Journal o/ Biorec/inolog)~. 18 (1991) 0 1991 Elsevier Science Publishers ADONIS 016816569100070D

BIOTEC

41-54 B.V. 0168-1656/91/$03.50

41

00588

A new human growth hormone production process using a recombinant Bacillus subtilis strain Elisabetta Franchi ‘, Federico Maisano ‘, Silvia Astrua Testori I, Giuliano Galli ‘, Salvatore Toma ‘, Luca Parente *, Francesca de Ferra ’ and Guido Grandi ’ ’ Eniricerche (Received

S.p.A.,

Milan,

Italy

2 May

1990;

revision

aud ’ Sclauo

S.p.A..

Siena. Italy

accepted

12 August

1990)

Summary We constructed a series of hybrid plasmids which directed the synthesis of different human growth hormone (hGH) precursor sequences in Bacillus subtilis. In addition to the 191 amino acids of the hormone, the precursors had in common an amino-terminal extension characterized by the presence of a methionine at position 1 and of the tetrapeptide Ile-Glu-Gly-Arg preceding the first residue (Phe) of hGH. The sequence between the methionine and the tetrapeptide was specific for each precursor and, because of the presence of charged residues, conferred particular properties to the molecules. Long homopolymeric tail-containing precursors such as MRRRRRRIILM-IEGR appeared insoluble whereas shorter sequences of the type MRR-IEGR and MEELM-IEGR augmented the solubility of the precursors with respect to Met-hGH. The soluble precursors could be easily purified from the bulk proteins taking advantage of the charged residues present on the N-terminal tail. After purification, the natural hGH was obtained by treating the precursors with the protease Factor Xa which cleaves after the arginine residue of the tetrapeptide IEGR. . A protocol for the production and purification of authentic hGH from a strain expressing one of these soluble precursors is reported. Human growth hormone;

Correspondence Milan. Italy.

10: G. Grandi,

Bacillus

subtilis;

Eniricerche

S.p.A.,

Factor Xa; Purification

Via

F. Maritano,

26 San Donato

Milanese

20097

42

Introduction Human growth hormone (hGH) is a 191 amino acid long protein. the complex physiological role of which is essential for the harmonious development of the human body. Purified hGH has been used successfully in the treatment of hypopituitary dwarfism, and its therapeutical use for other disorders such as bone fractures, bleeding ulcers and burns is foreseeable in the future (Hintz and Rosenfeld. 1984). Because of its species specificity, the human pituitary gland has been the only source of hGH before the advent of recombinant DNA technology. Methionyl-hGH (Met-hGH) has first been produced in Escherichia co/i (Goeddel et al., 1979) and, since then, many other examples of hGH production via genetic engineering have been published (Ikehara et al., 1984; Hsiung et al., 1986; Dalboge et al.. 1987; Chang et al., 1987; Kato et al., 1987). In particular, since the mature form of the natural hormone lacks the methionine at the N-terminus, methods have been developed for the production of recombinant hGH with native-like sequence. These methods are based either on the in vitro enzymatic removal of N-terminal tails of appropriately designed sequence, or on the construction of hybrid molecules where the hGH sequence is linked to a secretion signal sequence (leader peptide). This sequence promotes the export of the hybrid across the membrane and is precisely removed by a membrane-associated leader-peptidase (for a review see Randall et al., 1987). Production of recombinant hGH has been reported mostly from E. coli cells, while recently secretion of authentic hGH has been obtained from Bacillus subtilis (Nakayama et al., 1987) and Pseudomonas (Gray et al., 1984) recombinant strains. In this paper we report the cloning in B. subtilis of a series of N-terminus-tailed hGH precursors designed to be expressed at high level and in a soluble form. The tails of the precursors contain (a) the sequence recognized by the specific protease Factor Xa and (b) amino acid residues which allow the easy purification of the precursors from the cell proteins. Once the precursors are purified, authentic human growth hormone is obtained taking advantage of the specific proteolytic cleavage of Factor Xa and of the different chromatographic behaviour of the hormone with respect to the precursors and the residual contaminants present in the precursor preparations. A protocol for the production and purification of authentic hGH from a strain expressing one of these precursors is reported.

