G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks Michael Reiter ∗ , Anna-Margarita Schötta, Andreas Müller, Hannes Stockinger, Gerold Stanek Institute for Hygiene and Applied Immunology, Center for Pathophysiology, Infectiology and Immunology, Medical University of Vienna, Kinderspitalgasse 15, 1090 Vienna, Austria
a r t i c l e
i n f o
Article history: Received 2 December 2014 Received in revised form 2 February 2015 Accepted 4 February 2015 Available online xxx Keywords: Borrelia Miyamotoi Ixodes Tick PCR
a b s t r a c t A total of 350 ticks collected in Austria were analyzed for the presence of DNA sequences of B. miyamotoi. Three ticks gave positive results in a B. miyamotoi-specific nested PCR. Results were confirmed by sequencing the amplified glpQ gene from the positive samples. Moreover we developed a real-time PCR which unambiguously detected B. miyamotoi in all positive samples. Further genotyping of the samples found 100% identity of the 16S–23S intergenic spacer region with Swedish B. miyamotoi sequences. This is the first detection of the relapsing fever spirochete Borrelia miyamotoi in hard ticks in Austria. The results consolidate the picture of a European-wide distribution of B. miyamotoi and again underscore the need for clinical awareness to clarify possible involvement of this species in human disease. © 2015 Elsevier GmbH. All rights reserved.
Introduction Spirochetes of the genus Borrelia are currently subdivided into two major groups (Geller et al., 2012): the relapsing fever (RF) borreliae, which are harbored and transmitted by the body louse Pediculus corporis (louse borne-RF) or by argasid or soft ticks (tickborne RF), and the spirochetes of the Borrelia burgdorferi sensu lato (sl) complex, which are transmitted by ixodid or hard ticks. The B. burgdorferi sl complex includes the causative agents of Lyme borreliosis (LB) (Barbour et al., 2009), which presents predominantly with manifestations of infection of the skin, nervous system, musculoskeletal system, rarely the heart and other organs, as well as with rare chronic courses of skin, joint and central nervous system involvement (Stanek et al., 2012). Tick-borne RF is mainly characterized by repeated episodes of high fever (Assous and Wilamowski, 2009). There is a third group of borrelial species that are closely related to RF spirochetes but use ixodid ticks as vectors (Barbour et al., 2009). Representatives of this group include B. theileri, B. lonestari and B. miyamotoi (Barbour et al., 2009). Originally isolated from Ixodes persulcatus on the island of Hokkaido, Japan, in 1995 (Fukunaga et al., 1995), B. miyamotoi has been found in hard ticks
∗ Corresponding author. Tel.: +43 1 40160 33024. E-mail address: [email protected] (M. Reiter).
of different species, such as I. scapularis, I. ricinus and I. pacificus (Platonov et al., 2011). The detection of B. miyamotoi in Japan (Fukunaga et al., 1995), in USA (Scoles et al., 2001; Mun et al., 2006) and in Eurasia (Fraenkel et al., 2002; Richter et al., 2003; Fomenko et al., 2010; Hansford et al., 2014) indicates the wide distribution of this species in the northern hemisphere. Analysis of the flagellin gene and 16S rRNA has revealed a closer relationship to other RF borreliae than to Lyme borreliae (Fukunaga and Koreki, 1995; Fukunaga et al., 1995). At the genomic level, RF and Lyme borreliae are easily distinguished by the presence (Lyme borreliae) or absence (RF borreliae) of tandemly repeated 5S and 23S ribosomal genes (Davidson et al., 1992; Schwartz et al., 1992). The highly variable region of the 5S-23S duplication has been extensively used for subtyping B. burgdorferi sl species (Wang et al., 1999). B. miyamotoi lacks this second copy of the ribosomal genes, again demonstrating the closer relationship to other RF borreliae (Fukunaga et al., 1995). Another gene (glpQ) encoding a glycerophosphodiester phosphodiesterase is present only in RF borreliae but not in Lyme borreliae (Schwan et al., 1996; Fraser et al., 1997); this gene has been used for detection of RF borreliae and for specific identification and characterization of B. miyamotoi (Fomenko et al., 2010; Geller et al., 2012; Hansford et al., 2014). A third gene, the intergenic spacer (IGS) between the 16S and 23S genes is present in both Lyme borreliae and RF borreliae and is commonly used for characterization of both groups (Liveris et al., 1995; Bunikis et al., 2004b). Although the IGS exhibits greater diversity in
http://dx.doi.org/10.1016/j.ttbdis.2015.02.002 1877-959X/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS
2
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
B. miyamotoi than in other borreliae it remains a useful locus for genotyping RF borreliae (Bunikis et al., 2004b). The clinical importance of B. miyamotoi is currently under discussion. Although humans might become infected with B. miyamotoi, evidence for causing human disease is currently weak (Hamer et al., 2012; Fonville et al., 2014). Nevertheless, the number of scientific papers and case reports demonstrating association of B. miyamotoi with RF-like and LB-like symptoms in patients is increasing and B. miyamotoi has been identified in ticks in several European countries and in patients (Richter et al., 2003; Platonov et al., 2011; Geller et al., 2012; Hovius et al., 2013; Krause et al., 2013). The aim of the present study was to identify B. miyamotoi in ticks collected in Austria and to develop a rapid and reliable detection method for this species. Materials and methods Ticks Ticks were collected by flagging during spring/summer 2005 in all the federal states of Austria; ticks from Vienna were collected separately in autumn 2013. The 2005 Vienna batch was used up in another study. All ticks were frozen at −20 ◦ C until processing. Altogether, 350 Ixodes ricinus ticks comprising 46 adults (22 females, 24 males), 302 nymphs and 2 larvae were used for the study. DNA extraction from ticks DNA was extracted from the ticks by alkaline lysis (Guy and Stanek, 1991; Rijpkema et al., 1996) or with the DNeasy Blood and Tissue kit (Qiagen, Germany), using a modified protocol. Briefly, ticks were lysed overnight in 180 l ATL buffer and 20 l proteinase K solution at 56 ◦ C while shaking. AL buffer (200 l) was then added, followed by incubation at 70 ◦ C for 10 min. After the addition of 200 l 96% ethanol the mixture was centrifuged at 18,000 × g for 5 min. The remaining steps were as described in the manufacturer’s protocol. A negative extraction control was included with each batch in order to exclude possible cross-contamination during the extraction process. PCR and real-time PCR For the detection of B. miyamotoi, DNA samples extracted from groups of up to 10 ticks were pooled for testing; the ticks in any B. miyamotoi-positive pools were then tested individually. A nested PCR was used as described previously (Fomenko et al., 2010). The master mix contained (final concentrations): 0.4 M each primer, 400 M dNTPs (Solis BioDyne, Estonia), 1.25 u peqGOLD Hot Taq-DNA-Polymerase (PeqLab, Germany), 5 l reaction buffer Y (PeqLab, Germany), 10 l enhancer solution P (PeqLab, Germany), 5 l extracted DNA. Reaction volumes were adjusted to 50 l with PCR-grade water (Sigma–Aldrich, Austria). Primers Q1/Q2 were used for the first round of amplification. The reaction conditions were 95 ◦ C for 5 min, followed by 35 cycles of 95 ◦ C for 30 s, 50 ◦ C for 45 s and 72 ◦ C for 45 s, and a final elongation step of 72 ◦ C for 7 min. Primers Q3/Q4 were used for the second round of amplification and reaction conditions for the nested amplification were the same as for the first round, except that the annealing temperature was 52 ◦ C. A negative control containing PCR-grade water in the PCR master-mix instead of DNA was included in every run to control for possible contamination. The Borrelia rrs–rrlA region was amplified in a nested PCR, as described elsewhere (Bunikis et al., 2004a). The master mix was prepared as above. Primers rrs–rrlA IGS F/rrs–rrlA IGS R were used in the first round of amplification. Reaction conditions were 95 ◦ C
