminal stages of infection.25 Moreover, high serum antibody against Rv2626c was detected in patients with active TB.26 Our study also showed that Rv2626c induced high level of IFN-g production in the peripheral blood mononuclear cells (PBMCs) from active TB patients and close contacts. All these studies suggest that Rv2626c is an important antigen with potential to be used in TB subunit vaccines. To develop subunit vaccines which could provide promising protection, our lab constructed a multistage subunit vaccine ESAT6-Ag85B-MPT64(190–198)-Mtb8.4-Hspx (EAMMH, LT69) previously.27 In this study, we constructed another novel multistage fusion protein, ESAT6-Ag85B-MPT64(190–198)-Mtb8.4-
1671
Rv2626c with molecular weight of 70 kDa (LT70 for short). The fusion protein LT70 was mixed with an adjuvant being composed of DDA and Poly I:C, and its immunogenicity and protective efficacy were evaluated in C57BL/6 mice. The protective efficacy of the protein vaccine to boost BCG-primed immunity was also evaluated. The results showed that LT70 induced obvious higher protective efficacy than BCG and EAMMCMH.
Results Expression, purification and analysis of mycobacterial fusion proteins The new TB fusion protein LT70 is composed of the TB antigens ESAT-6, Ag85B, Mtb8.4, peptide 190–198 of MPT64, and Rv2626c, with molecular weight of 70kD. There is no mutation in the nucleotide acid DNA sequences encoding the recombinant fusion protein LT70 comparing with the DNA sequences of M. tuberculosis H37Rv. The fusion protein LT70 could be expressed in E. coli BL21. The cells were broken and the supernatant (soluble fractions) was collected (Fig. 1A), which was further purified by salt fractionation and hydrophobic chromatography successively (Fig. 1B). The purified LT70 was confirmed by Western blot. As expected, the fusion protein LT70 was recognized by anti-Ag85B and anti-Rv2626c (Fig. 1C). At the concentration of 0.5 mg/mL LT70, the endotoxin level was less than 2.5 EU/ml, which was lower than the requirement for animals and in vitro experiment.
Figure 1. Expression, purification and analysis of fusion protein LT70. (a) Expression of LT70 in E. coli. Coomassie Blue-stained 12% SDS-PAGE: E. coli BL21 lysate (lane 1), total E. coli BL21 expressing LT70 lysate (lane 2), supernatant of E. coli BL21 expressing LT70 lysate (lane 3) and sediment of E. coli lysate (lane 4). M, molecular weight. (b) Purification of LT70. The BL21 lysate containing LT70 (lane 1) was purified by 2 steps. First purification of LT70 by salting (lane 2), and followed with hydrophobic chromatography (lane 3). M, molecular weight. (c) Purified LT70 was verified by immunoblot: Mouse monoclonal anti-Rv2626c (lane 1), Negative control (lane 2), Mouse monoclonal anti-Ag85B (lane 3), Negative control (lane 4). M, molecular weight.
1672
X. LIU ET AL.
Immune responses of human PBMCs to LT70 and other antigens The protein HspX, Rv2626c, EAMM, and LT70 were co-cultured with PBMCs isolated from TB patients, close contacts (supposed to be latently infected with M. tuberculosis), and the secreted IFN-g was detected. Fig. 2 showed that Rv2626c induced higher numbers of IFN-g producing T cells than HspX did in patients with active TB. LT70 induced significant higher numbers of IFN-g producing T cells than EAMM and Rv2626c did in TB patients. Rv2626c and LT70 also induced high immune responses in M. tuberculosis close contacts (latently infected). These results indicate that LT70 containing Rv2626c could be recognized well in TB patients and M. tuberculosis latently infected human beings. Immunogenicity induced by vaccination with LT70 C57BL/6 mice were immunized with LT70 formulated in DDA/ Poly (I:C) 3 times and the releases of antigen specific IFN-g and the levels of the antibodies were evaluated. With the stimulation of ESAT6, Ag85B, Mtb8.4, Rv2626c and PPD, the numbers of spleen lymph cells secreting IFN-g from mice immunized with LT70 were higher than that from PBS, BCG and EAMMCMH groups (p < 0.05) (Fig. 3). The titers of IgG1 and IgG2c antibodies against Ag85B and Rv2626c and the relative ratio of IgG2c to IgG1 in LT70 group were significantly higher than that of BCG group (p < 0.05) and almost same as EAMMCMH group, and the antibody titers in PBS control group were negative (Table 1). Protective efficacy induced by vaccination with LT70 At week 30 post the last vaccination, mice were infected with M. tuberculosis H37Rv 50–100 CFU by aerosol challenge. Ten weeks later, the bacteria load in lung and spleen tissues were measured. The subunit vaccine LT70 showed better effect to
Figure 3. The immunogenicity of LT70 vaccine. Mice were immunized with 13 mg of LT70 formulated in DDA/poly(I:C) 3 times at 2-week intervals subcutaneously (s. c.) in week 0, 2 and 4 of the experiments. For EAMMCMH group, the mice were received EAMM (10 mg ) and MH (10 mg ) in DDA/poly(I:C). Mice immunized with 5£105 BCG or PBS was used as controls. Six weeks after the final vaccination, spleen cells were stimulated with ESAT6 (10 mg /ml), Ag85B (5 mg /ml), Mtb8.4 (10 mg /ml), Rv2626c (10 mg /ml) and PPD (5 mg /ml) respectively in vitro. The IFN-g was detected by ELISPOT kit and was showed as number of cells secreting IFN-g/3£105. Data were shown as means§ SD. n D 4. p < 0.05, relative to PBS and BCG groups.
control bacterial growth in lungs than EAMMCMH and BCG vaccines (p < 0.05), reducing approximately 1.12 log10 bacterial counts compared with PBS control (p < 0.01) (Table 2), and 0.6 log10 CFU than BCG group.
Immune responses induced by BCG priming and LT70 boosting C57BL/6 mice were primed with BCG and boosted with LT70 vaccine twice. The releases of IFN-g in spleen lymphocytes and the titers of antibodies in serum were evaluated. The results showed that with the stimulation of ESAT6, Ag85B and Rv2626c, the numbers of IFN-g secreting lymphocytes from the mice primed by BCG and boosted by LT70 were higher than that immunized with BCG without boosting (p < 0.05) (Fig. 4). The antibody titers of IgG1 and IgG2c against Ag85B and Rv2626c in the prime-boost group were also higher than that of BCG group (p < 0.05) (Table 1).
Protective efficacy induced by BCG priming and LT70 boosting
Figure 2. IFN-g responses to protein EAMM, HspX, Rv2626c and LT70 in different groups of donors. In this study, active TB patients (TB, n D 20) and close contacts (n D 10) were recruited. Freshly isolated PBMCs from these subjects were plated in duplicate at 3£105 cell per well in 96 spot and incubated with EAMM (5 mg/ ml), HspX (5 mg/ml), Rv2626c (5 mg/ml) and LT70 (5 mg/ml) for 48 h at 37 C, 5% CO2. IFN-g was detected using Human IFN-g ELISPOT kits. Data were shown as means§ SD. p < 0.01.
Mice were primed with BCG and boosted with LT70. Sixteen weeks after the last immunization, mice were challenged with M. tuberculosis H37Rv by inhalation. BCG-prime and LT70boost induced a significant reduction in the number of bacteria in the lungs and spleen compared to PBS controls (p < 0.05) (Table 2). In the pathologic reaction induced by vaccine immunization and M. tuberculosis challenge, the mice injected with PBS presented extensive pulmonary lesion and granulomas,
HUMAN VACCINES & IMMUNOTHERAPEUTICS
1673
Table 1. Serum antibodies induced by LT70 vaccine and BCG-prime, LT70-boost regimen. Anti-Ag85B Groups PBS BCG EAMMCMH LT70 BCG prime, LT70 boost
IgG1 — 2.47 § 0.33 4.40 § 0.41 4.67 § 0.32 4.67 § 0.32
Anti-Rv2626c
IgG2c
IgG2c/ IgG1
IgG1
IgG2c
IgG2c/ IgG1
— 1.13 § 0.05 2.50 § 0.16 3.55 § 0.33 4.52 § 0.43
— 0.46 § 0.15 0.56 § 0.39 0.76 § 1.03 0.97 § 1.34
— 1.17 § 0.05 — 4.52 § 0.43 4.50 § 0.36
— — — 2.90 § 0.27 4.45 § 0.36
— — — 0.64 § 0.62 0.98 § 1.00
Notes. Serum samples were collected 6 weeks after the last injection and the reciprocal end point titers of antigen specific IgG1 and IgG2c were analyzed by ELISA. Data were shown as means § SD. p < 0.05, relative to PBS and BCG groups.
while the mice primed with BCG and boosted with LT70 presented smaller lesions than PBS control (p < 0.01) (Fig. 5).