Materials and Methods Bacterial strains and transformation B. subtilis strain SMS118 (leu, PyrDl, npr -, spr -) derived from SMS108 (Toma et al., 1986) was grown in liquid VY medium or on solid Schaeffer’s sporulation medium (Schaeffer et al., 1965). B. subtilis competent cells were prepared according to Dubnau and Davidoff-Abelson (1971) and transformed as described by Contente

43

and Dubnau (1979). E. coli 71/18 [A(lac-proAB), thi, supE, F’, proAB, Ia0 ZAM15], E. coli JM83 [ara, (lac-proAB), rpsL( = strA), 4 80, lucZAMl5] and E. coli JMlOl [supE, thi, A(luc-proAB), F’, traD36, proAB, lucZ~ZAM15] were grown in LB medium and transformation was performed as described (Mandel and Higa, 1970). Antibiotics in the selective media were used at the following concentrations: ampicillin (Ap) 100 pg ml-‘, chloramphenicol (Cm) 5 pg ml-’ and 20 pg ml-’ for B. subtilis and E. coli, respectively. Chemicals and enzymes All analytical grade chemicals were purchased from Merck AG, (Darmstadt, F.R.G.). For gel electrophoresis the reagents were purchased from Bio-Rad (Richmond, CA). Restriction endonucleases EcoRI and HijldIII, T4 DNA ligase, T4 polynucleotide kinase, pUC sequencing kit, isopropyl-P-D-thiogalactoside (IPTG) and 5bromo4-chloro-3-indolyl-P-D-galactoside (X-gal) were purchased from Boehringer Mannheim while the enzymes FlzuDII and Mung bean nuclease were supplied by New England Biolabs. All enzymes were used following the manufacturers’ instructions. DNA sequencing DNA sequence analysis was performed using the modified terminator method of Sanger (Hattori and Sakaki, 1986).

dideoxy

chain

Oligonucleotide synthesis Oligonucleotides were synthesized by the solid-phase phosphoramidites method using a Beckman System One DNA Synthesizer. Oligonucleotides were purified by preparative gel electrophoresis on a 8-20s acrylamide/7 M urea gel and subsequently desalted by gel filtration on a Sephadex G-50 column equilibrated with water and resuspended in TEAB (10 mM N(CH,CH20H), - 10 mM NaHCO,, pH 9.0). Plasmids and plasmid constructions Plasmids containing the hGH cDNA derived from human pituitary gland were already described (Grandi et al., 1986). Plasmids pUC8 and pUC13 (Yanisch-Perron et al., 1985) were purchased from Bethesda Research Laboratories and Boehringer Mannheim, respectively. Plasmid pSM214 is a puBll0 (McKenzie et al., 1986) derivative shuttle vector created in our laboratory, carrying ampicillin, kanamycin and chloramphenicol resistance selectable markers (Velati Bellini et al., 1988). For pSM215 construction, the pSM212 EcoRI-Hind111 fragment harbouring the Met-hGH coding sequence was inserted into the EcoRI-HirzdIII site of pSM214.

44

Plasmid pSM245, having the tetrapeptide Ile-Glu-Gly-Arg (IEGR) hGH sequence, was constructed as follows. EcoRI/HindIII-digested ligated in a single step to the synthetic DNA fragment

fused to the pUC8 was

ILeGluGLyArg S'AATTCTTATGATCGAGGGTAGG GAATACTAGCTCCCATCC EcgRI site

and to the entire hGH structural gene having a blunt end at its 5’ site and a Hi,tdIII protruding terminus at the end of the gene. E. coli 71/18 transformants were selected for Ap resistance on plates supplemented with IPTG and X-gal. From one transformant clone pSM242 was isolated. The EcoRI-Hind111 fragment isolated from this intermediate was ligated to pSM214 after its digestion with EcoRI and HirrdIII. The ligation mixture was used to transform B. subtilis SMS118 competent cells selecting for Cm resistance. For the construction of pSM250 the synthetic DNA fragment ArgArgArgArgArgArg 5'AATTCTTATGCGTAGACGTCGCCGACGTAT GAATACGCATCTGCAGCGGCTGCATATTAA EcoRI site &oRI-like ---