for 7 min, followed by 35 cycles at 95 ◦ C for 45 s, 55.5 ◦ C for 1 min and 72 ◦ C for 45 s, and a final elongation step of 72 ◦ C for 7 min. Primers rrs–rrlA IGS Fn/rrs–rrlA IGS Rn were used for the second round of amplification. Reaction conditions for nested amplification were the same as for the first round. A PCR with primers S1/S2 targeting B. miyamotoi 16S rDNA was run with the following reaction conditions: 95 ◦ C for 5 min, followed by 35 cycles of 95 ◦ C for 30 s, 50 ◦ C for 45 s and 72 ◦ C for 90 s; the final extension step was at 72 ◦ C for 7 min. Portions (5 l) of the reaction product were used as template to generate PCR fragments suitable for cloning. For cloning of B. miyamotoi 16S rDNA, primer pairs Bm16S Fwd A/Bm16S Rev A and Bm16S Fwd B/Bm16S Rev B were used to generate two fragments 620 bp and 762 bp in length, respectively. Reaction conditions were as follows: 95 ◦ C for 5 min, followed by 35 cycles at 95 ◦ C for 30 s, 52 ◦ C for 45 s and 72 ◦ C for 1 min, and a final elongation step at 72 ◦ C for 7 min. For real-time PCR in an Applied Biosystems 7500 Real-Time PCR Cycler, primers and probes were based on sequences available from the National Center for Biotechnology Information (NCBI) (accession numbers GI:253757016, GI:38230732, GI:237866044). A complete match with B. miyamotoi strain LB-2001 (GI:60396860) could not be achieved. The reactions contained 1 l primer/probe mix (ingenetix, Austria), 10 l 2× TaqMan Gene Expression Master Mix (Life Technologies, Austria) and 4 l of tick DNA extract. The reaction volume was adjusted to 20 l with PCR-grade water. The following conditions were used in the 2-step PCR: 95 ◦ C for 10 min, followed by 50 cycles of 95 ◦ C for 15 s and 56 ◦ C for 2 min. For specificity testing, crude DNA extracts of the following strains were used: B. turicatae, B. duttonii, B. hermsii and B. burgdorferi B31. For sensitivity testing, vector pBBmglpQ was purified from E. coli DH5-␣ using a plasmid mini kit (Fisher Scientific, Vienna, Austria) and quantity was determined photometrically. Copy number was calculated from the molecular weight of pBBmglpQ. The extract was then serially diluted and the highest dilution resulted in 0.1 copy of the plasmid within the PCR reaction (Fig. 2). We additionally tested the sensitivity of the assay, when tick-DNA lysates were used instead of water for serial dilution of vector pBBmglpQ. Therefore, the genomic DNA of 15 nymphal I. ricinus ticks was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) as described above. Subsequently all extracts were tested with the real-time PCR assay to ensure they were B. miyamotoi negative. After that all extracts were pooled together and used for the dilution series of the experiment (Fig. 2). Sequences of all primers and probes used in this study are listed in Table 2. Cloning strategies A plasmid mini kit was used to purify the pBluescript KS II+ vector from an overnight culture of E. coli DH5-␣. TA cloning of glpQ The glpQ gene fragment was amplified from one of the tick extractions as described above and purified using a commercially available kit (Qiagen, Germany). The vector was digested with EcoRV (Fisher Scientific, Austria) according to the manufacturer’s instructions. The digested and purified vector was then incubated for 2 h at 72 ◦ C with Taq polymerase (Fisher Scientific, Austria) in the presence of 2 mM dTTP (Solis BioDyne, Estonia). The glpQ fragment was ligated into the resulting T-vector using T4 Ligase (Fisher Scientific, Austria), resulting in vector pBBmglpQ. Subsequently, E. coli DH5-␣ cells were transformed and clones were verified by sequencing (MWG Eurofins, Germany).
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model
ARTICLE IN PRESS
TTBDIS-440; No. of Pages 6
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Cloning of 16S rDNA The 16S rDNA from one of the positive tick samples was pre-amplified using primers S1/S2 (Fukunaga et al., 1996) as described above. From this primary amplicon, fragments Bm16Sa and Bm16Sb were generated as described above. Amplified fragments were digested with BamHI/EcoRI or EcoRI/XhoI, respectively. The two fragments were cloned into pBluescript KS II+ that had been digested with the corresponding enzymes, resulting in vectors pBBm16Sa and pBBm16Sb. The vectors were screened for the correct insert by restriction with the corresponding enzymes. Suitable clones were sequenced (MWG Eurofins, Germany). Sequencing and alignment Gene glpQ In order to confirm B. miyamotoi in PCR-positive samples of tick DNA, PCR amplicons were sequenced (MWG Eurofins, Germany) unidirectionally using primer Q3 (Fomenko et al., 2010). The obtained sequences were aligned and compared with known sequences from GenBank using the basic local alignment and search tool (BLAST) available from the NCBI website. All three obtained sequences were identical, therefore a 424 bp fragment of the glpQ gene of one of the positive samples was chosen for cloning and bidirectional sequencing. 16S–23S IGS Amplicons from primers rrs–rrlA IGS Fn/rrs–rrlA IGS Fn were sequenced bidirectionally using the same primers. 16S rDNA Vectors pBBm16Sa and pBBm16Sb were sent to MWG Eurofins (Germany) for bidirectional sequencing using common primers T3 and T7, respectively. Sequencing data were assembled and analyzed using CLC Main Workbench V7.0 (Qiagen, Germany). The corresponding accession numbers for all sequences obtained in this study are KP202175 (16S rDNA), KP202176 (glpQ), KP202177 (16S–23S IGS). Bacterial strains Borrelia burgdorferi sensu stricto B31 (DSM No.: 4680) was obtained from the Leibniz Institute DSMZ-German Collection of Microogranisms and Cell Cultures (Germany). Lyme borreliae strains B. garinii (878/11), B. afzelii (1960/11) and B. burgdorferi sensu stricto (2624/09) isolated from patient specimens were received from the Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, Slovenia (courtesy of Eva Ruzic-Sabljic). Strains of B. duttoni, B. turicatae and B. hermsii were received from the National Reference Centre for Borrelia in Oberschleißheim, Bavaria, Germany (courtesy of
3
Volker Fingerle). The respective strains were used as a reference for comparison with tick specimens suspected to be B. miyamotoi positive. Strains were grown to logarithmic phase at 36.5 ◦ C in a modified BSK II medium containing (per liter) 250 ml 2.1% gelatin solution (Sigma–Aldrich, Austria), 74 ml 10× CMRL 1066 (Life Technologies), 3.7 g Neopeptone (Becton Dickinson, Austria), 0.37 g yeast extract (Sigma–Aldrich, Austria), 4.4 g HEPES sodium salt (Sigma–Aldrich), 2.2 g glucose, 1.63 g sodium bicarbonate, 0.4 g sodium citrate dehydrate, 0.59 g sodium pyruvate, 0.3 g N-acetyl-d-glucosamine, 60.4 ml 30% bovine serum albumin solution (PAA Laboratories, Austria) and 59.3 ml heatinactivated rabbit serum (Sigma–Aldrich, Austria); pH adjusted to 7.6. For crude DNA extraction, 1.5 ml culture was centrifuged at room temperature for 10 min at 18,000 × g in a microcentrifuge. Pellets were washed once in PBS buffer and resuspended in 50 l PCR-grade water. Samples were then boiled for 10 min at 99 ◦ C and an aliquot was diluted 1:20 or 1:50. E. coli DH5-␣ was grown in BSK medium containing selective antibiotics at 37 ◦ C. Results and discussion In the present study we report the detection of B. miyamotoi in I. ricinus collected in Austria. A total of 350 ticks (see Table 1) were screened for the presence of B. miyamotoi using a recently published nested PCR (Fomenko et al., 2010) that targets the homolog of the E. coli gene glpQ present in tick-borne relapsing fever borreliae but not in B. burgdorferi sl (Schwan et al., 1996). This PCR exclusively targets the glpQ gene of B. miyamotoi. Three of 350 (0.86%) ticks yielded positive results. This finding is within the range in other reports of B. miyamotoi prevalences in Europe (Geller et al., 2012; Cochez et al., 2014; Hansford et al., 2014). The B. miyamotoi-positive ticks were collected from three sampling sites, two of which were located in Tyrol and one in Lower Austria. As mentioned above ticks from Vienna were collected in autumn 2013, while the majority was collected in spring/summer 2005. Thus, due to the large time span between the two samplings, we cannot draw a final conclusion on the epidemiology of B. miyamotoi in Austria. Moreover, the ticks collected in Vienna in autumn might have fed on much younger mice, which might not have had as much time to come in contact with ticks as older mice and are therefore less likely to be infected by tickborne bacteria including B. miyamotoi. When the Viennese ticks are excluded from the calculation the prevalence of B. miyamotoi within the given sample size of 325 rises to 0.92% (see Table 1). Our finding underscores the Europe-wide distribution of B. miyamotoi and also points at an Austrian-wide distribution. However, as we found B. miyamotoi in only two out of nine federal states a country-wide distribution remains to be confirmed by further studies. A larger sample size might result in a higher percentage of positive samples, resulting in a clearer picture of the spatial distribution of B. miyamotoi in Austria.
