Fetal and Pediatric Pathology, 33:182–190, 2014 C Informa Healthcare USA, Inc. Copyright ISSN: 1551-3815 print / 1551-3823 online DOI: 10.3109/15513815.2014.890260
ORIGINAL ARTICLE
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
A Novel and a Previously Described Compound Heterozygous PKLR Gene Mutations Causing Pyruvate Kinase Deficiency in a Chinese Child Huimin Li, Ping Gu, Ru-en Yao, Jian Wang, Qihua Fu, and Jing Wang Department of Laboratory Medicine, Shanghai Jiaotong University School of Medicine, Shanghai, China
Background: Pyruvate kinase deficiency (PKD) is one of the most common enzymatic defects in humans and it is an autosomal recessive disorder causing chronic nonspherocytic hemolytic anemia. Methods: A two-year-old male baby with severe hemolytic anemia and low level of pyruvate kinase (PK) activity was enrolled in this study. All exons of PKLR gene and their flanking sequences were amplified from the patient’s genomic DNA using PCR. Bioinformatics software was used to evaluate the functional impacts of the mutations found in this study. Results: It was here demonstrated that the boy harbored a previously described mutation (c. 941T>C) in exon 7 and a novel mutation (c. 1183 G>C) in exon 9 of PKLR gene. Both mutations led to significant structural alterations and decreased enzymatic activity of PK, as predicted by tool software. Conclusions: The compound heterozygous mutations in the PKLR gene were the cause of inherited PKD for this patient. Keywords: pyruvate kinase deficiency, PKLR gene, mutation, chronic hemolytic anemia
INTRODUCTION Pyruvate kinase (PK) catalyzes the conversion of phosphoenolpyruvate to pyruvate. It is one of glycolytic reactions in erythrocyte resulting in the production of ATP. A discrepancy was observed between erythrocyte energy requirements and ATPgenerating capacity. This induces irreversible membrane injury, resulting in cellular distortion, rigidity and dehydration and leading to the destruction of defective erythrocytes by the spleen and liver. In this way, PK deficiency (PKD) affects erythrocyte function. Human erythrocyte PKD was first identified in the early 1960s. It is an enzyme disease of the glycolytic pathway. It is a rare autosomal recessive genetic disorder. The prevalence of PKD is about 51 cases per million among Caucasians, and the global incidence is unknown [1,2]. The clinical severity of this disorder varies widely, ranging from a mildly compensated anemia to severe anemia in childhood. Even within the same family, individuals can have different symptoms and different levels of severity [3,4]. Affected patients are usually homozygous or compound heterozygous for Received 11 August 2013; Revised 28 January 2014; accepted 29 January 2014. Address correspondence to Jing Wang, Department of Laboratory Medicine, Shanghai Children’s Medical Center, Shanghai Jiaotong University School of Medicine, 1678 Dong-fang Road, Shanghai 200127, China. Tel: +86–21–38625548. Fax: +86–21–58756923. E-mail:[email protected]
PKLR Gene Mutations Causing Pyruvate Kinase Deficiency
mutated versions of the PKLR gene. A total number of 240 mutations have been identified in PKD (http://www.lovd.nl/pklr). In this study, a compound heterozygous PKLR gene mutation, namely c. 941 T> C in exon 7 and c. 1183 G>C in exon 9, was identified in a Chinese baby boy with lifethreatening anemia.
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
MATERIALS AND METHODS Patients The patient enrolled in this study was a male Chinese baby born with neonatal edema and yellow skin. The gestational age at his birth was 38 weeks and his birth weight was 2985 g. Laboratory screening tests revealed high levels of jaundice and low levels of hemoglobin on the day of his birth. Serum total bilirubin, direct bilirubin, hemoglobin and hematocrit levels were 184.5 μmol/L (normal range was 1.7–17.1 μmol/L), 14.1 μmol/L (normal range 0–5 μmol/L), 89 g/L (normal range for newborns 170–200 g/L) and 27.1% (normal range was 33.0–47.3%), respectively. The blood group of infant’s mother was type O and the infant was type B. Although the Coombs’ test for this patient was negative, the IgG anti-B was eluted from patient’s red blood cells and was existed in the patient’s serum, indicated that the patient had ABO hemolytic diseases of newborn (ABO HDN). 