site

was inserted into the EcoRI site of plasmid pSM245. Plasmid pSM274 was obtained by two cloning steps. First pSM242 was linearized with EcoRI and subsequently incubated with Mung bean nuclease. The synthetic DNA fragment GluGtu S'AATTCTTATGGAAGAA TTAAGAATACCTTCAA EcoRI site

was then ligated to the linear blunt-ended DNA and E. coli JM83 competent cells were transformed with the ligation mixture selecting for Ap resistance. In so doing, a plasmid was selected in which the sequence AATT was replaced with the synthetic fragment. In the second step, the plasmid intermediate was digested with EcoRI and Hind111 and the fragment harbouring the hGH coding sequence subcloned into the pSM214 vector, obtaining plasmid pSM274. Finally, to obtain plasmid pSM291, the DNA fragment &oRI MetArgArgILEGLUGLYARGPhe --------5'AATTCTTATGCGTAGAATCGAGGGTAGGTTCCCAACCATTCCCTTAT 3' GAATACGCATCTTAGCTCCCATCCAAGGGTTGGTAAGGGAATA -----------growth hormone > CCAGGCTTTTTGACAACGCTATGCTCCG 3' GGTCCGAAAAACTGTTGCGATACGAGGC 5'

human

fnu_DII was fused to the 600 bp FnuDII-Hind111 fragment of pSM209 (Grandi et al., 1986). The fused product was inserted into the EcoRI/HindIII sites of pSM214.

45

Protein extraction and analysis Cells were grown overnight in flasks at 37°C collected by centrifugation and washed twice with TE (1 mM EDTA, 10 mM Tris-HCl, pH 8). For analytical purposes, cells from 10 ml cultures were resuspended in 120 ~1 of 25% sucrose in TE and incubated 45 min at 37°C with 10 ~1 lysozyme at 40 mg ml-‘. The suspension was sonicated to homogeneity and centrifuged in an Eppendorf centrifuge for 10 min at 4°C; 2 yl of the supernatant (soluble fraction) were analyzed either by SDS-PAGE according to Laemmli (1970) or by Western blot (Towbin et al., 1979) using rabbit anti-hGH antiserum. Pellets (insoluble fraction) were solubilized in Sample Buffer (125 mM Tris-HCl, pH 6.8, 20% glycerol; 3% SDS; 3% pmercaptoethanol). For total protein analysis (soluble and insoluble fractions), 100 ~1 of cell lysates obtained after sonication were directly added to 200 ~1 of sample buffer. For preparative purposes, the washed cells from 1 litre culture were resuspended in 15 ml 25% sucrose in TE and disrupted in a French-press apparatus. The suspension was clarified by centrifugation at 17,000 X g for 30 min at 4°C and the supematant (which will be referred to as “the soluble fraction”) used for purification. Protein purification The hGH precursors were first purified by ion-exchange chromatography. The soluble fraction of the cell extracts from 1 litre culture was dialyzed against 50 mM CH,COONa/CH,COOH, pH 6 (buffer A) and loaded on a 23 X 1 cm S-Sepharose fast-flow column (Pharmacia, Sweden), previously equilibrated with buffer A at 4°C. After washing the unbound material with the buffer A at a flow rate of 18 ml h-’ (23 ml cm-* h-’ ), a NaCl gradient going from 0 to 0.25 M in buffer A (total volume 150 ml) was applied to elute hGH precursors. After Factor Xa digestion of the precursors (see below), the natural hGH was purified by chromatographing the reaction mixture under the same conditions. The final hGH purification was achieved by gel filtration chromatography, using a Sephadex G-100 Superfine column (55 X 1.6 cm) equilibrated in 50 mM NH,HCO, (flow rate: 8 ml cm-* h-l). Factor Xa digestion hGH samples were dialyzed against 50 mM Tris-HCl, pH 8; 0.1 mM NaCl; 1 mM CaCl, and digested with Factor Xa. Factor Xa was prepared from bovine blood as already described (Esnouf and Williams, 1962) and activated with Russel’s viper venom immobilized on Sepharose 4B (Nagai and Togersen, 1987). The Factor Xa digestion was carried out at 23°C with an enzyme to substrate ratio of 1 : 100 (wt/wt) for 20 h. Sequence analysis Amino terminal sequence was determined with a System 890M Sequencer (Beckman) using Beckman reagents. Sequence analysis was performed with l-2 nmol of