Table 1 Ticks tested for presence of B. miyamotoi. Federal state Vienna Lower Austria Upper Austria Burgenland Styria Salzburg Carinthia Tyrol Vorarlberg Total a
Number of ticks tested
Number of ticks positively tested for B. miyamotoi
Percentage of positive samples
25 61 36 64 16 24 48 37 39
0 1 0 0 0 0 0 2 0
0 1.64 0 0 0 0 0 5.41 0
350
3
0.86 (0.92a )
Percentage of positive samples excluding Viennese samples.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS
4
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Fig. 1. Amplification of the 16S–23S IGS from Lyme borreliae and B. miyamotoi. B. miyamotoi shows a signal at approx. 450 bp with the primers used. The expected signal for Borrelia burgdorferi B31 is at 988 bp. However, other Lyme borreliae show shorter signals (Ranka et al., 2004). The B. afzelii isolate used also shows a shorter IGS signal. (B.a. Borrelia afzelii, B.g. Borrelia garinii, B.b.s.s. Borrelia burgdorferi sensu stricto, B31 Borrelia burgdorferi strain B31. Different isolates of B. miyamotoi are marked with “Z”. NTC, non template control.)
The glpQ amplicons were sequenced in order to confirm the RF Borrelia species. Sequences were aligned and were identical in all three positive samples. A 424 bp fragment of the glpQ gene of one of the samples was subsequently cloned to obtain a clean sequencing result. Over the relevant length, this fragment showed a single nucleotide difference compared with other European B. miyamotoi sequences (e.g. GI:672940802, GI:565410772). The same is true for a sequence obtained from a patient in The Netherlands (GI:565410768) (Hovius et al., 2013).
The three positive samples were further characterized by partial sequencing of the 16S–23S IGS and the 16S rDNA. Amplification of the 16S–23S IGS, i.e. the rrs–rrlA region, yielded a product of approximately 450 bp (Fig. 1) in comparison with B. burgdorferi B31, the original type strain of the agent of Lyme borreliosis, which yields a 988 bp amplicon (Bunikis et al., 2004a). However, shorter IGS amplicons have been reported for other Lyme borreliae species (Ranka et al., 2004). The IGS sequences of all three positive samples were identical. The IGS was not cloned into a plasmid but all
Table 2 Sequences of primers used in this study. Primer designation
Target
Sequence
Reference
Q1 Q2 Q3 Q4 rrs–rrlA IGS F rrs–rrlA IGS R rrs–rrlA IGS Fn rrs–rrlA IGS Rn S1 S2 Bm16S Fwd A Bm16S Rev A Bm16S Fwd B Bm16S Rev B Bomy glpQ F Bomy glpQ R Bomy glpQ P
glpQ glpQ glpQ glpQ rrs–rrlA (16S–23S) IGS rrs–rrlA (16S–23S) IGS rrs–rrlA (16S–23S) IGS rrs–rrlA (16S–23S) IGS rrs rrs rrs rrs rrs rrs glpQ glpQ glpQ
CACCATTGATCATAGCTCACAG CTGTTGGTGCTTCATTCCAGTC GCTAGTGGGTATCTTCCAGAAC CTTGTTGTTTATGCCAGAAGGGT GTATGTTTAGTGAGGGGGGTG GGATCATAGCTCAGGTGGTTAG AGGGGGGTGAAGTCGTAACAAG GTCTGATAAACCTGAGGTCGGA GCTGGCAGTGCGTCTTAAGCATGC CGGGTTAGAATAATAGCTTCGGG CGATAGGATCCAAGCATGCAAGTCAAACG CGATAGAATTCTAACTTCCCCTATCAGAC CGATAGAATTCCTGGTGTAAGGGT CGATACTCGAGATAGCTTCGGGTATCCTC TGCACAATTATTTCCCAATCGA TTCACTGAGACTTAGTGATTTAAGTTCAGTT ACGGACGATATTACGCCACTGACTTCACA
Fomenko et al. (2010) Fomenko et al. (2010) Fomenko et al. (2010) Fomenko et al. (2010) Bunikis et al. (2004a) Bunikis et al. (2004a) Bunikis et al. (2004a) Bunikis et al. (2004a) Fukunaga et al. (1996) and Fomenko et al. (2010) Fukunaga et al. (1996) and Fomenko et al. (2010) This study This study This study This study This study This study This study
Restriction sites are underlined. Single nucleotide deviations of the Austrian B. miyamotoi isolates from the designed Real-time PCR primers and probe are marked in bold.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
5
Fig. 2. Sensitivity test of the Real-time PCR. The graph shows an amplification plot of a ten fold dilution series of vector pBBmglpQ. In one batch vector pBBmglpQ was diluted in water (red curves) whereas in the second batch tick-DNA lysate was used for dilution of the plasmid (blue curves). The respective amplification curves do not show significant differences. An included dilution to 10−1 copies of pBBmglpQ as well as non template controls containing water or tick-DNA lysate, respectively are not amplified. The graph is representative for three independent experiments. An included dilution of the vector to 100 copies was amplified only once in the triplicate. Numbers next to the amplification curve indicate the calculated copy number of the target gene. The bold line shows the threshold.
sequences were aligned into one consensus sequence. When compared with sequences deposited in GenBank this 448 bp fragment shares 97% similarity with B. miyamotoi FR64b, a Japanese isolate of which the complete genome has been recently made available at the NCBI (GI:576102789). However, over the relevant length, our sequence is identical to IGS sequences obtained in Sweden (GI:484359016; GI:484359017; GI:38350121). This supports the view that, within given geographic areas, genetic diversity of the IGS locus of B. miyamotoi is restricted, although greater than in other RF borreliae (Bunikis et al., 2004b). As glpQ and IGS sequences were identical for all three samples, a partial sequence of the 16S rDNA was cloned into plasmids for sequencing. In nested PCR, the primary amplicon was used to generate fragments Bm16Sa and Bm16Sb which were each cloned into pBluescript KS II+ vectors, resulting in plasmids pBBm16Sa and pBBm16Sb. Sequencing of both fragments identified a total length of 1382 bp when the two fragments were combined. When compared to sequences deposited at GenBank, this sequence shared highest similarity with B. miyamotoi isolate 543(1) (GI:672940799), which was originally obtained from I. ricinus in the Czech Republic. In order to speed up detection of B. miyamotoi, a Taqman MGB-based real-time PCR was developed. Primers and probe
were designed to target the glpQ gene on the basis of three sequences available from the NCBI (GI:253757016; GI:237866044; GI:38230732). The glpQ gene of B. miyamotoi strain LB-2001 (Scoles et al., 2001; Ullmann et al., 2005) will probably not be recognized by the assay. For checking sensitivity of the real-time PCR, the glpQ fragment was amplified from one of the B. miyamotoi-positive ticks and cloned into a plasmid. The copy number of the plasmid was calculated by measuring the concentration of the plasmid and in a serial dilution experiment as few as ten copies of the gene could be readily detected in the assay (Fig. 2). However, amplifying the target gene from more complex samples, e.g. tick DNA extracts, might alter the sensitivity of the assay. To address this problem, we additionally performed the serial dilution experiment using tick-lysate instead of water for diluting the plasmid. We did not observe significant impairment of the assay sensitivity under these conditions (Fig. 2). Moreover, we tested our method with DNA extracts from pure cultures of B. turicatae, B. duttoni, and B. hermsii, representing other RF borreliae, as well as B. burgdorferi B31, as a representative of Lyme borreliae. None of these strains were detected with our real-time PCR, demonstrating the specificity of the method. Using this PCR approach, we could readily identify B. miyamotoi in samples that also tested positive with the nested PCR targeting the glpQ
Fig. 3. Alignment of the glpQ target region. Selected sequences available from the NCBI show three distinct sequence types in the region that is targeted by our Real-time PCR. Primers and probe are highlighted by arrows.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS
6
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
