Vol. 66, No. 8
JOURNAL OF VIROLOGY, Aug. 1992, P. 5092-5095
0022-538X/92/085092-04$02.00/0 Copyright C 1992, American Society for Microbiology
A Mutation at One End of Moloney Murine Leukemia Virus DNA Blocks Cleavage of Both Ends by the Viral Integrase In Vivo JOHN E. MURPHYt AND STEPHEN P. GOFF*
Department of Biochemistry and Molecular Biophysics, Columbia University College of Physicians and Surgeons, New York, New York 10032 Received 28 August 1991/Accepted 29 April 1992
The integration of retroviral DNA proceeds through two steps: trimming of the termini to expose new 3' OH ends, and the transfer of those ends to the phosphates of target DNA. We have examined the ability of the Moloney murine leukemia virus integrase protein (IN) to trim the termini of the preintegrative DNA of mutant viruses with alterations in the U3 inverted repeat. The mutant terminus of one replication-defective viral DNA, containing a 7-bp deletion in the U3 inverted repeat, was not trimmed to produce the normal recessed end. Remarkably, the other terminus of this mutant DNA was also not trimmed, even though its sequence is wild type. This finding suggests that the IN protein requires the presence of two good ends before becoming properly activated to trim either one. mutations examined to date have been found to block the first step in the integration process. The effects of several mutations in the cis-acting inverted repeat regions have also been analyzed (3, 4, 12). Analysis of a number of viable viruses with mutations in the inverted repeats show that there is considerable flexibility in the position of the endonucleolytic cleavage, in that variants have been generated such that 1, 2, or 4 nucleotides (nt) are trimmed from the DNA without effect on the subsequent integration. These studies led to the conclusion that the site at which the viral DNA is cleaved by IN is always identical to the site at which the virus is joined to the host DNA (4, 15). Although inviable mutants of M-MuLV with deletions in the inverted repeats exist, the stage in the reaction at which these mutants are blocked in vivo has not been identified. In principle, these mutants could be blocked at either the trimming or joining
Immediately after infection of a cell, retroviruses carry out two reactions which are hallmarks of their unusual life cycle: the viral RNA genome is reverse transcribed into DNA, and this DNA is subsequently integrated into the host genome (for reviews, see references 8, 9, and 18). The integration reaction is now understood in some detail through biochemical and genetic analyses and is divided into two stages. In the first step, the full-length blunt-ended linear DNA, the product of reverse transcription, is trimmed by the endonuclease activity of the viral integrase (IN). This protein, brought into the cell inside the virion particle, cleaves two bases from the 3' ends of each strand to produce recessed 3' OH ends (11, 15). In the second step, the two newly formed 3' OH ends of the viral DNA are transferred to phosphates of the target DNA, releasing 3' OH ends at breaks in the target DNA (1, 6, 7). The two termini are joined to the target DNA at relative positions displaced by a small number of nucleotides, resulting in the generation of short gaps that flank the viral DNA. It is presumed that host functions are responsible for repair of the gaps, removal of unpaired bases, and ligation of the breaks in the DNA. The integration of the newly synthesized viral DNA genome into the host DNA is an essential part of the life cycle of Moloney murine leukemia virus (M-MuLV), and viruses containing mutations which block the integration reaction are not capable of replicating. Mutations affecting either the cis-acting sequences at the termini of the viral DNA (4, 12) or the trans-acting retroviral integrase function (5, 13, 17) have been found to block integration and, therefore, replication. Mutant viruses deficient in the IN function have been studied in the most detail; these viruses can synthesize viral DNA normally, but they do not efficiently establish that DNA as a provirus and do not efficiently express it to give rise to progeny. Analysis of the unintegrated DNA formed by such IN-minus viruses has shown that the termini of the viral DNA are not detectably trimmed but rather remain blunt and full length (15, 16). Thus, all IN
process.