50 hours after his birth, serum total bilirubin and direct bilirubin levels increased to 407.0 μmol/L and 29.5 μmol/L, respectively. While the hemoglobin and hematocrit levels decreased to 66 g/L and 20.5%, respectively. The infant experienced life-threatening hemolytic anemia, so exchange blood transfusion was arranged to remove the antibodies and increase the level of hemoglobin in his blood. Ten hours and 33 hours after exchange blood transfusion, the patient’s total bilirubin levels decreased to 233.7 μmol/L and 140.1 μmol/L, respectively. Over the next four months, the baby’s anemia persisted. He required transfusions of red blood cells once every month. This indicated that HDN was not the only cause of his anemia. Hematological screening tests were arranged. Erythrocyte morphology was abnormal. Polychromatophilia, anisocytosis and nucleated red blood cells were present in peripheral blood. Coombs’ test was negative. Enzyme biochemical tests showed that patient had low levels of PK activity. These results allowed the establishment of a diagnosis of PKD. Sample Collection and DNA Extraction Peripheral venous blood was collected from the patient and his family members with their informed consent. The samples were collected into 0.109 mol/L sodium citrate (9:1 v/v). Genomic DNA was extracted from whole blood using a Genomic DNA Purification Kit (Qiagen GmbH, Hilden, Germany) according to the manufactory’s instruction. Biochemical Analysis The PK activity levels of all family members were measured using colorimetry method (Pyruvate Kinase Assay Kit, Jiancheng Bioengineering Institute, Nanjing, China), as recommended by the International Council for Standardization in Hematology (ICSH). Hemoglobin concentrations and serum bilirubin levels were measured with an automatic hematological analyzer Sysmex XS-800i(Sysmex Corporation, Hyogo, Japan) and automatic biochemical analyzer Vitro 350 (Johnson and Johnson, NY, USA). Antibody screening tests for hemolytic disease were performed with a BioVue Ortho Micro-column (Johnson and Johnson, NJ, USA). C Informa Healthcare USA, Inc. Copyright
H. Li et al. Table 1. Exon E1 E3 E4–6 E7–8
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
E9–10 E11 E12
PCR primers of PKLR gene. Sequence
Length (bp)
F: gatgagaggaaatgccagga R: caccactgtctcctgttcca F: atatgcatgatgcccagctc R: cccaagggtagggatttttg F: agggaaggggagtctgtgat R: aaggtgtgatcggtctgagg F: gaggaggacatggttcctga R: cagcctggatgacagagtga F: ttcaggggttgtgactgtga R: gaatggacttgcctctgagc F: caccaaggcccagagaagta R: tgtggctatgctgatggaag F: ccaccacacccagctaattt R: ccaccacacccagctaattt
582 500 900 762 802 507 460
Genetic Analysis The PCR primers were designed according to the published PKLR sequence (GenBank Accession No. NG 011677.1) (Table 1). All of the exons and intron–exon boundaries of the PKLR gene, except for Exon 2, which encodes a liver-specific PK protein, were amplified with PCR Amplification Kit (Takara, Dalian, China). PCR was carried out for each fragment in a total volume of 50 μL containing about 100 ng of genomic DNA, 1×PCR buffer, 2 U Taq DNA polymerase, 2 μmol/L dNTP, 0.5 μmol of each primer and 1.5 mmol MgCl2 . The PCR conditions were as follows: 95◦ C for 5 minutes, then 30 cycles of denaturation at 95 ◦ C for 30 seconds, annealing at 59 ◦ C to 61 ◦ C for 30 seconds R pro thermal and extension at 72 ◦ C for 45 seconds with an Eppendorf Mastercycler cycler (Eppendorf, Hamburg, Germany). The PCR products were then sequenced on an ABI 3730 sequencer (Applied Biosystems, Foster City, CA, U.S.). Structural and Functional Analysis of Missense Mutations An online protein analysis software package, PyMOL (http://www.pymol.org), was used to evaluate the potential structural impacts of the nonsynonymous mutations identified in this study on the structures of the proteins. SIFT (http://sift. jcvi.org/www/SIFT dbSNP.html) and PolyPhen (http://genetics.bwh.harvard.edu/ pph2/index.shtml) were used to evaluate the functional effects of these mutations. RESULTS Phenotype Analysis Hematological screening tests showed that the patient had low levels of PK activity. After transfusion, the PK activity of the patient increased to 13.44 U/gHb from 5.02 U/gHb when he was five month old. The patient’s parents also showed low level of PK activity (Table 2), however, only the patient presented symptoms of hemolytic anemia. Genotype Analysis The patient had two heterozygous mutations in the PKLR gene: the previously described mutation [5] c. 941 T> C in exon 7 (Figure 1a) and a novel mutation c. 1183 G> C in exon 9 (Figure 1b). The c. 941 T> C mutation produced Ile314Thr substitution and c. 1183 G> C caused Val395Leu substitution. The patient inherited the compound heterozygous mutations from his parents. His father had the novel c. 1183 G> C mutation and his mother had c. 941 T> C mutation. The patient’s six year-old sister also had Fetal and Pediatric Pathology
57 121 129 119 129 170–200 (newborn) 110–160 (adult)
Hb (g/L)
Ret (%) 18.0 5.0 / / / 3–6 (newborn) 0.5–1.5 (adult)
Data collected on the 17th day post-transfusion; HA: hemolytic anemia.
5.02 13.44 10.18 7.06 11.7 17.17 ± 3.16
Patient Patient∗ Father Mother Sister Normal range
∗
PK activity (U/gHb)
Summary of clinical and laboratory data for the patient and his family members.
Individual
Table 2.