gene. Alignment of probe and primers with the glpQ sequences obtained in the present study revealed each a single nucleotide difference in the reverse primer as well as in the probe. Alignment of B. miyamotoi glpQ sequences available from the NCBI shows that at least three different sequence types occur in the targeted region (Fig. 3). This did not, however, adversely affect detection under the applied conditions. Nested PCR is always at high risk of contamination. The newly developed Real-time PCR provides a means for faster and easier detection of B. miyamotoi. Conclusion Our findings consolidate the picture of a wide distribution of B. miyamotoi species within Europe. With this spirochete on the verge of being recognized as a novel pathogen, the development of a fast, sensitive and reliable detection system is important. In addition to tick screening, we therefore developed a real-time PCR capable of detecting B. miyamotoi. This method clearly identified B. miyamotoi from ticks that also tested positive in the nested PCR while not amplifying DNA of different Lyme and RF borreliae. The high sequence similarity with a sample isolated from a Dutch patient (Hovius et al., 2013) supports the view that B. miyamotoi might constitute a new emerging pathogen, at least for immunocompromised patients. It is evident, however, that further studies are needed to elucidate a role for B. miyamotoi as a pathogen. Acknowledgements We thank Dr. Volker Fingerle, National Reference Center for Borrelia in Germany, and Dr. Eva Ruzic-Sabljic, Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, Slovenia for contributing Borrelia strains, and Drs. Irina Korschineck and Claudia Schabereiter-Gurtner, Ingenetix, for valuable discussions. References Assous, M.V., Wilamowski, A., 2009. Relapsing fever borreliosis in Eurasia–forgotten, but certainly not gone! Clin. Microbiol. Infect. 15, 407–414. Barbour, A.G., Bunikis, J., Travinsky, B., Hoen, A.G., Diuk-Wasser, M.A., Fish, D., Tsao, J.I., 2009. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am. J. Trop. Med. Hyg. 81, 1120–1131. Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., Barbour, A.G., 2004a. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150, 1741–1755. Bunikis, J., Tsao, J., Garpmo, U., Berglund, J., Fish, D., Barbour, A.G., 2004b. Typing of Borrelia relapsing fever group strains. Emerg. Infect. Dis. 10, 1661–1664. Cochez, C., Heyman, P., Heylen, D., Fonville, M., Hengeveld, P., Takken, W., Simons, L., Sprong, H., 2014. The presence of Borrelia miyamotoi, a relapsing fever spirochaete, in questing Ixodes ricinus in Belgium and in The Netherlands. Zoonoses Public Health, http://dx.doi.org/10.1111/zph.12154 (Epub ahead of print). Davidson, B.E., MacDougall, J., Saint Girons, I., 1992. Physical map of the linear chromosome of the bacterium Borrelia burgdorferi 212, a causative agent of Lyme disease, and localization of rRNA genes. J. Bacteriol. 174, 3766–3774. Fomenko, N.V., Livanova, N.N., Borgoiakov, V., Kozlova, I.V., Shulaikina, I.V., Pukhovskaia, N.M., Tokarevich, K.N., Livanov, S.G., Doroshchenko, E.K., Ivanov, L.I., 2010. Detection of Borrelia miyamotoi in ticks Ixodes persulcatus from Russia. Parazitologiia 44, 201–211. Fonville, M., Friesema, I.H., Hengeveld, P.D., Docters van Leeuwen, A., Jahfari, S., Harms, M.G., van Vliet, A.J., Hofhuis, A., van Pelt, W., Sprong, H., van den Wijngaard, C.C., 2014. Human exposure to tickborne relapsing fever spirochete Borrelia miyamotoi, the Netherlands. Emerg. Infect. Dis. 20, 1244–1245.
Fraenkel, C.J., Garpmo, U., Berglund, J., 2002. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J. Clin. Microbiol. 40, 3308–3312. Fraser, C.M., Casjens, S., Huang, W.M., Sutton, G.G., Clayton, R., Lathigra, R., White, O., Ketchum, K.A., Dodson, R., Hickey, E.K., Gwinn, M., Dougherty, B., Tomb, J.F., Fleischmann, R.D., Richardson, D., Peterson, J., Kerlavage, A.R., Quackenbush, J., Salzberg, S., Hanson, M., van Vugt, R., Palmer, N., Adams, M.D., Gocayne, J., Weidman, J., Utterback, T., Watthey, L., McDonald, L., Artiach, P., Bowman, C., Garland, S., Fuji, C., Cotton, M.D., Horst, K., Roberts, K., Hatch, B., Smith, H.O., Venter, J.C., 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390 (6660), 580–586. Fukunaga, M., Hamase, A., Okada, K., Inoue, H., Tsuruta, Y., Miyamoto, K., Nakao, M., 1996. Characterization of spirochetes isolated from ticks (Ixodes tanuki, Ixodes turdus, and Ixodes columnae) and comparison of the sequences with those of Borrelia burgdorferi sensu lato strains. Appl. Environ. Microbiol. 62, 2338–2344. Fukunaga, M., Koreki, Y., 1995. The flagellin gene of Borrelia miyamotoi sp. nov. and its phylogenetic relationship among Borrelia species. FEMS Microbiol. Lett. 134, 255–258. Fukunaga, M., Takahashi, Y., Tsuruta, Y., Matsushita, O., Ralph, D., McClelland, M., Nakao, M., 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int. J. Syst. Bacteriol. 45, 804–810. Geller, J., Nazarova, L., Katargina, O., Jarvekulg, L., Fomenko, N., Golovljova, I., 2012. Detection and genetic characterization of relapsing fever spirochete Borrelia miyamotoi in Estonian ticks. PLoS ONE 7, e51914. Guy, E.C., Stanek, G., 1991. Detection of Borrelia burgdorferi in patients with Lyme disease by the polymerase chain reaction. J. Clin. Pathol. 44, 610–611. Hamer, S.A., Hickling, G.J., Keith, R., Sidge, J.L., Walker, E.D., Tsao, J.I., 2012. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, USA. Parasit. Vectors 5, 231. Hansford, K.M., Fonville, M., Jahfari, S., Sprong, H., Medlock, J.M., 2014. Borrelia miyamotoi in host-seeking Ixodes ricinus ticks in England. Epidemiol. Infect., 1–9 (Epub ahead of print). Hovius, J.W., de Wever, B., Sohne, M., Brouwer, M.C., Coumou, J., Wagemakers, A., Oei, A., Knol, H., Narasimhan, S., Hodiamont, C.J., Jahfari, S., Pals, S.T., Horlings, H.M., Fikrig, E., Sprong, H., van Oers, M.H., 2013. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet 382 (9892), 658. Krause, P.J., Narasimhan, S., Wormser, G.P., Rollend, L., Fikrig, E., Lepore, T., Barbour, A., Fish, D., 2013. Human Borrelia miyamotoi infection in the United States. N. Engl. J. Med. 368, 291–293. Liveris, D., Gazumyan, A., Schwartz, I., 1995. Molecular typing of Borrelia burgdorferi sensu lato by PCR-restriction fragment length polymorphism analysis. J. Clin. Microbiol. 33, 589–595. Mun, J., Eisen, R.J., Eisen, L., Lane, R.S., 2006. Detection of a Borrelia miyamotoi sensu lato relapsing-fever group spirochete from Ixodes pacificus in California. J. Med. Entomol. 43, 120–123. Platonov, A.E., Karan, L.S., Kolyasnikova, N.M., Makhneva, N.A., Toporkova, M.G., Maleev, V.V., Fish, D., Krause, P.J., 2011. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg. Infect. Dis. 17, 1816–1823. Ranka, R., Bormane, A., Salmina, K., Baumanis, V., 2004. Identification of three clinically relevant Borrelia burgdorferi sensu lato genospecies by PCR-restriction fragment length polymorphism analysis of 16S–23S ribosomal DNA spacer amplicons. J Clin Microbiol 42 (4), 1444–1449. Richter, D., Schlee, D.B., Matuschka, F.R., 2003. Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. Emerg. Infect. Dis. 9, 697–701. Rijpkema, S., Golubic, D., Molkenboer, M., Verbeek-De Kruif, N., Schellekens, J., 1996. Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp. Appl. Acarol. 20, 23–30. Schwan, T.G., Schrumpf, M.E., Hinnebusch, B.J., Anderson Jr., D.E., Konkel, M.E., 1996. GlpQ: an antigen for serological discrimination between relapsing fever and Lyme borreliosis. J. Clin. Microbiol. 34, 2483–2492. Schwartz, J.J., Gazumyan, A., Schwartz, I., 1992. rRNA gene organization in the Lyme disease spirochete, Borrelia burgdorferi. J. Bacteriol. 174, 3757–3765. Scoles, G.A., Papero, M., Beati, L., Fish, D., 2001. A relapsing fever group spirochete transmitted by Ixodes scapularis ticks. Vector Borne Zoonotic Dis. 1, 21–34. Stanek, G., Wormser, G.P., Gray, J., Strle, F., 2012. Lyme borreliosis. Lancet 379 (9814), 461–473. Ullmann, A.J., Gabitzsch, E.S., Schulze, T.L., Zeidner, N.S., Piesman, J., 2005. Three multiplex assays for detection of Borrelia burgdorferi sensu lato and Borrelia miyamotoi sensu lato in field-collected Ixodes nymphs in North America. J. Med. Entomol. 42, 1057–1062. Wang, G., van Dam, A.P., Schwartz, I., Dankert, J., 1999. Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications. Clin. Microbiol. Rev. 12, 633–653.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks Michael Reiter ∗ , Anna-Margarita Schötta, Andreas Müller, Hannes Stockinger, Gerold Stanek Institute for Hygiene and Applied Immunology, Center for Pathophysiology, Infectiology and Immunology, Medical University of Vienna, Kinderspitalgasse 15, 1090 Vienna, Austria
a r t i c l e
i n f o
Article history: Received 2 December 2014 Received in revised form 2 February 2015 Accepted 4 February 2015 Available online xxx Keywords: Borrelia Miyamotoi Ixodes Tick PCR
a b s t r a c t A total of 350 ticks collected in Austria were analyzed for the presence of DNA sequences of B. miyamotoi. Three ticks gave positive results in a B. miyamotoi-specific nested PCR. Results were confirmed by sequencing the amplified glpQ gene from the positive samples. Moreover we developed a real-time PCR which unambiguously detected B. miyamotoi in all positive samples. Further genotyping of the samples found 100% identity of the 16S–23S intergenic spacer region with Swedish B. miyamotoi sequences. This is the first detection of the relapsing fever spirochete Borrelia miyamotoi in hard ticks in Austria. The results consolidate the picture of a European-wide distribution of B. miyamotoi and again underscore the need for clinical awareness to clarify possible involvement of this species in human disease. © 2015 Elsevier GmbH. All rights reserved.