To determine the fate of viral genomes with an alteration in a DNA terminus, we examined the preintegrative DNAs of two M-MuLV mutants. Mutant d18272-4 contains a 4-bp deletion removing bases 8 to 11 of the inverted repeat and retains the 7 terminal bp intact (Fig. 1). Mutant dl8269-7 contains a 7-bp deletion in the U3 inverted repeat region; this deletion removes bases 5 to 11 of the inverted repeat, counting from the edge of U3, leaving only the 4 terminal bp intact. Mutant dl8269-7 is replication defective, while mutant dl8272-4 is viable. The construction and characterization of the phenotype of these two mutants will be reported in detail elsewhere (lla). The ends of unintegrated viral DNA produced by dl8269-7 and dl8272-4 were analyzed by using a modification (15) of the genomic sequencing method (2). In this procedure, confluent monolayers of Rat-2 cells (approximately 5 x 106 cells in 150-mm-diameter dishes) were infected with virus stocks harvested from normal rat kidney cells producing dl8269-7, d18272-4, or wild-type virus. The concentrations of the mutant viruses used in these infections were about 10-fold lower than that of the wild type, as judged by reverse transcriptase assays. Low-molecular-weight DNA was isolated from these cells 20 h postinfection (10). The DNAs were cleaved with restriction enzymes that cut 50 to 150 bp from the tips of linear DNA, purified, suspended in
* Corresponding author. t Present address: Department of Microbiology and Immunology, University of California, San Francisco, CA 94143.
5092
dl
NOTES
VOL. 66, 1992
M-MULV
d18269-7
CLAEVAGE
INEGATIO >
AATGAAAGACCCCACCTGTAGGTTT * -
+
TT4CTTTCTGGGGTGGACATCCAAA..
+ AATGAAA
CCACCTGTAGGTTT.. TACCCAAA. G 8272-4TCTTT
AATG
TT4C
_
CCACCTGTAGGTTT:. . GGTGGACATCCAAA
5093
NJ
A~~~EA
A C
G
n,
T
.+ I +
FIG. 1. Sequences at the U3 edge of viruses and phenotypes induced by the mutations. Stippled boxes indicate the sequences deleted from the mutant genomes. The arrow represents the site at which the viral DNA is cleaved by the integrase. Cleavage denotes the ability of viral DNA containing this mutation to be cleaved by the integrase; integration denotes the ability of viral DNA containing the indicated mutation to integrate and replicate in vivo.
CIRCLE JUNCTIONS
80
nt
78
776
do _
s
_, ,L 1_.
*t
sequencing gel loading buffer containing 80% formamide, heated to 85°C, and separated on a 10% polyacrylamide gel containing 7 M urea. Following separation, the DNA was electroblotted onto GeneScreen (NEN) paper at 380 mA for 1 h. Filters were exposed to short-wave UV light to fix the transferred DNA and prehybridized in buffer (0.5 M sodium phosphate [pH 7.2], 7% sodium dodecyl sulfate, 0.25 M NaCl, 1% bovine serum albumin, 5 ,ug of polyribocytidine per ml). Hybridization (20 h, 42°C) was carried out in the same buffer, using oligonucleotides labeled by the addition of radioactive cytosine homopolymer to the 3' end. To determine the ability of the U3 region of the wild-type and mutant viruses to be trimmed by the IN function, the DNAs were cleaved with DdeI, and blots were probed with an oligonucleotide (5'-GGTGGACATCCAAACCG-3') recognizing the minus strand of the U3 region, the strand containing the 3' OH terminus of the viral DNA. The sizes of the DNAs detected were determined by comparison with sequencing ladders of M13 DNA as described previously (15). The bulk of the 3' ends of the wild-type DNA was cleaved, as indicated by the appearance of a fragment of 78 nt as the major product, with only a small amount of the uncleaved DNA remaining, indicated by a fragment of 80 nt (Fig. 2). The 3' end of the viable mutant d18272-4 was also successfully cleaved by IN; for this mutant, all of the products were shorter by 4 nt because of the presence of the deletion. The predominant product was a 74-nt fragment, with only a trace of the uncleaved 76-nt DNA detectable. Thus, although the inverted repeat sequence was altered in this mutant, the 3' end could still be trimmed by IN to permit normal integration and replication. The 3' end of the defective mutant d18269-7, in contrast, was not efficiently cleaved (Fig. 2). The major product detected was a 73-nt fragment, corresponding to the full-length DNA of the mutant; there was only a trace of a trimmed 71-nt fragment. These results suggest that the U3 sequence of mutant d18269-7 was not properly recognized by the IN protein during the trimming process, the first detectable step of integration reaction. It should be noted that the magnitude of the overall defect in the replication of the mutant (about 100-fold; data not shown) is greater than the defect in cutting (about 10-fold), suggesting that the subsequent strand transfer step may also be affected by the mutation. The total amount of the mutant viral DNAs detected in these assays was roughly in accord with the lower levels of virus used in the infections, suggest-
;:-
*
w *
*
.