Discussion d ais usually significant,ward constructed a novel fusion protein LT70 based on 5 mycobacterial antigens and peptide (ESAT6, Ag85B, Mtb8.4, 190–198 peptide of MPT64, and Rv2626c), which were expressed in various stages of bacteria respectively. The results showed that LT70 could be recognized well by human beings, and induce high immune responses in mice, and its protective efficacy against M. tuberculosis infection in mice was significantly higher than PBS control and BCG at 30 weeks after last immunization. The bacteria infected our body are heterogeneous.11 Both rapid growing and nonreplicating dormant M. tuberculosis bacteria coexist. The bacterial populations are in continuum with different metabolic status and these populations can interconvert.11 During primary phase, there is a rapid growing bacterial population and a relatively small population of non-growing bacteria. Along with the infection process, the number of growing bacteria decresed and the latent population incresed. This suggested that antigens in various growth stages should be included to construct novel multi-stage TB subunit vaccines so as to provide complete immune protection against bacteria in different metabolic states.6,10,14,28 In our previous study, subunit vaccine MH which contains a well-known latency-related antigen HspX could enhance the protective efficacy of EAMM vaccine consisting of 4 antigens mainly expressed by growing bacteria.23 The multistage TB subunit vaccine based on fusion protein LT69 containg HspX showed strong immunogenicity and high protective effect against M. tuberculosis H37Rv aerosol challenge, reducing approximately 0.72 log10 bacterial counts than PBS control.27 Other latent related antigens and multistage vaccines were also reported. One of latent-infection related antigens, Rv2660c, was linked together with Ag85BESAT6 to construct the subunit vaccines H56, which provided improved protective efficacy than Ag85B-ESAT6.30 Rv1733c is another latent related antigen. Using its synthetic peptides could led to a significant reduction in the bacterial load in the lungs of M. tuberculosis-challenged mice.29 Latency-associated Rv1813 was linked with other 3 M. tuberculosis antigens (Rv2608, Rv3619, Rv3620) to construct a multistage protein vaccine ID93, which induced high protective efficacy close to BCG.4
We compared the immune responses of Rv2626c (which was first screened by AERAS and donated to us), HspX, and Rv2007c in active TB patients and close contacts, and found that Rv2626c induced higher IFN-g production than others, which suggest that Rv2626c is an antigen candidate. Therefore, we fused antigen Rv2626c with EAMM to construct a novel multi-stage fusion protein LT70. LT70 showed promising protective efficacy in mice, reducing about 1.12 Log10 CFU in lung than PBS control, more than traditional vaccine Bacillus Calmette-Guerin (which reducing 0.52 Log10 CFU in lung tissue). It suggestes that LT70 would be a promising subunit vaccine candidate against M. tuberculosis infection. It is well known that protection against M. tuberculosis infection is highly dependent on Th1-type immune responses.31,32 People with gene-deficiencies impairing IFN-g showed increased susceptibility to M. tuberculosis infection.33 Recent studies showed that the ability of CD4C T cells to produce IFN-g, which activates phagocytes to engulf the intracellular pathogen, is central to the protection of M. tuberculosis infection.34 In our study, mice receiving LT70 subunit vaccine generated high antigen specific IFN-g as well as high IgG2c, and IgG1 antibodies. The BCG-prime and LT70 vaccineboosted mice presented higher ratio of antigen specific IgG2c/ IgG1 than BCG without boosting, which reflected that LT-70 induced a Th1-type immune response.35 Bacteria load (CFU data) is the most commonly used guide to determine whether a candidate vaccine had protective efficacy.34 A drop of about 0.7 log10 CFU in lung is usually regarded as statistically significant.36 We analyzed the bacterial load in lungs and spleens against M. tuberculosis infection at
Table 2. The protective efficacy of vaccines and BCG-prime, vaccine boost regimen against H37Rv infection in mice. Groups PBS BCG EAMMCMH LT69 LT70 BCG prime, LT70 boost
Mean Log10 CFU § SD(LUNG)
Mean Log10 CFU § SD(SPLEEN)
6.53 § 0.26 6.01 § 0.33(¡0.52) 5.78 § 0.32(¡0.75) 5.68 § 0.39(¡0.85) 5.41 § 0.37 (¡1.12) 5.62 § 0.64 (¡0.91)
5.98 § 0.27 5.10 § 0.45(¡0.88) 5.07 § 0.47 (¡0.91) 5.20 § 0.50 (¡0.78) 4.91 § 0.17 (¡1.07) 4.70 § 0.41 (¡1.28)
Notes. Ten weeks later, the protective efficacy was measured by detecting the bacteria load in lung tissuesand spleen tissues. Results are presented as means § SD from groups of 7 mice. p < 0.05, relative to PBS group. p < 0.01, relative to PBS and BCG groups.
1674
X. LIU ET AL.
Eight of 13 novel TB vaccine candidates that are currently entering the clinical trials belong to protein subunit category, demonstrating the important role of protein vaccines in the next generation of TB vaccines.10 We choosed the antigens of high immunogenicity like ESAT-6, Ag85B, Mtb8.4 and Rv2626c to construct LT70. These antigens are mainly selected on the basis of antigenicity, immunogenicity, and anti-infection protection in animal models. It may face inherent limitations to antigen screening due to the complex pathogenesis of M. tuberculosis and its interaction with the host.37 Furthermore, the subunit vaccine based on multi-stage fusion protein LT70 with adjuvant of DDA and Poly I:C induces high immune responses and protective efficacy in mice. We still need to evaluate its protective efficacy in other animal models such as non-human primates and guinea pigs in future.
Materials and methods Ethics statement Figure 4. The immune responses in the BCG-prime and LT70-boost regimen. C57BL/6 mice were primed with BCG at 0 week, and boosted with 10 mg of LT70 vaccine by s.c. at 15 and 18 week separately. Six weeks after the last boosting, spleen cells were stimulated with ESAT6, Ag85B and Rv2626c in vitro, and IFN-g production was assayed by ELISPOT. Results are presented as means § SD. nD4. p < 0.05, relative to PBS and BCG groups. p < 0.05, relative to PBS, BCG and LT70 groups.
30 weeks after vaccination. The results showed that LT70 alone reduced approximately 1.12 log10 bacterial counts comparing with PBS control (p < 0.001), higher than BCG induced protection. Therefore, LT70 vaccination induced long-term (at least 30 weeks after vaccination) protection against M. tuberculosis infection, higher than that conferred by BCG.
Animal experiments were performed in accordance with the guidelines of Council on Animal Care and Use. The protocols were approved by the Institutional Animal Care and Use Committee of Gansu College of Traditional Chinese Medicine (permit number: SYXK(Gan) 2013–001). Animals received free access to water and food throughout the study. During the experiments, the vaccinated and infected mice were monitored every day. Mice were euthanized by cervical dislocation. The research involved human participants have been approved by the Human Research Ethics Committee of Lanzhou University and Lanzhou Pulmonary Hospital. Each individual was introduced the nature of the research and given the study protocol, and they all signed the informed consents. Animals Studies were performed with C57BL/6 female mice (6–8 weeks old) from Slaccas Inc. (Beijing, China). Mice were housed in special pathogen-free conditions in Gansu University of Traditional Chinese Medicine. For M. tuberculosis H37Rv challenge experiments, animals were kept in ABSL-3 lab at Wuhan University. Mice received free access to food and provided with water ad libitum. Animal experiments were performed in compliance with the ethical and experiment regulations for animal care at Gansu University of Traditional Chinese Medicine and Wuhan University. pET30a(C)-LT70 plasmid construction
Figure 5. Pathologic reaction induced by vaccine immunization and M. tuberculosis challenge. Mice were immunized with BCG, EAMMCMH, LT69, LT70 and BCG prime, LT70 boost respectively. After the last vaccination, mice were aerosolinfected with M. tuberculosis H37Rv 50–100 CFU. The representative histological sections of the lungs from mice and the area ratio of granuloma in sections with HE of all groups were shown. nD5.
Recombinant pET30a(C)-Mtb8.4-HspX and pET30a (C)-ESAT6-Ag85B were produced as previously indicated.23,38 The plasmid encoding ESAT6-Ag85B-MPT64(190– 198)-Mtb8.4-Rv2626c was generated by inserting the genes Rv2626c into the multiple cloning sites of pET30a (C)-ESAT6-Ag85B-MPT64(190–198)-Mtb8.4 as follows. Initially, the DNA sequences coding fusion protein of MPT64(190–198)-Mtb8.4 was generated by PCR amplification from pET30a(C)-Mtb8.4-HspX plasmid. The fragment was
HUMAN VACCINES & IMMUNOTHERAPEUTICS
cloned into the Bgl II and Hind III site of pET30(C) to construct the plasmid pET30(C)-MPT64(190–198)-Mtb8.4. ESAT6-Ag85B sequence was generated by PCR amplification from pET30a(C)-ESAT6-Ag85B plasmid with the Primer F, CGGCATATGACAGAGCAGC AGTGGAA T (Nde I) and R, GAAGATCTGCCGGCGCCTAACGA ACTCTGGAG(Bgl II). Then this fragment was cloned into the unique sites Nde I and Bgl II of the previously constructed pET30(C)-MPT64(190–198)-Mtb8.4 plasmid. The DNA sequences coding Rv2626c was generated by PCR amplification from pET30a(C)-Rv2626c plasmid (provided by AERAS, USA) with the primer F, 50 –30 AC GAGCTC ATGACCACGG(Sac I) and the primer R, 50 –30 CCC AAGCTT CTATGCATTTAG(Hind III). The fragment was cloned into the Sac I and Hind III site of pET30a (C)-ESAT6-Ag85B-MPT64(190–198)-Mtb8.4 to construct the plasmid pET30a(C)-ESAT6-Ag85B-MPT64(190–198)-Mtb8.4Rv2626c (LT-70). The final plasmid constructed was transformed into the E. coli strain BL21 for production of the fusion protein LT70.
Expression, purification and analysis of mycobacterial fusion proteins E. coli BL21 expressing LT70 was grown in culture flask to an OD of 0.5 at 600 nm before incubation with 0.5 mM isopropyl b-D-thiogalactopyranoside (IPTG). After incubation for 4 h at 29 C, cells were harvested and suspended in phosphate buffer (20 mM; pH7.4). Samples were centrifuged and the supernatant containing the target protein LT70 was then submitted for purification. The method for purification of LT70 included 2 steps. First, saturated ammonium sulfate was added to the protein sample to 15% of saturation, and the precipitate from the salting-out was collected and resuspended in buffer A (phosphate buffer, 20 mM; sodium chloride, 0.25 M; pH7.4). Then the LT70 was further purified by a hydrophobic chromatography (HIC) on butyl-sepharose high performance column with AKTA Purifier 100 (GE Healthcare, Piscataway, NJ) and protein LT70 was eluted from the resin with buffer B (phosphate buffer, 20mM; pH7.4). The molecular weight and purity of the purified protein were assessed by SDS-PAGE, which was performed using 12% gradient Tris–glycine polyacrylamide gel using Bio-Rad MiniPROTEAN Tetra Electrophoresis System (Bio-Rad, CA, USA). The concentrations of the proteins were determined by the Lowry protein assay. Western blot was used to confirm the LT70 protein, in which protein LT70 was electrophoretically transferred onto nitrocellulose membrane, and the membrane was blocked with 5% bovine serum albumin (BSA)–Phosphate Buffered Saline (PBS) and was incubated with mouse monoclonal antiRv2626c (1:2000) and anti-Ag85B (1:2000) respectively, and followed by rabbit anti-mouse antibody (1:5000). Finally, we used ECL to chemiluminescence. Endotoxin levels of the fusion proteins EAMM, MH and LT70 were quantified by Gel Clot Tachypleus Amebocyte lysate (TAL) assay (Zhanjiang A&C Biological Ltd., Guangdong, China).