Introduction Spirochetes of the genus Borrelia are currently subdivided into two major groups (Geller et al., 2012): the relapsing fever (RF) borreliae, which are harbored and transmitted by the body louse Pediculus corporis (louse borne-RF) or by argasid or soft ticks (tickborne RF), and the spirochetes of the Borrelia burgdorferi sensu lato (sl) complex, which are transmitted by ixodid or hard ticks. The B. burgdorferi sl complex includes the causative agents of Lyme borreliosis (LB) (Barbour et al., 2009), which presents predominantly with manifestations of infection of the skin, nervous system, musculoskeletal system, rarely the heart and other organs, as well as with rare chronic courses of skin, joint and central nervous system involvement (Stanek et al., 2012). Tick-borne RF is mainly characterized by repeated episodes of high fever (Assous and Wilamowski, 2009). There is a third group of borrelial species that are closely related to RF spirochetes but use ixodid ticks as vectors (Barbour et al., 2009). Representatives of this group include B. theileri, B. lonestari and B. miyamotoi (Barbour et al., 2009). Originally isolated from Ixodes persulcatus on the island of Hokkaido, Japan, in 1995 (Fukunaga et al., 1995), B. miyamotoi has been found in hard ticks
∗ Corresponding author. Tel.: +43 1 40160 33024. E-mail address: [email protected] (M. Reiter).
of different species, such as I. scapularis, I. ricinus and I. pacificus (Platonov et al., 2011). The detection of B. miyamotoi in Japan (Fukunaga et al., 1995), in USA (Scoles et al., 2001; Mun et al., 2006) and in Eurasia (Fraenkel et al., 2002; Richter et al., 2003; Fomenko et al., 2010; Hansford et al., 2014) indicates the wide distribution of this species in the northern hemisphere. Analysis of the flagellin gene and 16S rRNA has revealed a closer relationship to other RF borreliae than to Lyme borreliae (Fukunaga and Koreki, 1995; Fukunaga et al., 1995). At the genomic level, RF and Lyme borreliae are easily distinguished by the presence (Lyme borreliae) or absence (RF borreliae) of tandemly repeated 5S and 23S ribosomal genes (Davidson et al., 1992; Schwartz et al., 1992). The highly variable region of the 5S-23S duplication has been extensively used for subtyping B. burgdorferi sl species (Wang et al., 1999). B. miyamotoi lacks this second copy of the ribosomal genes, again demonstrating the closer relationship to other RF borreliae (Fukunaga et al., 1995). Another gene (glpQ) encoding a glycerophosphodiester phosphodiesterase is present only in RF borreliae but not in Lyme borreliae (Schwan et al., 1996; Fraser et al., 1997); this gene has been used for detection of RF borreliae and for specific identification and characterization of B. miyamotoi (Fomenko et al., 2010; Geller et al., 2012; Hansford et al., 2014). A third gene, the intergenic spacer (IGS) between the 16S and 23S genes is present in both Lyme borreliae and RF borreliae and is commonly used for characterization of both groups (Liveris et al., 1995; Bunikis et al., 2004b). Although the IGS exhibits greater diversity in
http://dx.doi.org/10.1016/j.ttbdis.2015.02.002 1877-959X/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS
2
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
B. miyamotoi than in other borreliae it remains a useful locus for genotyping RF borreliae (Bunikis et al., 2004b). The clinical importance of B. miyamotoi is currently under discussion. Although humans might become infected with B. miyamotoi, evidence for causing human disease is currently weak (Hamer et al., 2012; Fonville et al., 2014). Nevertheless, the number of scientific papers and case reports demonstrating association of B. miyamotoi with RF-like and LB-like symptoms in patients is increasing and B. miyamotoi has been identified in ticks in several European countries and in patients (Richter et al., 2003; Platonov et al., 2011; Geller et al., 2012; Hovius et al., 2013; Krause et al., 2013). The aim of the present study was to identify B. miyamotoi in ticks collected in Austria and to develop a rapid and reliable detection method for this species. Materials and methods Ticks Ticks were collected by flagging during spring/summer 2005 in all the federal states of Austria; ticks from Vienna were collected separately in autumn 2013. The 2005 Vienna batch was used up in another study. All ticks were frozen at −20 ◦ C until processing. Altogether, 350 Ixodes ricinus ticks comprising 46 adults (22 females, 24 males), 302 nymphs and 2 larvae were used for the study. DNA extraction from ticks DNA was extracted from the ticks by alkaline lysis (Guy and Stanek, 1991; Rijpkema et al., 1996) or with the DNeasy Blood and Tissue kit (Qiagen, Germany), using a modified protocol. Briefly, ticks were lysed overnight in 180 l ATL buffer and 20 l proteinase K solution at 56 ◦ C while shaking. AL buffer (200 l) was then added, followed by incubation at 70 ◦ C for 10 min. After the addition of 200 l 96% ethanol the mixture was centrifuged at 18,000 × g for 5 min. The remaining steps were as described in the manufacturer’s protocol. A negative extraction control was included with each batch in order to exclude possible cross-contamination during the extraction process. PCR and real-time PCR For the detection of B. miyamotoi, DNA samples extracted from groups of up to 10 ticks were pooled for testing; the ticks in any B. miyamotoi-positive pools were then tested individually. A nested PCR was used as described previously (Fomenko et al., 2010). The master mix contained (final concentrations): 0.4 M each primer, 400 M dNTPs (Solis BioDyne, Estonia), 1.25 u peqGOLD Hot Taq-DNA-Polymerase (PeqLab, Germany), 5 l reaction buffer Y (PeqLab, Germany), 10 l enhancer solution P (PeqLab, Germany), 5 l extracted DNA. Reaction volumes were adjusted to 50 l with PCR-grade water (Sigma–Aldrich, Austria). Primers Q1/Q2 were used for the first round of amplification. The reaction conditions were 95 ◦ C for 5 min, followed by 35 cycles of 95 ◦ C for 30 s, 50 ◦ C for 45 s and 72 ◦ C for 45 s, and a final elongation step of 72 ◦ C for 7 min. Primers Q3/Q4 were used for the second round of amplification and reaction conditions for the nested amplification were the same as for the first round, except that the annealing temperature was 52 ◦ C. A negative control containing PCR-grade water in the PCR master-mix instead of DNA was included in every run to control for possible contamination. The Borrelia rrs–rrlA region was amplified in a nested PCR, as described elsewhere (Bunikis et al., 2004a). The master mix was prepared as above. Primers rrs–rrlA IGS F/rrs–rrlA IGS R were used in the first round of amplification. Reaction conditions were 95 ◦ C
for 7 min, followed by 35 cycles at 95 ◦ C for 45 s, 55.5 ◦ C for 1 min and 72 ◦ C for 45 s, and a final elongation step of 72 ◦ C for 7 min. Primers rrs–rrlA IGS Fn/rrs–rrlA IGS Rn were used for the second round of amplification. Reaction conditions for nested amplification were the same as for the first round. A PCR with primers S1/S2 targeting B. miyamotoi 16S rDNA was run with the following reaction conditions: 95 ◦ C for 5 min, followed by 35 cycles of 95 ◦ C for 30 s, 50 ◦ C for 45 s and 72 ◦ C for 90 s; the final extension step was at 72 ◦ C for 7 min. Portions (5 l) of the reaction product were used as template to generate PCR fragments suitable for cloning. For cloning of B. miyamotoi 16S rDNA, primer pairs Bm16S Fwd A/Bm16S Rev A and Bm16S Fwd B/Bm16S Rev B were used to generate two fragments 620 bp and 762 bp in length, respectively. Reaction conditions were as follows: 95 ◦ C for 5 min, followed by 35 cycles at 95 ◦ C for 30 s, 52 ◦ C for 45 s and 72 ◦ C for 1 min, and a final elongation step at 72 ◦ C for 7 min. For real-time PCR in an Applied Biosystems 7500 Real-Time PCR Cycler, primers and probes were based on sequences available from the National Center for Biotechnology Information (NCBI) (accession numbers GI:253757016, GI:38230732, GI:237866044). A complete match with B. miyamotoi strain LB-2001 (GI:60396860) could not be achieved. The reactions contained 1 l primer/probe mix (ingenetix, Austria), 10 l 2× TaqMan Gene Expression Master Mix (Life Technologies, Austria) and 4 l of tick DNA extract. The reaction volume was adjusted to 20 l with PCR-grade water. The following conditions were used in the 2-step PCR: 95 ◦ C for 10 min, followed by 50 cycles of 95 ◦ C for 15 s and 56 ◦ C for 2 min. For specificity testing, crude DNA extracts of the following strains were used: B. turicatae, B. duttonii, B. hermsii and B. burgdorferi B31. For sensitivity testing, vector pBBmglpQ was purified from E. coli DH5-␣ using a plasmid mini kit (Fisher Scientific, Vienna, Austria) and quantity was determined photometrically. Copy number was calculated from the molecular weight of pBBmglpQ. The extract was then serially diluted and the highest dilution resulted in 0.1 copy of the plasmid within the PCR reaction (Fig. 2). We additionally tested the sensitivity of the assay, when tick-DNA lysates were used instead of water for serial dilution of vector pBBmglpQ. Therefore, the genomic DNA of 15 nymphal I. ricinus ticks was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) as described above. Subsequently all extracts were tested with the real-time PCR assay to ensure they were B. miyamotoi negative. After that all extracts were pooled together and used for the dilution series of the experiment (Fig. 2). Sequences of all primers and probes used in this study are listed in Table 2. Cloning strategies A plasmid mini kit was used to purify the pBluescript KS II+ vector from an overnight culture of E. coli DH5-␣. TA cloning of glpQ The glpQ gene fragment was amplified from one of the tick extractions as described above and purified using a commercially available kit (Qiagen, Germany). The vector was digested with EcoRV (Fisher Scientific, Austria) according to the manufacturer’s instructions. The digested and purified vector was then incubated for 2 h at 72 ◦ C with Taq polymerase (Fisher Scientific, Austria) in the presence of 2 mM dTTP (Solis BioDyne, Estonia). The glpQ fragment was ligated into the resulting T-vector using T4 Ligase (Fisher Scientific, Austria), resulting in vector pBBmglpQ. Subsequently, E. coli DH5-␣ cells were transformed and clones were verified by sequencing (MWG Eurofins, Germany).
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model
ARTICLE IN PRESS
TTBDIS-440; No. of Pages 6
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Cloning of 16S rDNA The 16S rDNA from one of the positive tick samples was pre-amplified using primers S1/S2 (Fukunaga et al., 1996) as described above. From this primary amplicon, fragments Bm16Sa and Bm16Sb were generated as described above. Amplified fragments were digested with BamHI/EcoRI or EcoRI/XhoI, respectively. The two fragments were cloned into pBluescript KS II+ that had been digested with the corresponding enzymes, resulting in vectors pBBm16Sa and pBBm16Sb. The vectors were screened for the correct insert by restriction with the corresponding enzymes. Suitable clones were sequenced (MWG Eurofins, Germany). Sequencing and alignment Gene glpQ In order to confirm B. miyamotoi in PCR-positive samples of tick DNA, PCR amplicons were sequenced (MWG Eurofins, Germany) unidirectionally using primer Q3 (Fomenko et al., 2010). The obtained sequences were aligned and compared with known sequences from GenBank using the basic local alignment and search tool (BLAST) available from the NCBI website. All three obtained sequences were identical, therefore a 424 bp fragment of the glpQ gene of one of the positive samples was chosen for cloning and bidirectional sequencing. 16S–23S IGS Amplicons from primers rrs–rrlA IGS Fn/rrs–rrlA IGS Fn were sequenced bidirectionally using the same primers. 16S rDNA Vectors pBBm16Sa and pBBm16Sb were sent to MWG Eurofins (Germany) for bidirectional sequencing using common primers T3 and T7, respectively. Sequencing data were assembled and analyzed using CLC Main Workbench V7.0 (Qiagen, Germany). The corresponding accession numbers for all sequences obtained in this study are KP202175 (16S rDNA), KP202176 (glpQ), KP202177 (16S–23S IGS). Bacterial strains Borrelia burgdorferi sensu stricto B31 (DSM No.: 4680) was obtained from the Leibniz Institute DSMZ-German Collection of Microogranisms and Cell Cultures (Germany). Lyme borreliae strains B. garinii (878/11), B. afzelii (1960/11) and B. burgdorferi sensu stricto (2624/09) isolated from patient specimens were received from the Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, Slovenia (courtesy of Eva Ruzic-Sabljic). Strains of B. duttoni, B. turicatae and B. hermsii were received from the National Reference Centre for Borrelia in Oberschleißheim, Bavaria, Germany (courtesy of
3
Volker Fingerle). The respective strains were used as a reference for comparison with tick specimens suspected to be B. miyamotoi positive. Strains were grown to logarithmic phase at 36.5 ◦ C in a modified BSK II medium containing (per liter) 250 ml 2.1% gelatin solution (Sigma–Aldrich, Austria), 74 ml 10× CMRL 1066 (Life Technologies), 3.7 g Neopeptone (Becton Dickinson, Austria), 0.37 g yeast extract (Sigma–Aldrich, Austria), 4.4 g HEPES sodium salt (Sigma–Aldrich), 2.2 g glucose, 1.63 g sodium bicarbonate, 0.4 g sodium citrate dehydrate, 0.59 g sodium pyruvate, 0.3 g N-acetyl-d-glucosamine, 60.4 ml 30% bovine serum albumin solution (PAA Laboratories, Austria) and 59.3 ml heatinactivated rabbit serum (Sigma–Aldrich, Austria); pH adjusted to 7.6. For crude DNA extraction, 1.5 ml culture was centrifuged at room temperature for 10 min at 18,000 × g in a microcentrifuge. Pellets were washed once in PBS buffer and resuspended in 50 l PCR-grade water. Samples were then boiled for 10 min at 99 ◦ C and an aliquot was diluted 1:20 or 1:50. E. coli DH5-␣ was grown in BSK medium containing selective antibiotics at 37 ◦ C. Results and discussion In the present study we report the detection of B. miyamotoi in I. ricinus collected in Austria. A total of 350 ticks (see Table 1) were screened for the presence of B. miyamotoi using a recently published nested PCR (Fomenko et al., 2010) that targets the homolog of the E. coli gene glpQ present in tick-borne relapsing fever borreliae but not in B. burgdorferi sl (Schwan et al., 1996). This PCR exclusively targets the glpQ gene of B. miyamotoi. Three of 350 (0.86%) ticks yielded positive results. This finding is within the range in other reports of B. miyamotoi prevalences in Europe (Geller et al., 2012; Cochez et al., 2014; Hansford et al., 2014). The B. miyamotoi-positive ticks were collected from three sampling sites, two of which were located in Tyrol and one in Lower Austria. As mentioned above ticks from Vienna were collected in autumn 2013, while the majority was collected in spring/summer 2005. Thus, due to the large time span between the two samplings, we cannot draw a final conclusion on the epidemiology of B. miyamotoi in Austria. Moreover, the ticks collected in Vienna in autumn might have fed on much younger mice, which might not have had as much time to come in contact with ticks as older mice and are therefore less likely to be infected by tickborne bacteria including B. miyamotoi. When the Viennese ticks are excluded from the calculation the prevalence of B. miyamotoi within the given sample size of 325 rises to 0.92% (see Table 1). Our finding underscores the Europe-wide distribution of B. miyamotoi and also points at an Austrian-wide distribution. However, as we found B. miyamotoi in only two out of nine federal states a country-wide distribution remains to be confirmed by further studies. A larger sample size might result in a higher percentage of positive samples, resulting in a clearer picture of the spatial distribution of B. miyamotoi in Austria.