46

purified proteins and usually for lo-15 cycles. For sequence analysis, hGH precursors were purified on a reverse-phase HPLC Supelcosil LC-308 column from Supelco Inc., using water/acetonitrile gradient in 0.1% trifluoroacetic acid.

The pI of the purified proteins was determined with isoelectrofocusing in immobilized pH gradient using a LKB Multiphor II apparatus and the LKB Immobilines in the pH range 4.5-6.5 (Gianazza et al., 1984). The samples were applied on the surface at the cathodic side of the acrylamide gel and the electrophoretic run was performed at 200 V cm -’ for 15 h. The p1 of each hGH derivative was determined by comparison to the low p1 Calibration Kit from Pharmacia (Sweden). Determination

of protein concentration

Total protein concentration in crude extracts and purified fractions was evaluated with the Bio-Rad protein assay (Bradford, 1976). hGH concentration in the samples was estimated by immuno-dot blot analysis and comparing the intensity of the spots with those ones originated by weighed amounts of standard hGH (Kabi, Sweden). Insoluble fractions were first dissolved in 1% SDS and then diluted to the desired concentration before sample application onto the filter.

Results

Synthesis of hGH derivatives it1 B. subtilis In a recent work we showed that Met-hGH can be intracellularly expressed by B. subti/is cells transformed with plasmid pSM212 (Grandi et al., 1986). Subsequent work indicated that the hormone was partially compartmentalized in inclusion body-like structures. Similar results in terms of ratio between the soluble and insoluble fractions of hGH were obtained when B. subtilis was transformed with pSM215. For the construction of pSM215, the hGH cDNA was transferred from pSM212 to pSM214, a new plasmid vector we found particularly convenient for heterologous expression in B. subtilis (Velati Bellini et al., 1988). In order to increase the solubility of hGH and to design an easy purification scheme for the soluble fraction of the hormone, we modified the hGH coding sequence in plasmid pSM215. In so doing, a series of hGH precursors were obtained having in common the hormonal sequence linked at the N-terminus to the tetrapeptide Be-Glu-Gly-Arg (IEGR), which is recognized by the protease Factor Xa. This protease specifically cuts the precursor peptidic bond after the arginine residue (Nagai and Togersen, 1987). In addition, these precursors varied for the presence or not of stretches of aminoacids located between the start codon and the tetrapeptide, altering the pI of the protein with respect to the bulk of cellular proteins and to the native form of the hormone.