1675
Human subjects Twenty TB patients and 10 close contacts (latently infected with M. tuberculosis) were recruited to analyze their T-cell response to protein EAMM, HspX, Rv2626c and L70. The 20 TB patients were recruited from Lanzhou Pulmonary Hospital, Lanzhou, China. All patients were active TB with sputum smear positive. The close contacts were healthy individuals who were close contacted with TB patient in Lanzhou Pulmonary Hospital. ELISPOT for IFN-g production in human PBMCs Peripheral blood mononuclear cells (PBMCs) from human donors were freshly isolated by gradient centrifugation of heparinized blood. Human IFN-g pre-coated ELISPOT kits (Dakewe Biotech Company Ltd., Shenzhen, China) were performed according to the instruction of the manual. The 96-well plates pre-coated with anti-human IFN-g antibody were activated with RPMI-1640 for 15 min at room temperature. Freshly isolated PBMCs were plated in duplicate at 3£105 cells per well in RPMI 1640 supplemented with penicillin, streptomycin, and 10% newborn calf serum and stimulated with EAMM (5 mg/ ml), HspX (5 mg/ml), Rv2626c (5 mg/ml) and LT70 (5 mg/ml) respectively for 20 h at 37 C, 5% CO2. The cells were then removed and the Biotinylated antibody, Streptavidin–HRP, and AEC substrate was added subsequently, spots were counted on an automated ELISPOT reader. Vaccine preparation and adjuvants Vaccine was prepared as previously described.23,38 In short, for one dose of 0.2 ml, 10 mg of EAMM plus 10 mg of MH, 10 mg of LT69 or 13 mg of LT70 were mixed with the adjuvant consisting of 250 mg of N, N’-dimethyl-N, N’-dioctadecylammonium bromide (DDA) (Sigma-Aldrich, Poole, UK) and 50 mg of polyinosinic-polycytidylic acid (PolyI;C) (Sigma-Aldrich, Poole, UK) respectively to construct the subunit vaccine. Vaccine immunization Mice were immunized with LT69 (10 mg/dose), EAMM(10 mg/ dose) CMH (10 mg/dose) and LT70 (13 mg/dose) 3 times at 2week intervals subcutaneously (s.c.) at week 0, 2 and 4 separately. Mice immunized with BCG received a single dose of 5£105 CFU of BCG Danish s.c. in a volume of 0.2 ml at the week 0. In the BCG prime-boost regimen, mice were primed with BCG at week 0, and boosted with LT70 by s.c. at 15th and 18th week. The detection of cytokine IFN-g and antibodies The levels of antigen-specific IFN-g were tested using an enzyme-linked immunospot (ELISPOT) assay (Dakewe Biotech company limited, Shenzhen, China) following 40 h - incubation of splenocytes with special antigens, such as ESAT-6 (10 mg/ ml), Ag85B (5 mg/ml), Mtb8.4 (10 mg/ml), Rv2626c (10 mg/ ml), and PPD (5 mg/ml). Rv2626c and PPD were provided by AERAS, and the others were prepared in our lab. The ELISPOT
1676
X. LIU ET AL.
was developed according to manufacturer’s protocol. The spots were counted using an ELISPOT reader (Bio-sys, GmbH, Karben, Germany) and the results were showed as the mean spotforming cells per 5£105 cells § SD. The levels of the antibodies IgG1 and IgG2c against antigens Ag85B and Rv2626c in mouse sera were determined using enzyme-linked immunosorbent assay (ELISA). The ELISA was performed as follows: Microtitre plates were coated with 100 ul/well of antigens at 10 ug/ml in PBS overnight at 4 C; The plates were then washed with PBS containing 0.05% Tween 20 (PBST); Horse radish peroxidase-conjugated rabbit anti-mouse IgG1 or IgG2c (ROCKLAND, ROCKLAND immunochemicals Inc.) at a 1:25,000 dilution was added with 100 ul/well. The plates were incubated for 1 h at 37 C and washed with PBST. After washing, plates were added with TMB substrate 200 ul/ well and were incubated at room temperature for about 20 min. The reaction was stopped by the addition of a solution of sulphuric acid (1 mol/L). The optical density (OD) was measured at 450 nm.
M. tuberculosis challenge and bacteria-load detection Mice were challenged with 50–100 CFU of M. tuberculosis H37Rv per mouse by aerosol at 30 weeks after the last LT70 immunization (34 weeks after BCG immunization). In the BCG-prime and LT70-boost regimen, mice were challenged by H37Rv at 16 weeks after the last immunization. Enumerations of bacterial colony forming units (CFU) in the lungs and spleens were determined by serial 10-fold dilutions of wholeorgan homogenates on 7H11 medium (BD, NJ, USA) at 10 weeks after infection. Bacteria - load were presented as log10 CFU§SD.
Histopathological analysis The upper left lobes of the lungs of mice were harvested after M. tuberculosis H37Rv infection, fixed in 10% formalin, and embedded in paraffin blocks, then they were sectioned for light microscopy. To analyze the pathological changes, the sections were stained with haematoxylin and eosin. Granulomas areas were observed and divided by total section area to determine the percent of granuloma area in a section. Histopathological slides were evaluated by pathologists in a blind manner.
Statistical methods All values are expressed as mean § SD. Differences between the variance were analyzed by one-way ANOVA using SPSS13.0 software. A value of p < 0.05 was considered significant.
Disclosure of potential conflicts of interest The authors have applied for patents on LT70 and adjuvant of DDA and Poly I:C, which belong to Lanzhou University. The authors have declared that no other competing interest exists.
Acknowledgments We are grateful with Dr. Thomas G. Evans, Dr. Yan Guo, Dr. Barry Walker, and Dr. Ravi Anantha at AERAS for their providing Rv2626c and other antigens and antibodies for this study. Dr. Yan Guo also helped to review the manuscript.
Funding This work was funded by the National Major Science and Technology Projects (2012ZX10003-008-006) and NSFC of China (81072499, 31470895).
References [1] WHO. Global tuberculosis report 2014. Geneva: World health organization, 2014. http://www.who.int/tb/publications/global_report/ en/ (accessed Nov 12, 2014). [2] Lillebaek T, Dirksen A, Baess I, Strunge B, Thomsen VO, Andersen AB. Molecular evidence of endogenous reactivation of Mycobacterium tuberculosis after 33 years of latent infection. J Infect Dis 2002; 185:401-4; PMID:11807725; http://dx.doi.org/10.1086/338342 [3] Andersen P, Doherty TM. The success and failure of BCG - implications for a novel tuberculosis vaccine. Nat Rev Microbiol 2005; 3:656-62; PMID:16012514; http://dx.doi.org/10.1038/nrmicro1211 [4] Moyle PM, Toth I. Modern subunit vaccines: development, components, and research opportunities. Chem Med Chem 2013; 8:360-76; PMID:23316023; http://dx.doi.org/10.1002/cmdc.201200487 [5] Leroux-Roels I, Forgus S, De Boever F, Clement F, Demoitie MA, Mettens P, Moris P, Ledent E, Leroux-Roels G, Ofori-Anyinam O, et al. Improved CD4(C) T cell responses to Mycobacterium tuberculosis in PPD-negative adults by M72/AS01 as compared to the M72/ AS02 and Mtb72F/AS02 tuberculosis candidate vaccine formulations: a randomized trial. Vaccine 2013; 31:2196-206; PMID:22643213; http://dx.doi.org/10.1016/j.vaccine.2012.05.035 [6] Lin PL, Dietrich J, Tan E, Abalos RM, Burgos J, Bigbee C, Bigbee M, Milk L, Gideon HP, Rodgers M, et al. The multistage vaccine H56 boosts the effects of BCG to protect cynomolgus macaques against active tuberculosis and reactivation of latent Mycobacterium tuberculosis infection. J Clin Invest 2012; 122:303-14; PMID:22133873; http://dx.doi.org/10.1172/JCI46252 [7] Junqueira-Kipnis AP, Marques Neto LM, Kipnis A. Role of Fused Mycobacterium tuberculosis Immunogens and Adjuvants in Modern Tuberculosis Vaccines. Front Immunol 2014; 5:188; PMID:24795730; http://dx.doi.org/10.3389/fimmu.2014.00188 [8] Orme IM. Vaccine development for tuberculosis: current progress. Drugs 2013; 73:1015-24; PMID:23794129; http://dx.doi.org/10.1007/ s40265-013-0081-8 [9] Kaufmann SH. Tuberculosis vaccines: time to think about the next generation. Semin Immunol 2013; 25:172-81; PMID:23706597; http://dx.doi.org/10.1016/j.smim.2013.04.006 [10] Andersen P, Kaufmann SH. Novel vaccination strategies against tuberculosis. Cold Spring Harb Perspecti Med 2014; 4: 1–19; PMID:24890836 [11] Zhang Y. Advances in the treatment of tuberculosis. Clin Pharmacol Ther 2007; 82:595-600; PMID:17898708; http://dx.doi.org/10.1038/ sj.clpt.6100362 [12] Geluk A, Lin MY, van Meijgaarden KE, Leyten EM, Franken KL, Ottenhoff TH, Klein MR. T-cell recognition of the HspX protein of Mycobacterium tuberculosis correlates with latent M. tuberculosis infection but not with M. bovis BCG vaccination. Infect Immun 2007; 75:2914-21; PMID:17387166; http://dx.doi.org/10.1128/ IAI.01990-06 [13] Andersen P, Woodworth JS. Tuberculosis vaccines–rethinking the current paradigm. Trend Immunol 2014; 35:387-95; PMID:24875637; http://dx.doi.org/10.1016/j.it.2014.04.006 [14] Andersen P. Vaccine strategies against latent tuberculosis infection. Trends Microbiol 2007; 15:7-13; PMID:17141504; http://dx.doi.org/ 10.1016/j.tim.2006.11.008