Table 1 Ticks tested for presence of B. miyamotoi. Federal state Vienna Lower Austria Upper Austria Burgenland Styria Salzburg Carinthia Tyrol Vorarlberg Total a
Number of ticks tested
Number of ticks positively tested for B. miyamotoi
Percentage of positive samples
25 61 36 64 16 24 48 37 39
0 1 0 0 0 0 0 2 0
0 1.64 0 0 0 0 0 5.41 0
350
3
0.86 (0.92a )
Percentage of positive samples excluding Viennese samples.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS
4
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Fig. 1. Amplification of the 16S–23S IGS from Lyme borreliae and B. miyamotoi. B. miyamotoi shows a signal at approx. 450 bp with the primers used. The expected signal for Borrelia burgdorferi B31 is at 988 bp. However, other Lyme borreliae show shorter signals (Ranka et al., 2004). The B. afzelii isolate used also shows a shorter IGS signal. (B.a. Borrelia afzelii, B.g. Borrelia garinii, B.b.s.s. Borrelia burgdorferi sensu stricto, B31 Borrelia burgdorferi strain B31. Different isolates of B. miyamotoi are marked with “Z”. NTC, non template control.)
The glpQ amplicons were sequenced in order to confirm the RF Borrelia species. Sequences were aligned and were identical in all three positive samples. A 424 bp fragment of the glpQ gene of one of the samples was subsequently cloned to obtain a clean sequencing result. Over the relevant length, this fragment showed a single nucleotide difference compared with other European B. miyamotoi sequences (e.g. GI:672940802, GI:565410772). The same is true for a sequence obtained from a patient in The Netherlands (GI:565410768) (Hovius et al., 2013).
The three positive samples were further characterized by partial sequencing of the 16S–23S IGS and the 16S rDNA. Amplification of the 16S–23S IGS, i.e. the rrs–rrlA region, yielded a product of approximately 450 bp (Fig. 1) in comparison with B. burgdorferi B31, the original type strain of the agent of Lyme borreliosis, which yields a 988 bp amplicon (Bunikis et al., 2004a). However, shorter IGS amplicons have been reported for other Lyme borreliae species (Ranka et al., 2004). The IGS sequences of all three positive samples were identical. The IGS was not cloned into a plasmid but all
Table 2 Sequences of primers used in this study. Primer designation
Target
Sequence
Reference
Q1 Q2 Q3 Q4 rrs–rrlA IGS F rrs–rrlA IGS R rrs–rrlA IGS Fn rrs–rrlA IGS Rn S1 S2 Bm16S Fwd A Bm16S Rev A Bm16S Fwd B Bm16S Rev B Bomy glpQ F Bomy glpQ R Bomy glpQ P
glpQ glpQ glpQ glpQ rrs–rrlA (16S–23S) IGS rrs–rrlA (16S–23S) IGS rrs–rrlA (16S–23S) IGS rrs–rrlA (16S–23S) IGS rrs rrs rrs rrs rrs rrs glpQ glpQ glpQ
CACCATTGATCATAGCTCACAG CTGTTGGTGCTTCATTCCAGTC GCTAGTGGGTATCTTCCAGAAC CTTGTTGTTTATGCCAGAAGGGT GTATGTTTAGTGAGGGGGGTG GGATCATAGCTCAGGTGGTTAG AGGGGGGTGAAGTCGTAACAAG GTCTGATAAACCTGAGGTCGGA GCTGGCAGTGCGTCTTAAGCATGC CGGGTTAGAATAATAGCTTCGGG CGATAGGATCCAAGCATGCAAGTCAAACG CGATAGAATTCTAACTTCCCCTATCAGAC CGATAGAATTCCTGGTGTAAGGGT CGATACTCGAGATAGCTTCGGGTATCCTC TGCACAATTATTTCCCAATCGA TTCACTGAGACTTAGTGATTTAAGTTCAGTT ACGGACGATATTACGCCACTGACTTCACA
Fomenko et al. (2010) Fomenko et al. (2010) Fomenko et al. (2010) Fomenko et al. (2010) Bunikis et al. (2004a) Bunikis et al. (2004a) Bunikis et al. (2004a) Bunikis et al. (2004a) Fukunaga et al. (1996) and Fomenko et al. (2010) Fukunaga et al. (1996) and Fomenko et al. (2010) This study This study This study This study This study This study This study
Restriction sites are underlined. Single nucleotide deviations of the Austrian B. miyamotoi isolates from the designed Real-time PCR primers and probe are marked in bold.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
5
Fig. 2. Sensitivity test of the Real-time PCR. The graph shows an amplification plot of a ten fold dilution series of vector pBBmglpQ. In one batch vector pBBmglpQ was diluted in water (red curves) whereas in the second batch tick-DNA lysate was used for dilution of the plasmid (blue curves). The respective amplification curves do not show significant differences. An included dilution to 10−1 copies of pBBmglpQ as well as non template controls containing water or tick-DNA lysate, respectively are not amplified. The graph is representative for three independent experiments. An included dilution of the vector to 100 copies was amplified only once in the triplicate. Numbers next to the amplification curve indicate the calculated copy number of the target gene. The bold line shows the threshold.
sequences were aligned into one consensus sequence. When compared with sequences deposited in GenBank this 448 bp fragment shares 97% similarity with B. miyamotoi FR64b, a Japanese isolate of which the complete genome has been recently made available at the NCBI (GI:576102789). However, over the relevant length, our sequence is identical to IGS sequences obtained in Sweden (GI:484359016; GI:484359017; GI:38350121). This supports the view that, within given geographic areas, genetic diversity of the IGS locus of B. miyamotoi is restricted, although greater than in other RF borreliae (Bunikis et al., 2004b). As glpQ and IGS sequences were identical for all three samples, a partial sequence of the 16S rDNA was cloned into plasmids for sequencing. In nested PCR, the primary amplicon was used to generate fragments Bm16Sa and Bm16Sb which were each cloned into pBluescript KS II+ vectors, resulting in plasmids pBBm16Sa and pBBm16Sb. Sequencing of both fragments identified a total length of 1382 bp when the two fragments were combined. When compared to sequences deposited at GenBank, this sequence shared highest similarity with B. miyamotoi isolate 543(1) (GI:672940799), which was originally obtained from I. ricinus in the Czech Republic. In order to speed up detection of B. miyamotoi, a Taqman MGB-based real-time PCR was developed. Primers and probe
were designed to target the glpQ gene on the basis of three sequences available from the NCBI (GI:253757016; GI:237866044; GI:38230732). The glpQ gene of B. miyamotoi strain LB-2001 (Scoles et al., 2001; Ullmann et al., 2005) will probably not be recognized by the assay. For checking sensitivity of the real-time PCR, the glpQ fragment was amplified from one of the B. miyamotoi-positive ticks and cloned into a plasmid. The copy number of the plasmid was calculated by measuring the concentration of the plasmid and in a serial dilution experiment as few as ten copies of the gene could be readily detected in the assay (Fig. 2). However, amplifying the target gene from more complex samples, e.g. tick DNA extracts, might alter the sensitivity of the assay. To address this problem, we additionally performed the serial dilution experiment using tick-lysate instead of water for diluting the plasmid. We did not observe significant impairment of the assay sensitivity under these conditions (Fig. 2). Moreover, we tested our method with DNA extracts from pure cultures of B. turicatae, B. duttoni, and B. hermsii, representing other RF borreliae, as well as B. burgdorferi B31, as a representative of Lyme borreliae. None of these strains were detected with our real-time PCR, demonstrating the specificity of the method. Using this PCR approach, we could readily identify B. miyamotoi in samples that also tested positive with the nested PCR targeting the glpQ
Fig. 3. Alignment of the glpQ target region. Selected sequences available from the NCBI show three distinct sequence types in the region that is targeted by our Real-time PCR. Primers and probe are highlighted by arrows.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
G Model TTBDIS-440; No. of Pages 6
ARTICLE IN PRESS
6
M. Reiter et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