47

To obtain these hGH precursors, a fragment containing the hGH coding region was ligated to a synthetic oligonucleotide specifying the Met-IEGR sequence and cloned in pSM214. To this initial construct (pSM245) three different N-terminal tail-coding sequences were added replacing the initiator methionine codon through ligation with synthetic DNA fragments corresponding to the following polypeptides: Met-Arg-Arg-Arg-Arg-Arg-Arg-Ile-Ile-Leu-Met, Met-Arg-Arg, Met-GluGlu-Leu-Met. The resulting constructs named pSM250, pSM291 and pSM274, respectively, were transfected into B. subtilis competent cells. The total proteins from the recombinant strains together with the soluble and insoluble fractions are shown in Fig. 1. The yield of recombinant modified hGH was similar in all three strains, being more than 5% of the total proteins (see Materials and Methods for protein quantification) and about twice as high as the yield of Met-hGH in pSM215 harbouring strain. While the hGH hybrid molecules containing the longest N-terminal tail (MRRRRRRIILM) were found mostly in the insoluble fraction of the cellular proteins, B. subtilis strains carrying plasmids pSM291 and pSM274, yielded a higher relative fraction of soluble hybrid hGH, from 70 to 80% of the total hGH (Table 1). Subsequent experiments confirmed that longer homopolymeric and charged tails decrease the solubility of the hybrid polypeptides (data not shown). Interestingly, the addition of the shorter N-terminal M-IEGR, MRR-IEGR and MEELM-IEGR extrasequences increased the solubility of the recombinant polypeptide with respect to Met-hGH expressed in B. subtilis, where only less than 55% of the total hGH was present in the soluble fraction (Table 1). hGH precursors were partially purified by ion-exchange chromatography and the N-terminal sequence of the molecules was confirmed by automated sequence analysis. Furthermore, the isoelectric point of the hybrid polypeptides was assessed by analytical isoelectrofocusing electrophoresis in parallel with a sample of hGH with native sequence. The relative difference between the pI values of the hybrid molecules (Table 1) with respect to the native hormone warranted the feasibility of subsequent separation procedures based on charge differences. On this basis we developed the purification scheme described below for the MRR-IEGR-hGH hybrid polypeptide. Purification of methionine-free hGH The purification strategy is based on the charge difference between MRR-IEGRhGH (PI 5.9), the product of its digestion with Factor Xa (p1 5.2) and the bulk of cellular proteins which are less basic than the hybrid polypeptide. The entire procedure is schematized in Fig. 2 and consists of a first fractionation of the extract on a cation-exchange column, where the hybrid MRR-IEGR-hGH binds at pH 6, while most of the cellular proteins are not retained on the column. The precursor is subsequently eluted and cleaved by Factor Xa in solution. The cleavage with the protease is highly efficient and selective, the precursor being almost completely processed after 24 h digestion at room temperature (data not shown). The product of protease digestion (native methionine-free hGH) is sep-

48

. M

b

c

b

.

c.

b

c

b

l

250

215

214

Ca

bC

291

274

MW

B

-45

-31

L

-21.5

. M

b

214

Fig. 1. SDS-PAGE analysis expressing the different hGH protein fraction.

C

.,

b

215

c

.

b

250

c

I

b

274

c

.

b

c

291

(A) and Western blot (B) of protein samples from B. subrilis strains derivatives. (a): total proteins; (b): soluble protein fraction; (c): insoluble M: standard hGH; MW: molecular weights standard in kDa.

49 TABLE

1

Characteristics

of fused

hGH

derivatives

in B. subfilis

Plasmid

Sequence

PI

Solubility

pSM215 pSM245 pSM250 pSM274 pSM291

M-hGH M-IEGR-hGH MRRRRRRIILM-IEGR-hGH MEELM-IEGR-hGH MRR-IEGR-hGH

5.20 5.18 ND 4.85 5.93

55 65 0 80 70

%

The sequence of the hGH derivatives was determined at both DNA and protein level. The percentage the soluble form was estimated by immuno-dot blot analysis (see Materials and Methods). ND: not determined.

TABLE

2

Purification

of hGH

from

1 litre culture

Sample

Total

Crude extract First S-Sepharose Second S-Sepharose Gel filtration

350 10 7.5 6.2

K,:

of

purification

proteins

of B. subfilis (mg)

SMS118 hGH

(pSM191)

strain

%

5 80 90 98

KP

Yield

16 1.12 1.09

100 46 38 34

(%)

factor.

arated from contaminants and the residual undigested precursor by a second cycle of cation-exchange chromatography conducted under conditions identical with those for the first cycle (Figs. 3 and 4).