HUMAN VACCINES & IMMUNOTHERAPEUTICS
[15] Pallen MJ. The ESAT-6/WXG100 superfamily – and a new Grampositive secretion system? Trends Microbiol 2002; 10:209-12; PMID:11973144; http://dx.doi.org/10.1016/S0966-842X(02)02345-4 [16] Sreejit G, Ahmed A, Parveen N, Jha V, Valluri VL, Ghosh S, Mukhopadhyay S. The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (beta2M) affecting antigen presentation function of macrophage. PLoS pathogens 2014; 10: e1004446; PMID:25356553; http://dx.doi.org/10.1371/journal. ppat.1004446 [17] Olsen AW, Williams A, Okkels LM, Hatch G, Andersen P. Protective effect of a tuberculosis subunit vaccine based on a fusion of antigen 85B and ESAT-6 in the aerosol guinea pig model. Infect Immun 2004; 72:6148-50; PMID:15385521; http://dx.doi.org/10.1128/ IAI.72.10.6148-6150.2004 [18] Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ, Besra GS. Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science 1997; 276:1420-2; PMID:9162010; http://dx.doi. org/10.1126/science.276.5317.1420 [19] Brennan MJ, Clagett B, Fitzgerald H, Chen V, Williams A, Izzo AA, Barker LF. Preclinical evidence for implementing a prime-boost vaccine strategy for tuberculosis. Vaccine 2012; 30:2811-23; PMID:22387630; http://dx.doi.org/10.1016/j.vaccine.2012.02.036 [20] Brennan MJ, Thole J. Tuberculosis vaccines: a strategic blueprint for the next decade. Tuberculosis 2012; 92 Suppl 1:S6-13; PMID:22441160; http://dx.doi.org/10.1016/S1472-9792(12)70005-7 [21] Coler RN, Skeiky YA, Vedvick T, Bement T, Ovendale P, CamposNeto A, Alderson MR, Reed SG. Molecular cloning and immunologic reactivity of a novel low molecular mass antigen of Mycobacterium tuberculosis. J Immunol 1998; 161:2356-64; PMID:9725231 [22] Coler RN, Campos-Neto A, Ovendale P, Day FH, Fling SP, Zhu L, Serbina N, Flynn JL, Reed SG, Alderson MR. Vaccination with the T cell antigen Mtb 8.4 protects against challenge with Mycobacterium tuberculosis. J Immunol 2001; 166:6227-35; PMID:11342645; http:// dx.doi.org/10.4049/jimmunol.166.10.6227 [23] Xin Q, Niu H, Li Z, Zhang G, Hu L, Wang B, Li J, Yu H, Liu W, Wang Y, et al. Subunit vaccine consisting of multi-stage antigens has high protective efficacy against Mycobacterium tuberculosis infection in mice. PloS one 2013; 8:e72745; PMID:23967337; http://dx.doi.org/ 10.1371/journal.pone.0072745 [24] Rosenkrands I, Slayden RA, Crawford J, Aagaard C, Barry CE, 3rd, Andersen P. Hypoxic response of Mycobacterium tuberculosis studied by metabolic labeling and proteome analysis of cellular and extracellular proteins. J Bacteriol 2002; 184:3485-91; PMID:12057942; http://dx.doi.org/10.1128/JB.184.13.3485-3491.2002 [25] Shi L, Jung YJ, Tyagi S, Gennaro ML, North RJ. Expression of Th1mediated immunity in mouse lungs induces a Mycobacterium tuberculosis transcription pattern characteristic of nonreplicating persistence. Proc Natl Acad Sci U S A 2003; 100:241-6; PMID:12506197; http://dx.doi.org/10.1073/pnas.0136863100 [26] Davidow A, Kanaujia GV, Shi L, Kaviar J, Guo X, Sung N, Kaplan G, Menzies D, Gennaro ML. Antibody profiles characteristic of Mycobacterium tuberculosis infection state. Infect Immun 2005; 73:6846-51; PMID:16177363; http://dx.doi.org/10.1128/IAI.73.10.6846-6851.2005
1677
[27] Niu H, Peng J, Bai C, Liu X, Hu L, Luo Y, Wang B, Zhang Y, Chen J, Yu H, et al. Multi-stage tuberculosis subunit vaccine candidate LT69 provides high protection against mycobacterium tuberculosis infection in mice. PLoS One 2015; 10:e0130641; PMID:26098302; http:// dx.doi.org/10.1371/journal.pone.0130641 [28] Wang CC, Zhu B, Fan X, Gicquel B, Zhang Y. Systems approach to tuberculosis vaccine development. Respirology 2013; 18:412-20; PMID:23331331; http://dx.doi.org/10.1111/resp.12052 [29] Coppola M, van den Eeden SJ, Wilson L, Franken KL, Ottenhoff TH, Geluk A. Synthetic Long Peptide Derived from Mycobacterium tuberculosis Latency Antigen Rv1733c Protects against Tuberculosis. Clin Vaccine Immunol 2015; 22:1060-9; PMID:26202436; http://dx. doi.org/10.1128/CVI.00271-15 [30] Luabeya AK, Kagina BM, Tameris MD, Geldenhuys H, Hoff ST, Shi Z, Kromann I, Hatherill M, Mahomed H, Hanekom WA, et al. Firstin-human trial of the post-exposure tuberculosis vaccine H56:IC31 in Mycobacterium tuberculosis infected and non-infected healthy adults. Vaccine 2015; 33:4130-40; PMID:26095509; http://dx.doi.org/ 10.1016/j.vaccine.2015.06.051 [31] Behar SM, Dascher CC, Grusby MJ, Wang CR, Brenner MB. Susceptibility of mice deficient in CD1D or TAP1 to infection with Mycobacterium tuberculosis. J Exp Med 1999; 189:1973-80; PMID:10377193; http://dx.doi.org/10.1084/jem.189.12.1973 [32] Chen CY, Huang D, Wang RC, Shen L, Zeng G, Yao S, Shen Y, Halliday L, Fortman J, McAllister M, et al. A critical role for CD8 T cells in a nonhuman primate model of tuberculosis. PLoS pathogens 2009; 5:e1000392; PMID:19381260; http://dx.doi.org/10.1371/ journal.ppat.1000392 [33] Dorman SE, Holland SM. Interferon-gamma and interleukin-12 pathway defects and human disease. Cytokine Growth Factor Rev 2000; 11:321-33; PMID:10959079; http://dx.doi.org/10.1016/S13596101(00)00010-1 [34] Walzl G, Ronacher K, Hanekom W, Scriba TJ, Zumla A. Immunological biomarkers of tuberculosis. Nat Rev Immunol 2011; 11:34354; PMID:21475309; http://dx.doi.org/10.1038/nri2960 [35] Finkelman FD, Holmes J, Katona IM, Urban JF, Jr., Beckmann MP, Park LS, Schooley KA, Coffman RL, Mosmann TR, Paul WE. Lymphokine control of in vivo immunoglobulin isotype selection. Annu Rev Immunol 1990; 8:303-33; PMID:1693082; http://dx.doi.org/ 10.1146/annurev.iy.08.040190.001511 [36] Orme IM. Current progress in tuberculosis vaccine development. Vaccine 2005; 23:2105-8; PMID:15755579; http://dx.doi.org/ 10.1016/j.vaccine.2005.01.062 [37] Geluk A, van Meijgaarden KE, Joosten SA, Commandeur S, Ottenhoff TH. Innovative Strategies to Identify M. tuberculosis Antigens and Epitopes Using Genome-Wide Analyses. Front Immunol 2014; 5:256; PMID:25009541; http://dx.doi.org/10.3389/ fimmu.2014.00256 [38] Niu H, Hu L, Li Q, Da Z, Wang B, Tang K, Xin Q, Yu H, Zhang Y, Wang Y, et al. Construction and evaluation of a multistage Mycobacterium tuberculosis subunit vaccine candidate Mtb10.4-HspX. Vaccine 2011; 29:9451-8; PMID:22024175; http://dx.doi.org/10.1016/j. vaccine.2011.10.032
RESEARCH PAPER
A multistage mycobacterium tuberculosis subunit vaccine LT70 including latency antigen Rv2626c induces long-term protection against tuberculosis Xun Liua,b, Jinxiu Penga,b, Lina Huc, Yanping Luoa, Hongxia Niua,b, Chunxiang Baia,b, Qian Wanga, Fei Lia,b, Hongjuan Yua, Bingxiang Wangc, Huiyu Chena, Ming Guod, and Bingdong Zhua,b a
Gansu Provincial Key Laboratory of Evidence Based Medicine and Clinical Translation & Lanzhou Center for Tuberculosis Research, School of Basic Medical Sciences, Lanzhou University, Lanzhou, China; bInstitute of Pathogen Biology, School of Basic Medical Sciences, Lanzhou University, Lanzhou, China; cLanzhou Institute of Biological Products, Lanzhou, China; dABSL-3 Lab, Wuhan University, Wuhan, China
ABSTRACT
ARTICLE HISTORY
To develop an effective subunit vaccine which could target tubercle bacilli with different metabolic states and provide effective protective immunity, we fused antigens ESAT6, Ag85B, peptide 190–198 of MPT64, and Mtb8.4 mainly expressed by proliferating bacteria and latency-associated antigen Rv2626c together to construct a multistage protein ESAT6-Ag85B-MPT64(190–198)-Mtb8.4-Rv2626c (LT70 for short) with the molecular weight of 70 kDa. The human T-cell responses to LT70 and other antigens were analyzed. The immune responses of LT70 in the adjuvant of DDA and Poly I:C and its protective efficacy against Mycobacterium tuberculosis (M. tuberculosis) infection in C57BL/6 mice were evaluated. The results showed that LT70 was stably produced in Escherichia coli and could be purified by successive salting-out and chromatography. LT70 could be strongly recognized by human T cells from TB patients and persons who are supposed latently infected with M. tuberculosis. The subunit vaccine LT70 generated strong antigenspecific humoral and cell-mediated immunity, and induced higher protective efficacy (5.41§0.37 Log10 CFU in lung) than traditional vaccine Bacillus Calmette-Guerin (6.01§0.33 Log10 CFU) and PBS control (6.53§0.26 Log10 CFU) at 30 weeks post vaccination (10 weeks post-challenge) against M. tuberculosis infection (p < 0.05). These findings suggested that LT70 would be a promising subunit vaccine candidate against M. tuberculosis infection.