4
.
LTR TERMINI
~~\71
X
4
FIG. 2. Analysis of the 3' ends of the U3 termini of viral DNAs. DNAs were extracted from Rat-2 cells infected with the indicated virus stocks, digested with DdeI, separated by electrophoresis, blotted, and probed with a labeled oligonucleotide specific for the U3 minus strand. A sequence ladder of single-stranded M13 DNA, generated by synthesis in the presence of each of the four dideoxynucleotides, was used as size markers (lanes A, C, G, and T). Bands labeled circle junctions represent the fragments formed by cutting the two long terminal repeat (LTR) circle junctions with DdeI.
ing that there was no significant block to reverse transcription. To test whether the U5 termini of the mutant viral DNAs were correctly processed, we digested the DNAs with StyI (20 U/,g of total DNA) and blotted and probed them with an oligonucleotide (5'-CTCCTCTGAGTGATTG-3') recognizing the plus strand of the U5 region, the strand containing the right 3' OH end of the viral DNA. The U5 regions of all viral DNAs tested were of the wild-type sequence, retaining the complete inverted repeat. The U5 end of the wild-type DNA, as expected, was efficiently cleaved, as indicated by the appearance of a fragment of 52 nt, with only small amounts of a fragment of 54 nt (Fig. 3). The U5 end of mutant d18272-4 was also substantially cleaved; the sizes of the fragments generated were identical to those of the wild type, as expected from the fact that the mutation is located at the opposite end of the genome. Surprisingly, the U5 end of the defective mutant d18269-7 was not efficiently trimmed (Fig. 3). The major product was a fragment of 54 nt, derived from the full-length genomic DNA; there was only a trace of DNA of 52 nt. The very small extent of cleavage was similar to that seen at the U3 end of this mutant. This striking result was consistently found with use of DNA from independent infections. We conclude that the mutation at the U3 end profoundly blocked cleavage not only at the site of the mutation but also at the distant U5 terminus, even though its sequence was wild type. Thus, two intact termini are apparently required in vivo for the recognition and cleavage of either one by the IN protein. The unexpected effect of a mutation at one end of the
5094
J. VIROL.
NOTES
topologically constrained by noncovalent interactions with IN protein. Examination of the relative ratios of the various DNA fragments detected in the wild-type and mutant infections revealed a significant aberration for the integration-defective mutant d18269-7. In most infections, the U5 and U3 probes detect not only the terminal DNA fragments from the linear DNA genome but also a fragnent containing the long terminal repeat-long terminal repeat junction from the circular DNA formed by the ligation of the two termini. In a wild-type infection, this fragnent is a minor species, representing perhaps 1/10 of the total preintegrative DNA. In cells infected with mutant d18269-7, however, the relative abundance of this DNA fragment is significantly increased, much as is seen in infections with IN-deficient virus (15). This result suggests that when the linear viral DNA is unable to integrate, the circularization of the DNA by nonviral mechanisms is enhanced as a default, and presumably nonproduc-
0-
csa
co
cs co
2
-0
+s.S.~~~~~~~~~~~~~~~~~~~~~~.
*e. * +LsR -s9
tive, pathway. TERMINI
lmg
=
54
nt
FIG. 3. Analysis of the 3' end of the U5 termini of viral DNAs. DNAs were prepared and digested with StyI, blotted, and probed with a labeled oligonucleotide specific for U5 plus strands. A sequence ladder was used to determine the sizes of the DNAs. The band labeled +S.S. is derived from digestion of the plus-strand strong-stop product of the reverse transcription reaction. LTR, long
terminal repeat.