gene. Alignment of probe and primers with the glpQ sequences obtained in the present study revealed each a single nucleotide difference in the reverse primer as well as in the probe. Alignment of B. miyamotoi glpQ sequences available from the NCBI shows that at least three different sequence types occur in the targeted region (Fig. 3). This did not, however, adversely affect detection under the applied conditions. Nested PCR is always at high risk of contamination. The newly developed Real-time PCR provides a means for faster and easier detection of B. miyamotoi. Conclusion Our findings consolidate the picture of a wide distribution of B. miyamotoi species within Europe. With this spirochete on the verge of being recognized as a novel pathogen, the development of a fast, sensitive and reliable detection system is important. In addition to tick screening, we therefore developed a real-time PCR capable of detecting B. miyamotoi. This method clearly identified B. miyamotoi from ticks that also tested positive in the nested PCR while not amplifying DNA of different Lyme and RF borreliae. The high sequence similarity with a sample isolated from a Dutch patient (Hovius et al., 2013) supports the view that B. miyamotoi might constitute a new emerging pathogen, at least for immunocompromised patients. It is evident, however, that further studies are needed to elucidate a role for B. miyamotoi as a pathogen. Acknowledgements We thank Dr. Volker Fingerle, National Reference Center for Borrelia in Germany, and Dr. Eva Ruzic-Sabljic, Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, Slovenia for contributing Borrelia strains, and Drs. Irina Korschineck and Claudia Schabereiter-Gurtner, Ingenetix, for valuable discussions. References Assous, M.V., Wilamowski, A., 2009. Relapsing fever borreliosis in Eurasia–forgotten, but certainly not gone! Clin. Microbiol. Infect. 15, 407–414. Barbour, A.G., Bunikis, J., Travinsky, B., Hoen, A.G., Diuk-Wasser, M.A., Fish, D., Tsao, J.I., 2009. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am. J. Trop. Med. Hyg. 81, 1120–1131. Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., Barbour, A.G., 2004a. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150, 1741–1755. Bunikis, J., Tsao, J., Garpmo, U., Berglund, J., Fish, D., Barbour, A.G., 2004b. Typing of Borrelia relapsing fever group strains. Emerg. Infect. Dis. 10, 1661–1664. Cochez, C., Heyman, P., Heylen, D., Fonville, M., Hengeveld, P., Takken, W., Simons, L., Sprong, H., 2014. The presence of Borrelia miyamotoi, a relapsing fever spirochaete, in questing Ixodes ricinus in Belgium and in The Netherlands. Zoonoses Public Health, http://dx.doi.org/10.1111/zph.12154 (Epub ahead of print). Davidson, B.E., MacDougall, J., Saint Girons, I., 1992. Physical map of the linear chromosome of the bacterium Borrelia burgdorferi 212, a causative agent of Lyme disease, and localization of rRNA genes. J. Bacteriol. 174, 3766–3774. Fomenko, N.V., Livanova, N.N., Borgoiakov, V., Kozlova, I.V., Shulaikina, I.V., Pukhovskaia, N.M., Tokarevich, K.N., Livanov, S.G., Doroshchenko, E.K., Ivanov, L.I., 2010. Detection of Borrelia miyamotoi in ticks Ixodes persulcatus from Russia. Parazitologiia 44, 201–211. Fonville, M., Friesema, I.H., Hengeveld, P.D., Docters van Leeuwen, A., Jahfari, S., Harms, M.G., van Vliet, A.J., Hofhuis, A., van Pelt, W., Sprong, H., van den Wijngaard, C.C., 2014. Human exposure to tickborne relapsing fever spirochete Borrelia miyamotoi, the Netherlands. Emerg. Infect. Dis. 20, 1244–1245.
Fraenkel, C.J., Garpmo, U., Berglund, J., 2002. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J. Clin. Microbiol. 40, 3308–3312. Fraser, C.M., Casjens, S., Huang, W.M., Sutton, G.G., Clayton, R., Lathigra, R., White, O., Ketchum, K.A., Dodson, R., Hickey, E.K., Gwinn, M., Dougherty, B., Tomb, J.F., Fleischmann, R.D., Richardson, D., Peterson, J., Kerlavage, A.R., Quackenbush, J., Salzberg, S., Hanson, M., van Vugt, R., Palmer, N., Adams, M.D., Gocayne, J., Weidman, J., Utterback, T., Watthey, L., McDonald, L., Artiach, P., Bowman, C., Garland, S., Fuji, C., Cotton, M.D., Horst, K., Roberts, K., Hatch, B., Smith, H.O., Venter, J.C., 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390 (6660), 580–586. Fukunaga, M., Hamase, A., Okada, K., Inoue, H., Tsuruta, Y., Miyamoto, K., Nakao, M., 1996. Characterization of spirochetes isolated from ticks (Ixodes tanuki, Ixodes turdus, and Ixodes columnae) and comparison of the sequences with those of Borrelia burgdorferi sensu lato strains. Appl. Environ. Microbiol. 62, 2338–2344. Fukunaga, M., Koreki, Y., 1995. The flagellin gene of Borrelia miyamotoi sp. nov. and its phylogenetic relationship among Borrelia species. FEMS Microbiol. Lett. 134, 255–258. Fukunaga, M., Takahashi, Y., Tsuruta, Y., Matsushita, O., Ralph, D., McClelland, M., Nakao, M., 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int. J. Syst. Bacteriol. 45, 804–810. Geller, J., Nazarova, L., Katargina, O., Jarvekulg, L., Fomenko, N., Golovljova, I., 2012. Detection and genetic characterization of relapsing fever spirochete Borrelia miyamotoi in Estonian ticks. PLoS ONE 7, e51914. Guy, E.C., Stanek, G., 1991. Detection of Borrelia burgdorferi in patients with Lyme disease by the polymerase chain reaction. J. Clin. Pathol. 44, 610–611. Hamer, S.A., Hickling, G.J., Keith, R., Sidge, J.L., Walker, E.D., Tsao, J.I., 2012. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, USA. Parasit. Vectors 5, 231. Hansford, K.M., Fonville, M., Jahfari, S., Sprong, H., Medlock, J.M., 2014. Borrelia miyamotoi in host-seeking Ixodes ricinus ticks in England. Epidemiol. Infect., 1–9 (Epub ahead of print). Hovius, J.W., de Wever, B., Sohne, M., Brouwer, M.C., Coumou, J., Wagemakers, A., Oei, A., Knol, H., Narasimhan, S., Hodiamont, C.J., Jahfari, S., Pals, S.T., Horlings, H.M., Fikrig, E., Sprong, H., van Oers, M.H., 2013. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet 382 (9892), 658. Krause, P.J., Narasimhan, S., Wormser, G.P., Rollend, L., Fikrig, E., Lepore, T., Barbour, A., Fish, D., 2013. Human Borrelia miyamotoi infection in the United States. N. Engl. J. Med. 368, 291–293. Liveris, D., Gazumyan, A., Schwartz, I., 1995. Molecular typing of Borrelia burgdorferi sensu lato by PCR-restriction fragment length polymorphism analysis. J. Clin. Microbiol. 33, 589–595. Mun, J., Eisen, R.J., Eisen, L., Lane, R.S., 2006. Detection of a Borrelia miyamotoi sensu lato relapsing-fever group spirochete from Ixodes pacificus in California. J. Med. Entomol. 43, 120–123. Platonov, A.E., Karan, L.S., Kolyasnikova, N.M., Makhneva, N.A., Toporkova, M.G., Maleev, V.V., Fish, D., Krause, P.J., 2011. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg. Infect. Dis. 17, 1816–1823. Ranka, R., Bormane, A., Salmina, K., Baumanis, V., 2004. Identification of three clinically relevant Borrelia burgdorferi sensu lato genospecies by PCR-restriction fragment length polymorphism analysis of 16S–23S ribosomal DNA spacer amplicons. J Clin Microbiol 42 (4), 1444–1449. Richter, D., Schlee, D.B., Matuschka, F.R., 2003. Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. Emerg. Infect. Dis. 9, 697–701. Rijpkema, S., Golubic, D., Molkenboer, M., Verbeek-De Kruif, N., Schellekens, J., 1996. Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp. Appl. Acarol. 20, 23–30. Schwan, T.G., Schrumpf, M.E., Hinnebusch, B.J., Anderson Jr., D.E., Konkel, M.E., 1996. GlpQ: an antigen for serological discrimination between relapsing fever and Lyme borreliosis. J. Clin. Microbiol. 34, 2483–2492. Schwartz, J.J., Gazumyan, A., Schwartz, I., 1992. rRNA gene organization in the Lyme disease spirochete, Borrelia burgdorferi. J. Bacteriol. 174, 3757–3765. Scoles, G.A., Papero, M., Beati, L., Fish, D., 2001. A relapsing fever group spirochete transmitted by Ixodes scapularis ticks. Vector Borne Zoonotic Dis. 1, 21–34. Stanek, G., Wormser, G.P., Gray, J., Strle, F., 2012. Lyme borreliosis. Lancet 379 (9814), 461–473. Ullmann, A.J., Gabitzsch, E.S., Schulze, T.L., Zeidner, N.S., Piesman, J., 2005. Three multiplex assays for detection of Borrelia burgdorferi sensu lato and Borrelia miyamotoi sensu lato in field-collected Ixodes nymphs in North America. J. Med. Entomol. 42, 1057–1062. Wang, G., van Dam, A.P., Schwartz, I., Dankert, J., 1999. Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications. Clin. Microbiol. Rev. 12, 633–653.
Please cite this article in press as: Reiter, M., et al., A newly established real-time PCR for detection of Borrelia miyamotoi in Ixodes ricinus ticks. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.002