Received 28 October 2015 Revised 22 December 2015 Accepted 8 January 2016
Introduction Mycobacterium tuberculosis (M. tuberculosis) is the causative agent of human tuberculosis (TB), a disease that is estimated to cause nearly 9 million people felling ill and 1.5 million people death worldwide every year.1 Moreover, there are about 2 billion people around the world infected with M. tuberculosis, and more than 90% of them are in latent infection. Reactivation of latent infection is considered as a cause of tuberculosis.2 Bacille Calmette-Guerin (BCG), an attenuated vaccine derived from Mycobacterium bovis, is the only vaccine available against TB.3 However, despite its protection against TB in children, BCG failed to protect adults against M. tuberculosis infection and reactivation of latent infection. Thus, novel vaccines that could provide more robust and longer protection than BCG or have the capability to boost BCG-primed immunity are urgently needed. The protein subunit vaccine is generally well tolerated and relatively safe.4 Some protein subunit vaccines, such as M72 5 and H56,6 in suitable adjuvants have been reported to induce Th1-type cell-mediated immune responses and provide effective protection against TB.7 Some of them are in clinical trials.8,9 However, most of the current subunit vaccines in clinical trials are based on antigens produced by replicating bacilli.6,10
KEYWORDS
LT70; mycobacterium tuberculosis; protective efficacy; Rv2626c; subunit vaccine
Because the infected bacteria always consist of varying growing and non-growing subpopulations which can interconvert with each other,11 ideal vaccines should not only provide protection against replicating bacteria, but also target dormant bacteria.12 Therefore novel subunit vaccine should include antigens from different stages of bacteria.6,9,13,14 There are several antigens that have been proven to have high immunogenicity. The 6 kDa early secreted antigenic target (ESAT-6), a virulence factor of M. tuberculosis, acts alone or combines with CFP10 to modulate host immune responses.15,16 ESAT-6-containing vaccines could induce strong immune responses and provide protective efficacy against TB.6,17 The Ag85 complex is a 30–32 kDa family of 3 proteins (Ag85A, Ag85B, and Ag85C), possesses enzymatic mycolyl-transferase activity involved in biogenesis of cord factor and in the coupling of mycolic acids to cell wall.18 By virtue of their strong Th1-type cytokine inducing potential the Ag85 components are among the most promising vaccine antigens now. Many of the novel TB vaccines tested in preclinical and clinical trials, are composed of Ag85 components, encoded by recombinant viral vectors or expressed as recombinant fusion proteins.19,20 Mtb8.4 elicited Th1 responses in murine and human cells.21
CONTACT Bingdong Zhu [email protected] Institute of Pathogen Biology, School of Basic Medical Sciences, Lanzhou University, 199 West Donggang Road, Lanzhou 730000, China. Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/khvi. © 2016 Taylor & Francis
HUMAN VACCINES & IMMUNOTHERAPEUTICS
Immunization with Mtb8.4 recombinant protein also induced strong CD8C cytotoxic T lymphocyte (CTL) responses and provided effective protection against M. tuberculosis challenge.22 In our previous study, we constructed a fusion protein ESAT6-Ag85B-MPT64(190–198)Mtb8.4 (EAMM), which was proved to be the most effective protein among the 8 fusion proteins constructed in our lab.23 However, there is no latency antigen included in it. Further study showed that the combination of EAMM and another fusion protein Mtb10.4-HspX (MH) consisting of a dormancy-related antigen HspX provided higher protective efficacy than EAMM or MH alone.23 Besides that, a hypothetical protein Rv2626c has been shown to be up-regulated in hypoxic conditions of an in vitro M. tuberculosis latency model.24 Further studies in the lung of M. tuberculosis infected mice showed that the expression of Rv2626c increased at the terminal stages of infection.25 Moreover, high serum antibody against Rv2626c was detected in patients with active TB.26 Our study also showed that Rv2626c induced high level of IFN-g production in the peripheral blood mononuclear cells (PBMCs) from active TB patients and close contacts. All these studies suggest that Rv2626c is an important antigen with potential to be used in TB subunit vaccines. To develop subunit vaccines which could provide promising protection, our lab constructed a multistage subunit vaccine ESAT6-Ag85B-MPT64(190–198)-Mtb8.4-Hspx (EAMMH, LT69) previously.27 In this study, we constructed another novel multistage fusion protein, ESAT6-Ag85B-MPT64(190–198)-Mtb8.4-
1671
Rv2626c with molecular weight of 70 kDa (LT70 for short). The fusion protein LT70 was mixed with an adjuvant being composed of DDA and Poly I:C, and its immunogenicity and protective efficacy were evaluated in C57BL/6 mice. The protective efficacy of the protein vaccine to boost BCG-primed immunity was also evaluated. The results showed that LT70 induced obvious higher protective efficacy than BCG and EAMMCMH.
Results Expression, purification and analysis of mycobacterial fusion proteins The new TB fusion protein LT70 is composed of the TB antigens ESAT-6, Ag85B, Mtb8.4, peptide 190–198 of MPT64, and Rv2626c, with molecular weight of 70kD. There is no mutation in the nucleotide acid DNA sequences encoding the recombinant fusion protein LT70 comparing with the DNA sequences of M. tuberculosis H37Rv. The fusion protein LT70 could be expressed in E. coli BL21. The cells were broken and the supernatant (soluble fractions) was collected (Fig. 1A), which was further purified by salt fractionation and hydrophobic chromatography successively (Fig. 1B). The purified LT70 was confirmed by Western blot. As expected, the fusion protein LT70 was recognized by anti-Ag85B and anti-Rv2626c (Fig. 1C). At the concentration of 0.5 mg/mL LT70, the endotoxin level was less than 2.5 EU/ml, which was lower than the requirement for animals and in vitro experiment.
Figure 1. Expression, purification and analysis of fusion protein LT70. (a) Expression of LT70 in E. coli. Coomassie Blue-stained 12% SDS-PAGE: E. coli BL21 lysate (lane 1), total E. coli BL21 expressing LT70 lysate (lane 2), supernatant of E. coli BL21 expressing LT70 lysate (lane 3) and sediment of E. coli lysate (lane 4). M, molecular weight. (b) Purification of LT70. The BL21 lysate containing LT70 (lane 1) was purified by 2 steps. First purification of LT70 by salting (lane 2), and followed with hydrophobic chromatography (lane 3). M, molecular weight. (c) Purified LT70 was verified by immunoblot: Mouse monoclonal anti-Rv2626c (lane 1), Negative control (lane 2), Mouse monoclonal anti-Ag85B (lane 3), Negative control (lane 4). M, molecular weight.
1672
X. LIU ET AL.
Immune responses of human PBMCs to LT70 and other antigens The protein HspX, Rv2626c, EAMM, and LT70 were co-cultured with PBMCs isolated from TB patients, close contacts (supposed to be latently infected with M. tuberculosis), and the secreted IFN-g was detected. Fig. 2 showed that Rv2626c induced higher numbers of IFN-g producing T cells than HspX did in patients with active TB. LT70 induced significant higher numbers of IFN-g producing T cells than EAMM and Rv2626c did in TB patients. Rv2626c and LT70 also induced high immune responses in M. tuberculosis close contacts (latently infected). These results indicate that LT70 containing Rv2626c could be recognized well in TB patients and M. tuberculosis latently infected human beings. Immunogenicity induced by vaccination with LT70 C57BL/6 mice were immunized with LT70 formulated in DDA/ Poly (I:C) 3 times and the releases of antigen specific IFN-g and the levels of the antibodies were evaluated. With the stimulation of ESAT6, Ag85B, Mtb8.4, Rv2626c and PPD, the numbers of spleen lymph cells secreting IFN-g from mice immunized with LT70 were higher than that from PBS, BCG and EAMMCMH groups (p < 0.05) (Fig. 3). The titers of IgG1 and IgG2c antibodies against Ag85B and Rv2626c and the relative ratio of IgG2c to IgG1 in LT70 group were significantly higher than that of BCG group (p < 0.05) and almost same as EAMMCMH group, and the antibody titers in PBS control group were negative (Table 1). Protective efficacy induced by vaccination with LT70 At week 30 post the last vaccination, mice were infected with M. tuberculosis H37Rv 50–100 CFU by aerosol challenge. Ten weeks later, the bacteria load in lung and spleen tissues were measured. The subunit vaccine LT70 showed better effect to
Figure 3. The immunogenicity of LT70 vaccine. Mice were immunized with 13 mg of LT70 formulated in DDA/poly(I:C) 3 times at 2-week intervals subcutaneously (s. c.) in week 0, 2 and 4 of the experiments. For EAMMCMH group, the mice were received EAMM (10 mg ) and MH (10 mg ) in DDA/poly(I:C). Mice immunized with 5£105 BCG or PBS was used as controls. Six weeks after the final vaccination, spleen cells were stimulated with ESAT6 (10 mg /ml), Ag85B (5 mg /ml), Mtb8.4 (10 mg /ml), Rv2626c (10 mg /ml) and PPD (5 mg /ml) respectively in vitro. The IFN-g was detected by ELISPOT kit and was showed as number of cells secreting IFN-g/3£105. Data were shown as means§ SD. n D 4. p < 0.05, relative to PBS and BCG groups.
control bacterial growth in lungs than EAMMCMH and BCG vaccines (p < 0.05), reducing approximately 1.12 log10 bacterial counts compared with PBS control (p < 0.01) (Table 2), and 0.6 log10 CFU than BCG group.
Immune responses induced by BCG priming and LT70 boosting C57BL/6 mice were primed with BCG and boosted with LT70 vaccine twice. The releases of IFN-g in spleen lymphocytes and the titers of antibodies in serum were evaluated. The results showed that with the stimulation of ESAT6, Ag85B and Rv2626c, the numbers of IFN-g secreting lymphocytes from the mice primed by BCG and boosted by LT70 were higher than that immunized with BCG without boosting (p < 0.05) (Fig. 4). The antibody titers of IgG1 and IgG2c against Ag85B and Rv2626c in the prime-boost group were also higher than that of BCG group (p < 0.05) (Table 1).
Protective efficacy induced by BCG priming and LT70 boosting
Figure 2. IFN-g responses to protein EAMM, HspX, Rv2626c and LT70 in different groups of donors. In this study, active TB patients (TB, n D 20) and close contacts (n D 10) were recruited. Freshly isolated PBMCs from these subjects were plated in duplicate at 3£105 cell per well in 96 spot and incubated with EAMM (5 mg/ ml), HspX (5 mg/ml), Rv2626c (5 mg/ml) and LT70 (5 mg/ml) for 48 h at 37 C, 5% CO2. IFN-g was detected using Human IFN-g ELISPOT kits. Data were shown as means§ SD. p < 0.01.