the processing of the other end strongly suggests that the two termini interact during cleavage by the IN protein. A simple model consistent with the observation is that the active configuration of the IN protein for cleavage is a dimer (or higher oligomer) and that each of two subunits must be bound to a recognition site before being activated to cleave either one. The interaction of two IN monomers with DNA may induce a conformational change in the complex that is required for the efficient cutting of the viral DNA. An alternative model is that IN binding to DNA might be cooperative: binding of IN to one end of the DNA might stabilize the interaction of the other subunit with the other end, promoting the overall reaction. Whether dimerization of IN precedes or follows DNA binding is not clear. In either case, it seems likely that IN proteins must be bound to both ends simultaneously at some point in time, in order to communicate the presence of the DNA sequence at one end to activate cleavage of the other end. It therefore seems likely that the IN protein may hold the two termini together at least transiently, to form a large circular DNA in the infected cell, much as the adenovirus terminal protein is thought to hold the ends of the adenoviral genome together in the virion (14). This structure presumably would facilitate the concerted joining of the two termini to the host DNA during the integration reaction. Although the structure of the retroviral precursor to the integrated proviral DNA is a linear molecule, it may be that the DNA is
genome on
This work was supported by funds from PHS grant CA30488 from the National Institutes of Health. REFERENCES 1. Brown, P. O., B. Bowerman, H. E. Varmus, and J. M. Bishop. 1989. Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral integrase protein. Proc. Natl. Acad. Sci. USA 86:2525-2529. 2. Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995. 3. Cobrinik, D., R Katz, R. Terry, A. M. Skalka, and J. Leis. 1987. Avian sarcoma and leukosis viruspol-endonuclease recognition of the tandem long terminal repeat junction: minimum site required for cleavage is also required for viral growth. J. Virol. 61:1999-2008. 4. Colicelli, J., and S. P. Goff. 1985. Mutants and pseudorevertants of Moloney murine leukemia virus with alterations at the integration site. Cell 42:573-580. 5. Donehower, L. A., and H. E. Varmus. 1984. A mutant murine leukemia virus with a single missense codon in pol is defective in a function affecting integration. Proc. Natl. Acad. Sci. USA 81:6461-6465. 6. Fujiwara, T., and R. Craigie. 1989. Integration of mini-retroviral DNA: a cell-free reaction for biochemical analysis of retroviral integration. Proc. Natl. Acad. Sci. USA 86:3065-3069. 7. Fujiwara, T., and K. Mizuuchi. 1988. Retroviral DNA integration: structure of an integration intermediate. Cell 54:497-504. 8. Goff, S. P. 1990. Integration of retroviral DNA into the genome of the infected cell. Cancer Cells 2:172-178. 9. Grandgenett, D. P., and S. R. Mumm. 1990. Unraveling retrovirus integration. Cell 60:3-4. 10. Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-371. 11. Katzman, M., R. A. Katz, A. M. Skalka, and J. Leis. 1989. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J. Virol. 63:5319-5327. 11a.Murphy, J. E., and S. P. Goff. Unpublished data. 12. Panganiban, A. T., and H. M. Temin. 1983. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature (London) 306:155-160. 13. Panganiban, A. T., and H. M. Temin. 1984. The retrovirus pol gene encodes a product required for DNA integration: identification of a retroviral int locus. Proc. Natl. Acad. Sci. USA 81:7885-7889. 14. Robinson, A. J., H. B. Younghusband, and A. J. BelHett. 1973. A circular DNA-protein complex from adenoviruses. Virology
56:54-69.
15. Roth, M. J., P. Schwartzberg, and S. P. Goff. 1989. Structure of
VOL. 66, 1992
the termini of DNA intermediates in the integration of retroviral DNA: dependence on IN function and terminal DNA sequence. Cell 58:47-54. 16. Roth, M. R., P. Schwartzberg, N. Tanese, and S. P. Goff. 1990. Analysis of mutations in the integration function of Moloney murine leukemia virus: effects on DNA binding and cutting. J. Virol. 64:4709-4717.