Factor digestion

Xa

S-sepharose Fast

flow

AAA Purified

hGH

Fig. 2. Purification scheme of methionine-free hGH from B. srrbfilis SMSllS(pSM291). triangles represent contaminant proteins and hGH, respectively. The positively charged extention (tail on top of triangles) is cleaved off by Factor Xa in the reaction tank, changing of recombinant hGH. See text for details.

Circles and N-terminal the pl value

50 0.2 M NaCl I

t

MRR-IEGR-hGH

hGH

Azso

ml Fig. 3. Elution profile of Factor Xa-treated-MRR-IEGR-hGH loaded onto a S-Sepharose column. The Factor Xa digestion was purposely prematurely stopped to show up the different behaviour of native hGH and precursor.

fast-flow retention

Following this purification scheme, more than 90% pure hGH was recovered and the hormone was further purified to 98% homogeneity through gel-filtration chromatography. The overall yield of purified hormone from the combined cycles of chromatography was about 34% (see Table 2) a satisfactory amount considering also the high yield of soluble hGH precursor synthesized in B. subtilis.

Fig. 4. SDS-PAGE of Factor Xa-treated-MRR-IEGR-hGH. The same reaction mixture as in Fig. 3 was resolved on a 12.5% polyacrylamide gel and stained with Coomassie blue. Lane 1, purified MRR-IEGRhGH; lane 2, partially digested MRR-IEGR-hGH; lane 3, standard hGH; lane 4, aliquot of the not retained pick of S-Sepharose fast-flow chromatography (Fig. 3).

51 60

r

0

2

4

6

8

10

12

14

16

18

20

22

24

26

28

30

32

34

Tlme(days)

Fig. 5. Effect of recombinant received 100 pg of r-hGH (-A-),

N-terminal

hGH on weight variation of hypophysectomized 100 pg of standard hGH (-•-) or physiological day for 16 d. (-0-): healthy untreated rats.

female rats. Each rat solution (- * -) every

analysis and biological assay of recombinant hGH produced in B. subtilis

To confirm the specificity of cleavage with factor Xa and the identity of the product, N-terminal sequencing of the purified product of digestion was performed as described in Materials and Methods. The sequence of the first ten amino acids analyzed (Phe-Pro-Thr-Ile-Pro-Leu-Ser-Arg-Leu-Phe) was identical to the native hormone sequence. To further assess the biological properties of the recombinant hormone produced and purified from B. subtilis, 35 mg of recombinant hGH were tested in vivo for their ability to increase body weight of hypophysectomized rats in parallel with purified natural hGH (Li, 1977). As shown in Fig. 5, no detectable difference was found between the biological activity of the recombinant hormone and the natural hGH. Discussion A common problem in the production of heterologous proteins from host/vector expression systems is the fractionation of the desired polypeptide in insoluble aggregates which require subsequent biochemical procedures in order to obtain the native structure and physiological properties. In this communication we described an attempt to design specific alterations of the polypeptide sequence of human growth hormone in order to meet three essential requirements: (a) increased solubility of the modified polypeptide, (b) ease of purification of the soluble hGH derivative and (c) complete removal of the added unnatural sequences to obtain the polypeptide with authentic sequence and with physiological properties equal to the native hormone. The modification of hGH was based on the insertion of N-terminal tails characterized by the presence of (a) the Factor Xa recognition sequence (IEGR) located immediately upstream from the native hGH sequence and (b) different stretches of charged residues.