Mice were primed with BCG and boosted with LT70. Sixteen weeks after the last immunization, mice were challenged with M. tuberculosis H37Rv by inhalation. BCG-prime and LT70boost induced a significant reduction in the number of bacteria in the lungs and spleen compared to PBS controls (p < 0.05) (Table 2). In the pathologic reaction induced by vaccine immunization and M. tuberculosis challenge, the mice injected with PBS presented extensive pulmonary lesion and granulomas,
HUMAN VACCINES & IMMUNOTHERAPEUTICS
1673
Table 1. Serum antibodies induced by LT70 vaccine and BCG-prime, LT70-boost regimen. Anti-Ag85B Groups PBS BCG EAMMCMH LT70 BCG prime, LT70 boost
IgG1 — 2.47 § 0.33 4.40 § 0.41 4.67 § 0.32 4.67 § 0.32
Anti-Rv2626c
IgG2c
IgG2c/ IgG1
IgG1
IgG2c
IgG2c/ IgG1
— 1.13 § 0.05 2.50 § 0.16 3.55 § 0.33 4.52 § 0.43
— 0.46 § 0.15 0.56 § 0.39 0.76 § 1.03 0.97 § 1.34
— 1.17 § 0.05 — 4.52 § 0.43 4.50 § 0.36
— — — 2.90 § 0.27 4.45 § 0.36
— — — 0.64 § 0.62 0.98 § 1.00
Notes. Serum samples were collected 6 weeks after the last injection and the reciprocal end point titers of antigen specific IgG1 and IgG2c were analyzed by ELISA. Data were shown as means § SD. p < 0.05, relative to PBS and BCG groups.
while the mice primed with BCG and boosted with LT70 presented smaller lesions than PBS control (p < 0.01) (Fig. 5).
Discussion d ais usually significant,ward constructed a novel fusion protein LT70 based on 5 mycobacterial antigens and peptide (ESAT6, Ag85B, Mtb8.4, 190–198 peptide of MPT64, and Rv2626c), which were expressed in various stages of bacteria respectively. The results showed that LT70 could be recognized well by human beings, and induce high immune responses in mice, and its protective efficacy against M. tuberculosis infection in mice was significantly higher than PBS control and BCG at 30 weeks after last immunization. The bacteria infected our body are heterogeneous.11 Both rapid growing and nonreplicating dormant M. tuberculosis bacteria coexist. The bacterial populations are in continuum with different metabolic status and these populations can interconvert.11 During primary phase, there is a rapid growing bacterial population and a relatively small population of non-growing bacteria. Along with the infection process, the number of growing bacteria decresed and the latent population incresed. This suggested that antigens in various growth stages should be included to construct novel multi-stage TB subunit vaccines so as to provide complete immune protection against bacteria in different metabolic states.6,10,14,28 In our previous study, subunit vaccine MH which contains a well-known latency-related antigen HspX could enhance the protective efficacy of EAMM vaccine consisting of 4 antigens mainly expressed by growing bacteria.23 The multistage TB subunit vaccine based on fusion protein LT69 containg HspX showed strong immunogenicity and high protective effect against M. tuberculosis H37Rv aerosol challenge, reducing approximately 0.72 log10 bacterial counts than PBS control.27 Other latent related antigens and multistage vaccines were also reported. One of latent-infection related antigens, Rv2660c, was linked together with Ag85BESAT6 to construct the subunit vaccines H56, which provided improved protective efficacy than Ag85B-ESAT6.30 Rv1733c is another latent related antigen. Using its synthetic peptides could led to a significant reduction in the bacterial load in the lungs of M. tuberculosis-challenged mice.29 Latency-associated Rv1813 was linked with other 3 M. tuberculosis antigens (Rv2608, Rv3619, Rv3620) to construct a multistage protein vaccine ID93, which induced high protective efficacy close to BCG.4
We compared the immune responses of Rv2626c (which was first screened by AERAS and donated to us), HspX, and Rv2007c in active TB patients and close contacts, and found that Rv2626c induced higher IFN-g production than others, which suggest that Rv2626c is an antigen candidate. Therefore, we fused antigen Rv2626c with EAMM to construct a novel multi-stage fusion protein LT70. LT70 showed promising protective efficacy in mice, reducing about 1.12 Log10 CFU in lung than PBS control, more than traditional vaccine Bacillus Calmette-Guerin (which reducing 0.52 Log10 CFU in lung tissue). It suggestes that LT70 would be a promising subunit vaccine candidate against M. tuberculosis infection. It is well known that protection against M. tuberculosis infection is highly dependent on Th1-type immune responses.31,32 People with gene-deficiencies impairing IFN-g showed increased susceptibility to M. tuberculosis infection.33 Recent studies showed that the ability of CD4C T cells to produce IFN-g, which activates phagocytes to engulf the intracellular pathogen, is central to the protection of M. tuberculosis infection.34 In our study, mice receiving LT70 subunit vaccine generated high antigen specific IFN-g as well as high IgG2c, and IgG1 antibodies. The BCG-prime and LT70 vaccineboosted mice presented higher ratio of antigen specific IgG2c/ IgG1 than BCG without boosting, which reflected that LT-70 induced a Th1-type immune response.35 Bacteria load (CFU data) is the most commonly used guide to determine whether a candidate vaccine had protective efficacy.34 A drop of about 0.7 log10 CFU in lung is usually regarded as statistically significant.36 We analyzed the bacterial load in lungs and spleens against M. tuberculosis infection at
Table 2. The protective efficacy of vaccines and BCG-prime, vaccine boost regimen against H37Rv infection in mice. Groups PBS BCG EAMMCMH LT69 LT70 BCG prime, LT70 boost
Mean Log10 CFU § SD(LUNG)
Mean Log10 CFU § SD(SPLEEN)
6.53 § 0.26 6.01 § 0.33(¡0.52) 5.78 § 0.32(¡0.75) 5.68 § 0.39(¡0.85) 5.41 § 0.37 (¡1.12) 5.62 § 0.64 (¡0.91)
5.98 § 0.27 5.10 § 0.45(¡0.88) 5.07 § 0.47 (¡0.91) 5.20 § 0.50 (¡0.78) 4.91 § 0.17 (¡1.07) 4.70 § 0.41 (¡1.28)
Notes. Ten weeks later, the protective efficacy was measured by detecting the bacteria load in lung tissuesand spleen tissues. Results are presented as means § SD from groups of 7 mice. p < 0.05, relative to PBS group. p < 0.01, relative to PBS and BCG groups.
1674
X. LIU ET AL.
Eight of 13 novel TB vaccine candidates that are currently entering the clinical trials belong to protein subunit category, demonstrating the important role of protein vaccines in the next generation of TB vaccines.10 We choosed the antigens of high immunogenicity like ESAT-6, Ag85B, Mtb8.4 and Rv2626c to construct LT70. These antigens are mainly selected on the basis of antigenicity, immunogenicity, and anti-infection protection in animal models. It may face inherent limitations to antigen screening due to the complex pathogenesis of M. tuberculosis and its interaction with the host.37 Furthermore, the subunit vaccine based on multi-stage fusion protein LT70 with adjuvant of DDA and Poly I:C induces high immune responses and protective efficacy in mice. We still need to evaluate its protective efficacy in other animal models such as non-human primates and guinea pigs in future.
Materials and methods Ethics statement Figure 4. The immune responses in the BCG-prime and LT70-boost regimen. C57BL/6 mice were primed with BCG at 0 week, and boosted with 10 mg of LT70 vaccine by s.c. at 15 and 18 week separately. Six weeks after the last boosting, spleen cells were stimulated with ESAT6, Ag85B and Rv2626c in vitro, and IFN-g production was assayed by ELISPOT. Results are presented as means § SD. nD4. p < 0.05, relative to PBS and BCG groups. p < 0.05, relative to PBS, BCG and LT70 groups.
30 weeks after vaccination. The results showed that LT70 alone reduced approximately 1.12 log10 bacterial counts comparing with PBS control (p < 0.001), higher than BCG induced protection. Therefore, LT70 vaccination induced long-term (at least 30 weeks after vaccination) protection against M. tuberculosis infection, higher than that conferred by BCG.
Animal experiments were performed in accordance with the guidelines of Council on Animal Care and Use. The protocols were approved by the Institutional Animal Care and Use Committee of Gansu College of Traditional Chinese Medicine (permit number: SYXK(Gan) 2013–001). Animals received free access to water and food throughout the study. During the experiments, the vaccinated and infected mice were monitored every day. Mice were euthanized by cervical dislocation. The research involved human participants have been approved by the Human Research Ethics Committee of Lanzhou University and Lanzhou Pulmonary Hospital. Each individual was introduced the nature of the research and given the study protocol, and they all signed the informed consents. Animals Studies were performed with C57BL/6 female mice (6–8 weeks old) from Slaccas Inc. (Beijing, China). Mice were housed in special pathogen-free conditions in Gansu University of Traditional Chinese Medicine. For M. tuberculosis H37Rv challenge experiments, animals were kept in ABSL-3 lab at Wuhan University. Mice received free access to food and provided with water ad libitum. Animal experiments were performed in compliance with the ethical and experiment regulations for animal care at Gansu University of Traditional Chinese Medicine and Wuhan University. pET30a(C)-LT70 plasmid construction
Figure 5. Pathologic reaction induced by vaccine immunization and M. tuberculosis challenge. Mice were immunized with BCG, EAMMCMH, LT69, LT70 and BCG prime, LT70 boost respectively. After the last vaccination, mice were aerosolinfected with M. tuberculosis H37Rv 50–100 CFU. The representative histological sections of the lungs from mice and the area ratio of granuloma in sections with HE of all groups were shown. nD5.