NOTES
5095
17. Schwartzberg, P., J. Colicelli, and S. P. Goff. 1984. Construction and analysis of deletion mutations in the pol gene of Moloney murine leukemia virus: a new viral function required for productive infection. Cell 37:1043-1052. 18. Varmus, H. E., and P. O. Brown. 1989. Retroviruses, p. 53-108. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
JOURNAL OF VIROLOGY, Aug. 1992, P. 5092-5095
0022-538X/92/085092-04$02.00/0 Copyright C 1992, American Society for Microbiology
A Mutation at One End of Moloney Murine Leukemia Virus DNA Blocks Cleavage of Both Ends by the Viral Integrase In Vivo JOHN E. MURPHYt AND STEPHEN P. GOFF*
Department of Biochemistry and Molecular Biophysics, Columbia University College of Physicians and Surgeons, New York, New York 10032 Received 28 August 1991/Accepted 29 April 1992
The integration of retroviral DNA proceeds through two steps: trimming of the termini to expose new 3' OH ends, and the transfer of those ends to the phosphates of target DNA. We have examined the ability of the Moloney murine leukemia virus integrase protein (IN) to trim the termini of the preintegrative DNA of mutant viruses with alterations in the U3 inverted repeat. The mutant terminus of one replication-defective viral DNA, containing a 7-bp deletion in the U3 inverted repeat, was not trimmed to produce the normal recessed end. Remarkably, the other terminus of this mutant DNA was also not trimmed, even though its sequence is wild type. This finding suggests that the IN protein requires the presence of two good ends before becoming properly activated to trim either one. mutations examined to date have been found to block the first step in the integration process. The effects of several mutations in the cis-acting inverted repeat regions have also been analyzed (3, 4, 12). Analysis of a number of viable viruses with mutations in the inverted repeats show that there is considerable flexibility in the position of the endonucleolytic cleavage, in that variants have been generated such that 1, 2, or 4 nucleotides (nt) are trimmed from the DNA without effect on the subsequent integration. These studies led to the conclusion that the site at which the viral DNA is cleaved by IN is always identical to the site at which the virus is joined to the host DNA (4, 15). Although inviable mutants of M-MuLV with deletions in the inverted repeats exist, the stage in the reaction at which these mutants are blocked in vivo has not been identified. In principle, these mutants could be blocked at either the trimming or joining
Immediately after infection of a cell, retroviruses carry out two reactions which are hallmarks of their unusual life cycle: the viral RNA genome is reverse transcribed into DNA, and this DNA is subsequently integrated into the host genome (for reviews, see references 8, 9, and 18). The integration reaction is now understood in some detail through biochemical and genetic analyses and is divided into two stages. In the first step, the full-length blunt-ended linear DNA, the product of reverse transcription, is trimmed by the endonuclease activity of the viral integrase (IN). This protein, brought into the cell inside the virion particle, cleaves two bases from the 3' ends of each strand to produce recessed 3' OH ends (11, 15). In the second step, the two newly formed 3' OH ends of the viral DNA are transferred to phosphates of the target DNA, releasing 3' OH ends at breaks in the target DNA (1, 6, 7). The two termini are joined to the target DNA at relative positions displaced by a small number of nucleotides, resulting in the generation of short gaps that flank the viral DNA. It is presumed that host functions are responsible for repair of the gaps, removal of unpaired bases, and ligation of the breaks in the DNA. The integration of the newly synthesized viral DNA genome into the host DNA is an essential part of the life cycle of Moloney murine leukemia virus (M-MuLV), and viruses containing mutations which block the integration reaction are not capable of replicating. Mutations affecting either the cis-acting sequences at the termini of the viral DNA (4, 12) or the trans-acting retroviral integrase function (5, 13, 17) have been found to block integration and, therefore, replication. Mutant viruses deficient in the IN function have been studied in the most detail; these viruses can synthesize viral DNA normally, but they do not efficiently establish that DNA as a provirus and do not efficiently express it to give rise to progeny. Analysis of the unintegrated DNA formed by such IN-minus viruses has shown that the termini of the viral DNA are not detectably trimmed but rather remain blunt and full length (15, 16). Thus, all IN
process.