52

An interesting and rather surprising observation is the variability of precursors solubility, apparently related to the nature of the N-terminal tail. In the host-vector system used for these experiments, we observed an increasing tendency of the hybrid polypeptides to partitioning in insoluble aggregates with increasing lengths of charged homopolymeric tails of the type MRRRRRRIILM-IEGR. On the contrary, the shorter sequences M-IEGR, MRR-IEGR and MEELM-IEGR augmented the solubility of the precursors with respect to methionyl-hGH. Furthermore, these short N-terminal tails alter the p1 of the hormone and therefore allow the use of the easy and highly efficient purification scheme described here. Although it would be interesting to compare our hGH production process with those which make use of secretory systems developed either in E. coli or B. subtilis (Chang et al., 1987; Kato et al., 1987; Nakayama et al., 1987) the data reported in the literature are not sufficient for an accurate comparative analysis. Nevertheless, a great advantage of our method is found in the simplicity of hGH purification. The unusually charged hGH precursor can be easily purified from the bulk proteins with a single ion-exchange chromatography. Furthermore, after Factor Xa cleavage, the chemico-physical properties of hGH drastically change with respect to the precursor. This allows the easy separation of the mature hormone from the precursor and from the residual contaminants by running the digestion product under the same chromatographic conditions used for the precursor purification. The simplicity of the purification scheme, together with the high specificity of Factor Xa and the high levels of pre-hGH expression, makes the process particularly attractive and competitive. The efficient removal of the N-terminal tail by Factor Xa is an indication of the good accessibility of the protease to the cleavage site. This is consistent with the recent data on hGH three-dimensional structure which show that the N-terminus of the hormone is quite exposed to the solvent and not involved in important intramolecular interactions (Cunningham et al., 1989). While in this communication we reported the purification of one of the hybrid derivatives, the same procedure has been applied successfully and with comparable yields to the other constructs described. All of the hybrid hormones could be cut efficiently by Factor Xa. In principle this method of design, cloning and purification of hybrid polypeptides can be applied to other proteins which tend to be insoluble, are difficult to purify otherwise, or in which the removal of the initiator methionine would be desired in order to maintain a sequence identical to the natural counterpart.

References Bradford, M. (1976) A rapid and sensitive method for quantitation of micrograms quantities of protein utilizing principle of protein-dye binding. Anal. Biochem. 72, 248-254. Chang, N.C., Rey. M., Bochner, B., Heyneker, H. and Gray, G. (1987) High-level secretion of human growth hormone by Escherichia coli. Gene 55, 189-196. Contente, S. and Dubnau, D. (1979) Characterization of plasmid transformation in B. subfilis: kinetic properties and the effect of DNA conformation. Mol. Gen. Genet. 167, 251-258.