Recombinant pET30a(C)-Mtb8.4-HspX and pET30a (C)-ESAT6-Ag85B were produced as previously indicated.23,38 The plasmid encoding ESAT6-Ag85B-MPT64(190– 198)-Mtb8.4-Rv2626c was generated by inserting the genes Rv2626c into the multiple cloning sites of pET30a (C)-ESAT6-Ag85B-MPT64(190–198)-Mtb8.4 as follows. Initially, the DNA sequences coding fusion protein of MPT64(190–198)-Mtb8.4 was generated by PCR amplification from pET30a(C)-Mtb8.4-HspX plasmid. The fragment was
HUMAN VACCINES & IMMUNOTHERAPEUTICS
cloned into the Bgl II and Hind III site of pET30(C) to construct the plasmid pET30(C)-MPT64(190–198)-Mtb8.4. ESAT6-Ag85B sequence was generated by PCR amplification from pET30a(C)-ESAT6-Ag85B plasmid with the Primer F, CGGCATATGACAGAGCAGC AGTGGAA T (Nde I) and R, GAAGATCTGCCGGCGCCTAACGA ACTCTGGAG(Bgl II). Then this fragment was cloned into the unique sites Nde I and Bgl II of the previously constructed pET30(C)-MPT64(190–198)-Mtb8.4 plasmid. The DNA sequences coding Rv2626c was generated by PCR amplification from pET30a(C)-Rv2626c plasmid (provided by AERAS, USA) with the primer F, 50 –30 AC GAGCTC ATGACCACGG(Sac I) and the primer R, 50 –30 CCC AAGCTT CTATGCATTTAG(Hind III). The fragment was cloned into the Sac I and Hind III site of pET30a (C)-ESAT6-Ag85B-MPT64(190–198)-Mtb8.4 to construct the plasmid pET30a(C)-ESAT6-Ag85B-MPT64(190–198)-Mtb8.4Rv2626c (LT-70). The final plasmid constructed was transformed into the E. coli strain BL21 for production of the fusion protein LT70.
Expression, purification and analysis of mycobacterial fusion proteins E. coli BL21 expressing LT70 was grown in culture flask to an OD of 0.5 at 600 nm before incubation with 0.5 mM isopropyl b-D-thiogalactopyranoside (IPTG). After incubation for 4 h at 29 C, cells were harvested and suspended in phosphate buffer (20 mM; pH7.4). Samples were centrifuged and the supernatant containing the target protein LT70 was then submitted for purification. The method for purification of LT70 included 2 steps. First, saturated ammonium sulfate was added to the protein sample to 15% of saturation, and the precipitate from the salting-out was collected and resuspended in buffer A (phosphate buffer, 20 mM; sodium chloride, 0.25 M; pH7.4). Then the LT70 was further purified by a hydrophobic chromatography (HIC) on butyl-sepharose high performance column with AKTA Purifier 100 (GE Healthcare, Piscataway, NJ) and protein LT70 was eluted from the resin with buffer B (phosphate buffer, 20mM; pH7.4). The molecular weight and purity of the purified protein were assessed by SDS-PAGE, which was performed using 12% gradient Tris–glycine polyacrylamide gel using Bio-Rad MiniPROTEAN Tetra Electrophoresis System (Bio-Rad, CA, USA). The concentrations of the proteins were determined by the Lowry protein assay. Western blot was used to confirm the LT70 protein, in which protein LT70 was electrophoretically transferred onto nitrocellulose membrane, and the membrane was blocked with 5% bovine serum albumin (BSA)–Phosphate Buffered Saline (PBS) and was incubated with mouse monoclonal antiRv2626c (1:2000) and anti-Ag85B (1:2000) respectively, and followed by rabbit anti-mouse antibody (1:5000). Finally, we used ECL to chemiluminescence. Endotoxin levels of the fusion proteins EAMM, MH and LT70 were quantified by Gel Clot Tachypleus Amebocyte lysate (TAL) assay (Zhanjiang A&C Biological Ltd., Guangdong, China).
1675
Human subjects Twenty TB patients and 10 close contacts (latently infected with M. tuberculosis) were recruited to analyze their T-cell response to protein EAMM, HspX, Rv2626c and L70. The 20 TB patients were recruited from Lanzhou Pulmonary Hospital, Lanzhou, China. All patients were active TB with sputum smear positive. The close contacts were healthy individuals who were close contacted with TB patient in Lanzhou Pulmonary Hospital. ELISPOT for IFN-g production in human PBMCs Peripheral blood mononuclear cells (PBMCs) from human donors were freshly isolated by gradient centrifugation of heparinized blood. Human IFN-g pre-coated ELISPOT kits (Dakewe Biotech Company Ltd., Shenzhen, China) were performed according to the instruction of the manual. The 96-well plates pre-coated with anti-human IFN-g antibody were activated with RPMI-1640 for 15 min at room temperature. Freshly isolated PBMCs were plated in duplicate at 3£105 cells per well in RPMI 1640 supplemented with penicillin, streptomycin, and 10% newborn calf serum and stimulated with EAMM (5 mg/ ml), HspX (5 mg/ml), Rv2626c (5 mg/ml) and LT70 (5 mg/ml) respectively for 20 h at 37 C, 5% CO2. The cells were then removed and the Biotinylated antibody, Streptavidin–HRP, and AEC substrate was added subsequently, spots were counted on an automated ELISPOT reader. Vaccine preparation and adjuvants Vaccine was prepared as previously described.23,38 In short, for one dose of 0.2 ml, 10 mg of EAMM plus 10 mg of MH, 10 mg of LT69 or 13 mg of LT70 were mixed with the adjuvant consisting of 250 mg of N, N’-dimethyl-N, N’-dioctadecylammonium bromide (DDA) (Sigma-Aldrich, Poole, UK) and 50 mg of polyinosinic-polycytidylic acid (PolyI;C) (Sigma-Aldrich, Poole, UK) respectively to construct the subunit vaccine. Vaccine immunization Mice were immunized with LT69 (10 mg/dose), EAMM(10 mg/ dose) CMH (10 mg/dose) and LT70 (13 mg/dose) 3 times at 2week intervals subcutaneously (s.c.) at week 0, 2 and 4 separately. Mice immunized with BCG received a single dose of 5£105 CFU of BCG Danish s.c. in a volume of 0.2 ml at the week 0. In the BCG prime-boost regimen, mice were primed with BCG at week 0, and boosted with LT70 by s.c. at 15th and 18th week. The detection of cytokine IFN-g and antibodies The levels of antigen-specific IFN-g were tested using an enzyme-linked immunospot (ELISPOT) assay (Dakewe Biotech company limited, Shenzhen, China) following 40 h - incubation of splenocytes with special antigens, such as ESAT-6 (10 mg/ ml), Ag85B (5 mg/ml), Mtb8.4 (10 mg/ml), Rv2626c (10 mg/ ml), and PPD (5 mg/ml). Rv2626c and PPD were provided by AERAS, and the others were prepared in our lab. The ELISPOT
1676
X. LIU ET AL.
was developed according to manufacturer’s protocol. The spots were counted using an ELISPOT reader (Bio-sys, GmbH, Karben, Germany) and the results were showed as the mean spotforming cells per 5£105 cells § SD. The levels of the antibodies IgG1 and IgG2c against antigens Ag85B and Rv2626c in mouse sera were determined using enzyme-linked immunosorbent assay (ELISA). The ELISA was performed as follows: Microtitre plates were coated with 100 ul/well of antigens at 10 ug/ml in PBS overnight at 4 C; The plates were then washed with PBS containing 0.05% Tween 20 (PBST); Horse radish peroxidase-conjugated rabbit anti-mouse IgG1 or IgG2c (ROCKLAND, ROCKLAND immunochemicals Inc.) at a 1:25,000 dilution was added with 100 ul/well. The plates were incubated for 1 h at 37 C and washed with PBST. After washing, plates were added with TMB substrate 200 ul/ well and were incubated at room temperature for about 20 min. The reaction was stopped by the addition of a solution of sulphuric acid (1 mol/L). The optical density (OD) was measured at 450 nm.
M. tuberculosis challenge and bacteria-load detection Mice were challenged with 50–100 CFU of M. tuberculosis H37Rv per mouse by aerosol at 30 weeks after the last LT70 immunization (34 weeks after BCG immunization). In the BCG-prime and LT70-boost regimen, mice were challenged by H37Rv at 16 weeks after the last immunization. Enumerations of bacterial colony forming units (CFU) in the lungs and spleens were determined by serial 10-fold dilutions of wholeorgan homogenates on 7H11 medium (BD, NJ, USA) at 10 weeks after infection. Bacteria - load were presented as log10 CFU§SD.
Histopathological analysis The upper left lobes of the lungs of mice were harvested after M. tuberculosis H37Rv infection, fixed in 10% formalin, and embedded in paraffin blocks, then they were sectioned for light microscopy. To analyze the pathological changes, the sections were stained with haematoxylin and eosin. Granulomas areas were observed and divided by total section area to determine the percent of granuloma area in a section. Histopathological slides were evaluated by pathologists in a blind manner.
Statistical methods All values are expressed as mean § SD. Differences between the variance were analyzed by one-way ANOVA using SPSS13.0 software. A value of p < 0.05 was considered significant.
Disclosure of potential conflicts of interest The authors have applied for patents on LT70 and adjuvant of DDA and Poly I:C, which belong to Lanzhou University. The authors have declared that no other competing interest exists.
Acknowledgments We are grateful with Dr. Thomas G. Evans, Dr. Yan Guo, Dr. Barry Walker, and Dr. Ravi Anantha at AERAS for their providing Rv2626c and other antigens and antibodies for this study. Dr. Yan Guo also helped to review the manuscript.
Funding This work was funded by the National Major Science and Technology Projects (2012ZX10003-008-006) and NSFC of China (81072499, 31470895).