To determine the fate of viral genomes with an alteration in a DNA terminus, we examined the preintegrative DNAs of two M-MuLV mutants. Mutant d18272-4 contains a 4-bp deletion removing bases 8 to 11 of the inverted repeat and retains the 7 terminal bp intact (Fig. 1). Mutant dl8269-7 contains a 7-bp deletion in the U3 inverted repeat region; this deletion removes bases 5 to 11 of the inverted repeat, counting from the edge of U3, leaving only the 4 terminal bp intact. Mutant dl8269-7 is replication defective, while mutant dl8272-4 is viable. The construction and characterization of the phenotype of these two mutants will be reported in detail elsewhere (lla). The ends of unintegrated viral DNA produced by dl8269-7 and dl8272-4 were analyzed by using a modification (15) of the genomic sequencing method (2). In this procedure, confluent monolayers of Rat-2 cells (approximately 5 x 106 cells in 150-mm-diameter dishes) were infected with virus stocks harvested from normal rat kidney cells producing dl8269-7, d18272-4, or wild-type virus. The concentrations of the mutant viruses used in these infections were about 10-fold lower than that of the wild type, as judged by reverse transcriptase assays. Low-molecular-weight DNA was isolated from these cells 20 h postinfection (10). The DNAs were cleaved with restriction enzymes that cut 50 to 150 bp from the tips of linear DNA, purified, suspended in
* Corresponding author. t Present address: Department of Microbiology and Immunology, University of California, San Francisco, CA 94143.
5092
dl
NOTES
VOL. 66, 1992
M-MULV
d18269-7
CLAEVAGE
INEGATIO >
AATGAAAGACCCCACCTGTAGGTTT * -
+
TT4CTTTCTGGGGTGGACATCCAAA..
+ AATGAAA
CCACCTGTAGGTTT.. TACCCAAA. G 8272-4TCTTT
AATG
TT4C
_
CCACCTGTAGGTTT:. . GGTGGACATCCAAA
5093
NJ
A~~~EA
A C
G
n,
T
.+ I +
FIG. 1. Sequences at the U3 edge of viruses and phenotypes induced by the mutations. Stippled boxes indicate the sequences deleted from the mutant genomes. The arrow represents the site at which the viral DNA is cleaved by the integrase. Cleavage denotes the ability of viral DNA containing this mutation to be cleaved by the integrase; integration denotes the ability of viral DNA containing the indicated mutation to integrate and replicate in vivo.
CIRCLE JUNCTIONS
80
nt
78
776
do _
s
_, ,L 1_.
*t
sequencing gel loading buffer containing 80% formamide, heated to 85°C, and separated on a 10% polyacrylamide gel containing 7 M urea. Following separation, the DNA was electroblotted onto GeneScreen (NEN) paper at 380 mA for 1 h. Filters were exposed to short-wave UV light to fix the transferred DNA and prehybridized in buffer (0.5 M sodium phosphate [pH 7.2], 7% sodium dodecyl sulfate, 0.25 M NaCl, 1% bovine serum albumin, 5 ,ug of polyribocytidine per ml). Hybridization (20 h, 42°C) was carried out in the same buffer, using oligonucleotides labeled by the addition of radioactive cytosine homopolymer to the 3' end. To determine the ability of the U3 region of the wild-type and mutant viruses to be trimmed by the IN function, the DNAs were cleaved with DdeI, and blots were probed with an oligonucleotide (5'-GGTGGACATCCAAACCG-3') recognizing the minus strand of the U3 region, the strand containing the 3' OH terminus of the viral DNA. The sizes of the DNAs detected were determined by comparison with sequencing ladders of M13 DNA as described previously (15). The bulk of the 3' ends of the wild-type DNA was cleaved, as indicated by the appearance of a fragment of 78 nt as the major product, with only a small amount of the uncleaved DNA remaining, indicated by a fragment of 80 nt (Fig. 2). The 3' end of the viable mutant d18272-4 was also successfully cleaved by IN; for this mutant, all of the products were shorter by 4 nt because of the presence of the deletion. The predominant product was a 74-nt fragment, with only a trace of the uncleaved 76-nt DNA detectable. Thus, although the inverted repeat sequence was altered in this mutant, the 3' end could still be trimmed by IN to permit normal integration and replication. The 3' end of the defective mutant d18269-7, in contrast, was not efficiently cleaved (Fig. 2). The major product detected was a 73-nt fragment, corresponding to the full-length DNA of the mutant; there was only a trace of a trimmed 71-nt fragment. These results suggest that the U3 sequence of mutant d18269-7 was not properly recognized by the IN protein during the trimming process, the first detectable step of integration reaction. It should be noted that the magnitude of the overall defect in the replication of the mutant (about 100-fold; data not shown) is greater than the defect in cutting (about 10-fold), suggesting that the subsequent strand transfer step may also be affected by the mutation. The total amount of the mutant viral DNAs detected in these assays was roughly in accord with the lower levels of virus used in the infections, suggest-
;:-
*
w *
*
.