53 Cunningham, B.C., Jhurani, P.. Ng. P. and Wells, A. (1989) Receptor and antibody epitopes in human growth hormone identified by homolog-scanning mutagenesis. Science 243, 1330-1336. Dalboge. H., Dalh, H.H.M., Pedersen, J., Hansen, W.J. and Christensen, T. (1987) A novel enzymatic method for production of authentic hGH from an Escherichio co/i produced hGH-precursor. Bio/Technology 5, 161-164. Dubnau, D. and Davidoff-Abelson, R. (1971) Fate of transforming DNA following uptake by competent B. subtilis. 1. Formation and properties of the donor recipient complex. J. Mol. Biol. 56, 209-221. Esnouf. M.P. and Williams, W.J. (1962) The isolation and purification of a bovine plasma-protein which is a substrate for the coagulant fraction of Russel’s viper venom. B&hem. J. 84, 62-71. Gianazza, E., Celentano, F., Dossi, G., Biellqvist, B. and Righetti, P.G. (1984) Preparation of immobilized pH gradients spanning 2-6 pH units with two chamber mixers: evaluation of two experimental approaches. Electrophoresis 5, 88-97. Goeddel, D.V., Heyneker, H.L., Hozumi, T., Arentzen, R., Itakura, K., Yansura, D.G., Ross, M.J., Miozzari, G., Crea, R. and Seeburg, P.H. (1979) Direct expression in Escliericliia co/i of a DNA sequence coding for human growth hormone. Nature 281, 544-548. Grandi, G., Del Bue, M., Cosmina, P., Franchi, E. and Toma, S. (1986) Construction and use of expression vector in B. subtilis. In: Physiological and Genetic Modulation of Product Formation. Proceedings of an International Symposium. Como (Italy) May 81h - 10’h, 105, 147-162. Gray, G.L., McKeown, K.A., Jones, A.J.S., Seeburg, P.H. and Heyneker, H.L. (1984) Pseudommos oemgimsa secretes and correctly processes human growth hormone. Bio/Technology 2, 161-165. Hattori, M. and Sakaki, Y. (1986) Dideoxy sequencing using denaturated plasmid templates. Anal. Biochem. 152, 232-238. Hintz, R.L. and Rosenfeld, R.G. (1984) Impieghi clinici dei preparati sintetici di ormone della crescita. Minuti 4. 25-33. Hsiung. H.M., Mayne, N.C. and Becker, G.W. (1986) High-level expression, efficient secretion and folding of human growth hormone in Escherichio co/i. Bio/Technology 4, 991-995. Ikehara, M., Ohtsuka. E., Tokunaga, T.. Taniyama, Y., Iway, S., Kitano, K., Miyamoto, S., Ohgi, T., Sakuragawa, Y., Fujiyama, K., Ikari, T., Kobayashi, M., Miyake, T., Shibahara, S.. Ono, A., Ueda. T., Tanaka, T., Baba, H., Miki, T., Sakurai, A., Oishi, T., Chisaka, 0. and Matsubara, K. (1984) Synthesis of a gene for human growth hormone and its expression in Escherichia co/i. Proc. Natl. Acad. Sci. U.S.A. 81, 5956-5960. Kato, C., Kobayashi, T., Kudo, T., Furusato, T., Murakami, Y., Tanaka, T., Baba, H., Oishi, T., Ohtsuka, E., Ikehara, M., Yanagida, T., Kato, H., Moriyama, S. and Horikoshi, K. (1987) Construction of an excretion vector and extracellular production of human growth hormone from Escherichia coli. Gene 54, 197-202. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Li, C.H. (1977) Hormonal Proteins and Peptides, Academic Press, New York, pp. 1-41. Mandel, M. and Higa, A. (1970) Calcium-dependent bacteriophage DNA infection. J. Mol. Biol. 53, 159-162. McKenzie, T., Hoshino, T., Tanaka, T. and Sueoka, N. (1986) The nucleotide sequence of pUB110: some salient features in relation to replication and its regulation. Plasmid 15, 93-103. Nagai, K. and Togersen, H.C. (1987) Synthesis and sequence-specific proteolysis of hybrid proteins produced in Escherichio co/i. Methods Enzymol. 153, 461-481. Nakayama, A., Kaivamura, K.. Shimada, ii., Akaoka, A., Mita, I., Honjo, M. and Furutani, Y. (1987) Extracellular production of human growth hormone by a head portion of the prepropeptide derived from Bacillus anyloliquefociens neutral protease in Bacillus subfilis. J. Biotechnol. 5, 171-179. Randall, L.L., Hardy, S.J.S. and Thorn, J.R. (1987) Export of protein: a biochemical view. Annu. Rev. Microbial. 41, 507-541. Schaeffer. P., Miller, J. and Aubert, J.P. (1965) Catabolic repression of bacterial sporulation. Proc. Natl. Acad. Sci. U.S.A. 54, 704-711. Toma, S., Del Bue, M., Pirola, A. and Grandi, G. (1986) nprR1 and nprR2 regulatory regions for neutral preotease expression in Bacillus subrilis. J. Bacterial. 167, 740-743.

54 Towbin. H., Staehlin. T. and Gordon, J. (1979) gels IO niwxellulose sheers: procedure and 4350-4354. Yanisch-Perron. C., Vieira, J. and Messing, J. slrains: nucleotide sequences of the M13mp8 Velali Bellini, A., Russomanno, G. and Grandi. suh~ilis. Proceedings of the FEMS Symposium

Electrophoretic transfer of proteins from polyacrilamide some applications. Proc. NatI. Acad. Sci. U.S.A. 76, (1985) Improved Ml3 phage cloning vectors and host and pUC19 vectors. Gene 33, 103-119. G. (1988) Expression of pertussis toxin subunits in B. Pertussis, Berlin, F.R.G., pp. 43-55.