References [1] WHO. Global tuberculosis report 2014. Geneva: World health organization, 2014. http://www.who.int/tb/publications/global_report/ en/ (accessed Nov 12, 2014). [2] Lillebaek T, Dirksen A, Baess I, Strunge B, Thomsen VO, Andersen AB. Molecular evidence of endogenous reactivation of Mycobacterium tuberculosis after 33 years of latent infection. J Infect Dis 2002; 185:401-4; PMID:11807725; http://dx.doi.org/10.1086/338342 [3] Andersen P, Doherty TM. The success and failure of BCG - implications for a novel tuberculosis vaccine. Nat Rev Microbiol 2005; 3:656-62; PMID:16012514; http://dx.doi.org/10.1038/nrmicro1211 [4] Moyle PM, Toth I. Modern subunit vaccines: development, components, and research opportunities. Chem Med Chem 2013; 8:360-76; PMID:23316023; http://dx.doi.org/10.1002/cmdc.201200487 [5] Leroux-Roels I, Forgus S, De Boever F, Clement F, Demoitie MA, Mettens P, Moris P, Ledent E, Leroux-Roels G, Ofori-Anyinam O, et al. Improved CD4(C) T cell responses to Mycobacterium tuberculosis in PPD-negative adults by M72/AS01 as compared to the M72/ AS02 and Mtb72F/AS02 tuberculosis candidate vaccine formulations: a randomized trial. Vaccine 2013; 31:2196-206; PMID:22643213; http://dx.doi.org/10.1016/j.vaccine.2012.05.035 [6] Lin PL, Dietrich J, Tan E, Abalos RM, Burgos J, Bigbee C, Bigbee M, Milk L, Gideon HP, Rodgers M, et al. The multistage vaccine H56 boosts the effects of BCG to protect cynomolgus macaques against active tuberculosis and reactivation of latent Mycobacterium tuberculosis infection. J Clin Invest 2012; 122:303-14; PMID:22133873; http://dx.doi.org/10.1172/JCI46252 [7] Junqueira-Kipnis AP, Marques Neto LM, Kipnis A. Role of Fused Mycobacterium tuberculosis Immunogens and Adjuvants in Modern Tuberculosis Vaccines. Front Immunol 2014; 5:188; PMID:24795730; http://dx.doi.org/10.3389/fimmu.2014.00188 [8] Orme IM. Vaccine development for tuberculosis: current progress. Drugs 2013; 73:1015-24; PMID:23794129; http://dx.doi.org/10.1007/ s40265-013-0081-8 [9] Kaufmann SH. Tuberculosis vaccines: time to think about the next generation. Semin Immunol 2013; 25:172-81; PMID:23706597; http://dx.doi.org/10.1016/j.smim.2013.04.006 [10] Andersen P, Kaufmann SH. Novel vaccination strategies against tuberculosis. Cold Spring Harb Perspecti Med 2014; 4: 1–19; PMID:24890836 [11] Zhang Y. Advances in the treatment of tuberculosis. Clin Pharmacol Ther 2007; 82:595-600; PMID:17898708; http://dx.doi.org/10.1038/ sj.clpt.6100362 [12] Geluk A, Lin MY, van Meijgaarden KE, Leyten EM, Franken KL, Ottenhoff TH, Klein MR. T-cell recognition of the HspX protein of Mycobacterium tuberculosis correlates with latent M. tuberculosis infection but not with M. bovis BCG vaccination. Infect Immun 2007; 75:2914-21; PMID:17387166; http://dx.doi.org/10.1128/ IAI.01990-06 [13] Andersen P, Woodworth JS. Tuberculosis vaccines–rethinking the current paradigm. Trend Immunol 2014; 35:387-95; PMID:24875637; http://dx.doi.org/10.1016/j.it.2014.04.006 [14] Andersen P. Vaccine strategies against latent tuberculosis infection. Trends Microbiol 2007; 15:7-13; PMID:17141504; http://dx.doi.org/ 10.1016/j.tim.2006.11.008
HUMAN VACCINES & IMMUNOTHERAPEUTICS
[15] Pallen MJ. The ESAT-6/WXG100 superfamily – and a new Grampositive secretion system? Trends Microbiol 2002; 10:209-12; PMID:11973144; http://dx.doi.org/10.1016/S0966-842X(02)02345-4 [16] Sreejit G, Ahmed A, Parveen N, Jha V, Valluri VL, Ghosh S, Mukhopadhyay S. The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (beta2M) affecting antigen presentation function of macrophage. PLoS pathogens 2014; 10: e1004446; PMID:25356553; http://dx.doi.org/10.1371/journal. ppat.1004446 [17] Olsen AW, Williams A, Okkels LM, Hatch G, Andersen P. Protective effect of a tuberculosis subunit vaccine based on a fusion of antigen 85B and ESAT-6 in the aerosol guinea pig model. Infect Immun 2004; 72:6148-50; PMID:15385521; http://dx.doi.org/10.1128/ IAI.72.10.6148-6150.2004 [18] Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ, Besra GS. Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science 1997; 276:1420-2; PMID:9162010; http://dx.doi. org/10.1126/science.276.5317.1420 [19] Brennan MJ, Clagett B, Fitzgerald H, Chen V, Williams A, Izzo AA, Barker LF. Preclinical evidence for implementing a prime-boost vaccine strategy for tuberculosis. Vaccine 2012; 30:2811-23; PMID:22387630; http://dx.doi.org/10.1016/j.vaccine.2012.02.036 [20] Brennan MJ, Thole J. Tuberculosis vaccines: a strategic blueprint for the next decade. Tuberculosis 2012; 92 Suppl 1:S6-13; PMID:22441160; http://dx.doi.org/10.1016/S1472-9792(12)70005-7 [21] Coler RN, Skeiky YA, Vedvick T, Bement T, Ovendale P, CamposNeto A, Alderson MR, Reed SG. Molecular cloning and immunologic reactivity of a novel low molecular mass antigen of Mycobacterium tuberculosis. J Immunol 1998; 161:2356-64; PMID:9725231 [22] Coler RN, Campos-Neto A, Ovendale P, Day FH, Fling SP, Zhu L, Serbina N, Flynn JL, Reed SG, Alderson MR. Vaccination with the T cell antigen Mtb 8.4 protects against challenge with Mycobacterium tuberculosis. J Immunol 2001; 166:6227-35; PMID:11342645; http:// dx.doi.org/10.4049/jimmunol.166.10.6227 [23] Xin Q, Niu H, Li Z, Zhang G, Hu L, Wang B, Li J, Yu H, Liu W, Wang Y, et al. Subunit vaccine consisting of multi-stage antigens has high protective efficacy against Mycobacterium tuberculosis infection in mice. PloS one 2013; 8:e72745; PMID:23967337; http://dx.doi.org/ 10.1371/journal.pone.0072745 [24] Rosenkrands I, Slayden RA, Crawford J, Aagaard C, Barry CE, 3rd, Andersen P. Hypoxic response of Mycobacterium tuberculosis studied by metabolic labeling and proteome analysis of cellular and extracellular proteins. J Bacteriol 2002; 184:3485-91; PMID:12057942; http://dx.doi.org/10.1128/JB.184.13.3485-3491.2002 [25] Shi L, Jung YJ, Tyagi S, Gennaro ML, North RJ. Expression of Th1mediated immunity in mouse lungs induces a Mycobacterium tuberculosis transcription pattern characteristic of nonreplicating persistence. Proc Natl Acad Sci U S A 2003; 100:241-6; PMID:12506197; http://dx.doi.org/10.1073/pnas.0136863100 [26] Davidow A, Kanaujia GV, Shi L, Kaviar J, Guo X, Sung N, Kaplan G, Menzies D, Gennaro ML. Antibody profiles characteristic of Mycobacterium tuberculosis infection state. Infect Immun 2005; 73:6846-51; PMID:16177363; http://dx.doi.org/10.1128/IAI.73.10.6846-6851.2005
1677
[27] Niu H, Peng J, Bai C, Liu X, Hu L, Luo Y, Wang B, Zhang Y, Chen J, Yu H, et al. Multi-stage tuberculosis subunit vaccine candidate LT69 provides high protection against mycobacterium tuberculosis infection in mice. PLoS One 2015; 10:e0130641; PMID:26098302; http:// dx.doi.org/10.1371/journal.pone.0130641 [28] Wang CC, Zhu B, Fan X, Gicquel B, Zhang Y. Systems approach to tuberculosis vaccine development. Respirology 2013; 18:412-20; PMID:23331331; http://dx.doi.org/10.1111/resp.12052 [29] Coppola M, van den Eeden SJ, Wilson L, Franken KL, Ottenhoff TH, Geluk A. Synthetic Long Peptide Derived from Mycobacterium tuberculosis Latency Antigen Rv1733c Protects against Tuberculosis. Clin Vaccine Immunol 2015; 22:1060-9; PMID:26202436; http://dx. doi.org/10.1128/CVI.00271-15 [30] Luabeya AK, Kagina BM, Tameris MD, Geldenhuys H, Hoff ST, Shi Z, Kromann I, Hatherill M, Mahomed H, Hanekom WA, et al. Firstin-human trial of the post-exposure tuberculosis vaccine H56:IC31 in Mycobacterium tuberculosis infected and non-infected healthy adults. Vaccine 2015; 33:4130-40; PMID:26095509; http://dx.doi.org/ 10.1016/j.vaccine.2015.06.051 [31] Behar SM, Dascher CC, Grusby MJ, Wang CR, Brenner MB. Susceptibility of mice deficient in CD1D or TAP1 to infection with Mycobacterium tuberculosis. J Exp Med 1999; 189:1973-80; PMID:10377193; http://dx.doi.org/10.1084/jem.189.12.1973 [32] Chen CY, Huang D, Wang RC, Shen L, Zeng G, Yao S, Shen Y, Halliday L, Fortman J, McAllister M, et al. A critical role for CD8 T cells in a nonhuman primate model of tuberculosis. PLoS pathogens 2009; 5:e1000392; PMID:19381260; http://dx.doi.org/10.1371/ journal.ppat.1000392 [33] Dorman SE, Holland SM. Interferon-gamma and interleukin-12 pathway defects and human disease. Cytokine Growth Factor Rev 2000; 11:321-33; PMID:10959079; http://dx.doi.org/10.1016/S13596101(00)00010-1 [34] Walzl G, Ronacher K, Hanekom W, Scriba TJ, Zumla A. Immunological biomarkers of tuberculosis. Nat Rev Immunol 2011; 11:34354; PMID:21475309; http://dx.doi.org/10.1038/nri2960 [35] Finkelman FD, Holmes J, Katona IM, Urban JF, Jr., Beckmann MP, Park LS, Schooley KA, Coffman RL, Mosmann TR, Paul WE. Lymphokine control of in vivo immunoglobulin isotype selection. Annu Rev Immunol 1990; 8:303-33; PMID:1693082; http://dx.doi.org/ 10.1146/annurev.iy.08.040190.001511 [36] Orme IM. Current progress in tuberculosis vaccine development. Vaccine 2005; 23:2105-8; PMID:15755579; http://dx.doi.org/ 10.1016/j.vaccine.2005.01.062 [37] Geluk A, van Meijgaarden KE, Joosten SA, Commandeur S, Ottenhoff TH. Innovative Strategies to Identify M. tuberculosis Antigens and Epitopes Using Genome-Wide Analyses. Front Immunol 2014; 5:256; PMID:25009541; http://dx.doi.org/10.3389/ fimmu.2014.00256 [38] Niu H, Hu L, Li Q, Da Z, Wang B, Tang K, Xin Q, Yu H, Zhang Y, Wang Y, et al. Construction and evaluation of a multistage Mycobacterium tuberculosis subunit vaccine candidate Mtb10.4-HspX. Vaccine 2011; 29:9451-8; PMID:22024175; http://dx.doi.org/10.1016/j. vaccine.2011.10.032