4
.
LTR TERMINI
~~\71
X
4
FIG. 2. Analysis of the 3' ends of the U3 termini of viral DNAs. DNAs were extracted from Rat-2 cells infected with the indicated virus stocks, digested with DdeI, separated by electrophoresis, blotted, and probed with a labeled oligonucleotide specific for the U3 minus strand. A sequence ladder of single-stranded M13 DNA, generated by synthesis in the presence of each of the four dideoxynucleotides, was used as size markers (lanes A, C, G, and T). Bands labeled circle junctions represent the fragments formed by cutting the two long terminal repeat (LTR) circle junctions with DdeI.
ing that there was no significant block to reverse transcription. To test whether the U5 termini of the mutant viral DNAs were correctly processed, we digested the DNAs with StyI (20 U/,g of total DNA) and blotted and probed them with an oligonucleotide (5'-CTCCTCTGAGTGATTG-3') recognizing the plus strand of the U5 region, the strand containing the right 3' OH end of the viral DNA. The U5 regions of all viral DNAs tested were of the wild-type sequence, retaining the complete inverted repeat. The U5 end of the wild-type DNA, as expected, was efficiently cleaved, as indicated by the appearance of a fragment of 52 nt, with only small amounts of a fragment of 54 nt (Fig. 3). The U5 end of mutant d18272-4 was also substantially cleaved; the sizes of the fragments generated were identical to those of the wild type, as expected from the fact that the mutation is located at the opposite end of the genome. Surprisingly, the U5 end of the defective mutant d18269-7 was not efficiently trimmed (Fig. 3). The major product was a fragment of 54 nt, derived from the full-length genomic DNA; there was only a trace of DNA of 52 nt. The very small extent of cleavage was similar to that seen at the U3 end of this mutant. This striking result was consistently found with use of DNA from independent infections. We conclude that the mutation at the U3 end profoundly blocked cleavage not only at the site of the mutation but also at the distant U5 terminus, even though its sequence was wild type. Thus, two intact termini are apparently required in vivo for the recognition and cleavage of either one by the IN protein. The unexpected effect of a mutation at one end of the
5094
J. VIROL.
NOTES
topologically constrained by noncovalent interactions with IN protein. Examination of the relative ratios of the various DNA fragments detected in the wild-type and mutant infections revealed a significant aberration for the integration-defective mutant d18269-7. In most infections, the U5 and U3 probes detect not only the terminal DNA fragments from the linear DNA genome but also a fragnent containing the long terminal repeat-long terminal repeat junction from the circular DNA formed by the ligation of the two termini. In a wild-type infection, this fragnent is a minor species, representing perhaps 1/10 of the total preintegrative DNA. In cells infected with mutant d18269-7, however, the relative abundance of this DNA fragment is significantly increased, much as is seen in infections with IN-deficient virus (15). This result suggests that when the linear viral DNA is unable to integrate, the circularization of the DNA by nonviral mechanisms is enhanced as a default, and presumably nonproduc-
0-
csa
co
cs co
2
-0
+s.S.~~~~~~~~~~~~~~~~~~~~~~.
*e. * +LsR -s9
tive, pathway. TERMINI
lmg
=
54
nt
FIG. 3. Analysis of the 3' end of the U5 termini of viral DNAs. DNAs were prepared and digested with StyI, blotted, and probed with a labeled oligonucleotide specific for U5 plus strands. A sequence ladder was used to determine the sizes of the DNAs. The band labeled +S.S. is derived from digestion of the plus-strand strong-stop product of the reverse transcription reaction. LTR, long
terminal repeat.
the processing of the other end strongly suggests that the two termini interact during cleavage by the IN protein. A simple model consistent with the observation is that the active configuration of the IN protein for cleavage is a dimer (or higher oligomer) and that each of two subunits must be bound to a recognition site before being activated to cleave either one. The interaction of two IN monomers with DNA may induce a conformational change in the complex that is required for the efficient cutting of the viral DNA. An alternative model is that IN binding to DNA might be cooperative: binding of IN to one end of the DNA might stabilize the interaction of the other subunit with the other end, promoting the overall reaction. Whether dimerization of IN precedes or follows DNA binding is not clear. In either case, it seems likely that IN proteins must be bound to both ends simultaneously at some point in time, in order to communicate the presence of the DNA sequence at one end to activate cleavage of the other end. It therefore seems likely that the IN protein may hold the two termini together at least transiently, to form a large circular DNA in the infected cell, much as the adenovirus terminal protein is thought to hold the ends of the adenoviral genome together in the virion (14). This structure presumably would facilitate the concerted joining of the two termini to the host DNA during the integration reaction. Although the structure of the retroviral precursor to the integrated proviral DNA is a linear molecule, it may be that the DNA is
genome on
This work was supported by funds from PHS grant CA30488 from the National Institutes of Health. REFERENCES 1. Brown, P. O., B. Bowerman, H. E. Varmus, and J. M. Bishop. 1989. Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral integrase protein. Proc. Natl. Acad. Sci. USA 86:2525-2529. 2. Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995. 3. Cobrinik, D., R Katz, R. Terry, A. M. Skalka, and J. Leis. 1987. Avian sarcoma and leukosis viruspol-endonuclease recognition of the tandem long terminal repeat junction: minimum site required for cleavage is also required for viral growth. J. Virol. 61:1999-2008. 4. Colicelli, J., and S. P. Goff. 1985. Mutants and pseudorevertants of Moloney murine leukemia virus with alterations at the integration site. Cell 42:573-580. 5. Donehower, L. A., and H. E. Varmus. 1984. A mutant murine leukemia virus with a single missense codon in pol is defective in a function affecting integration. Proc. Natl. Acad. Sci. USA 81:6461-6465. 6. Fujiwara, T., and R. Craigie. 1989. Integration of mini-retroviral DNA: a cell-free reaction for biochemical analysis of retroviral integration. Proc. Natl. Acad. Sci. USA 86:3065-3069. 7. Fujiwara, T., and K. Mizuuchi. 1988. Retroviral DNA integration: structure of an integration intermediate. Cell 54:497-504. 8. Goff, S. P. 1990. Integration of retroviral DNA into the genome of the infected cell. Cancer Cells 2:172-178. 9. Grandgenett, D. P., and S. R. Mumm. 1990. Unraveling retrovirus integration. Cell 60:3-4. 10. Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-371. 11. Katzman, M., R. A. Katz, A. M. Skalka, and J. Leis. 1989. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J. Virol. 63:5319-5327. 11a.Murphy, J. E., and S. P. Goff. Unpublished data. 12. Panganiban, A. T., and H. M. Temin. 1983. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature (London) 306:155-160. 13. Panganiban, A. T., and H. M. Temin. 1984. The retrovirus pol gene encodes a product required for DNA integration: identification of a retroviral int locus. Proc. Natl. Acad. Sci. USA 81:7885-7889. 14. Robinson, A. J., H. B. Younghusband, and A. J. BelHett. 1973. A circular DNA-protein complex from adenoviruses. Virology
56:54-69.
15. Roth, M. J., P. Schwartzberg, and S. P. Goff. 1989. Structure of
VOL. 66, 1992
the termini of DNA intermediates in the integration of retroviral DNA: dependence on IN function and terminal DNA sequence. Cell 58:47-54. 16. Roth, M. R., P. Schwartzberg, N. Tanese, and S. P. Goff. 1990. Analysis of mutations in the integration function of Moloney murine leukemia virus: effects on DNA binding and cutting. J. Virol. 64:4709-4717.
NOTES
5095
17. Schwartzberg, P., J. Colicelli, and S. P. Goff. 1984. Construction and analysis of deletion mutations in the pol gene of Moloney murine leukemia virus: a new viral function required for productive infection. Cell 37:1043-1052. 18. Varmus, H. E., and P. O. Brown. 1989. Retroviruses, p. 53-108. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