16.5 35.1 39.5 33.8 38.4 33.0–47.3
Hct (%) 95.8 89.7 82.8 90.4 83.1 78.5–92.3
MCV (fl)
29.8 29.2 27.3 31.6 27.9 26.9–33.3
MCH (pg)
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
311 328 329 349 336 322–362
MCHC (g/L)
yes no no no no /
HA
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
H. Li et al.
Figure 1. The results of PKLR gene sequencing analysis for the patient. a. Arrow indicated the T (red one) to C (blue one) heterozygous mutation (c. 941 T> C) in exon 7 of PKLR gene, which would cause Ile(ATT) to Thr(ACT) substitution (Ile314Thr) in the coding protein. b. Arrow indicated the G (black one) to C (blue one) heterozygous mutation (c. 1183 G> C) in exon 9 of PKLR gene, which would cause Val(GTG) to Leu(CTG) substitution (Val395Leu) in the coding protein.
the novel c. 1183 G> C mutation. The pedigree is shown in Figure 2. The possibility that the novel mutation might be a polymorphism was excluded through analysis of an additional 100 normal controls. Evaluation of Functional Impact Both missense mutations, Ile314Thr and Val395Leu, were in the hydrophobic core of the conserved A domain (Figure 3). Ile314Thr caused a hydrophobic to hydrophilic substitution, changing the structural integrity and stability of the molecule. Val395Leu introduced a bulkier aliphatic side chain that produced steric clashes with spatial adjacent residues, causing folding destabilization. Analysis performed using the software packages SIFT and PolyPhen indicated that the probability of damaging score of the novel mutation Val395Leu was 0.994 (sensitivity was 0.69 and specificity was 0.97). The Val395 in PK protein is highly conserved in many mammals (Figure 4). DISCUSSION PKD (OMIM 266200), inherited in an autosomal recessive mode, is one of the most common diseases of hereditary nonspherocytic hemolytic anemia. To date, more than 500 affected families have been described. Although PKD occurs worldwide, most cases have been reported in northern Europe, Japan and the United States [6]. PK (EC: 2.7.1.40) is a tetrameric enzyme and four different isozymes, R, L, M1 and M2, are expressed in mammals. These isozymes perform the same function but each isozyme is structurally unique and works in different tissues and organs. The redblood-cell-specific isozyme PK-R is encoded by the PKLR gene, which is located on chromosome 1q21. This gene also encodes the PK-L isozyme, which is predominantly Fetal and Pediatric Pathology
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
PKLR Gene Mutations Causing Pyruvate Kinase Deficiency
Figure 2. Pedigree of pyruvate kinase deficiency.
Figure 3. Close-up views of parts structure of the conserved A domain for PK protein. The yellow parts represent the α helix structures, the blue parts represent the ß sheet structures. A. The magenta indicated the Ile314 residue buried in the interior of the molecule. B. The magenta indicated the Val395 residue located at the C terminus of helix α7 with a side chain inserted between helix α7 and helix α8 of the A domain.
Human Rat Dog Rattus norvegicus Xenopus tropicalis
TRAETSDVANAVLDGADCIMLS TRAETSDVANAVLDGADCIMLS TRAETSDVANAVLDGADCIMLS TRAETSDVANAVLDGADCIMLS TRAEGSDVANAVLDGADCIMLS
Figure 4. Comparison of amino acid sequences in species at the sites of Val395.
C Informa Healthcare USA, Inc. Copyright
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
H. Li et al.
expressed in the liver. The PKLR gene consists of 12 exons and spans 9.5 kb. Exon 1 is erythrocyte-specific and exon 2 is liver-specific. The erythrocyte-specific mRNA is 2 kb in length and encodes a PK-R subunit of 574 amino acids. The two other isozymes, PKM1 and PK-M2, are produced from the PKM gene [7]. Each PK-R subunit can be divided into four domains: N-terminal (residues 57–84), A (residues 85–159 and 263–431), B (residues 160–262) and C (residues 432–574) [8]. The A domain is the most highly conserved, B and C domain are more variable [9]. The active site lies in a cleft between the A domain and the flexible B domain [7]. The C domain contains the binding site for fructose-1,6-bisphosphate (FBP). The A and C domains, together with the small N-terminal domain, form the main body of the subunit. The B domain is loosely packed to the rest of the molecule and adopts slightly different orientations in the four crystallographically independent polypeptide chains [8]. The clinical symptoms of PKD usually occur in compound heterozygotes and homozygotes [10]. The degree of hemolysis for PKD varies widely, ranging from very mild or fully compensated forms to life-threatening neonatal anemia and jaundice, necessitating exchange transfusions [11]. Newborns suffer from severe hemolytic crisis and hyperbilirubinemia [12]. Adults are at risk of infections because of asplenia, organ damage and systemic iron overload [13]. Severe individuals have life-threatening manifestations and require long-term transfusion therapy and splenectomy during early childhood [13]. While many mutations have been found in the PKLR gene, data on the relationship between the specific mutation and the severity of the disorder and on the relationship between the residual enzymatic activity and the severity of hemolysis are still rare [4, 11, 14]. It has been reported that mutations near the substrate and fructose 1,6-diphosphate binding site may change the conformation of the active site, resulting in very low PK activity and severe clinical symptoms [15]. In the present study, one previously described mutation and one novel mutation in PKLR gene were identified in the patient. These mutations caused Ile314Thr and Val395Leu substitution, respectively. Both were in the A domain, which is highly conserved in the PKLR gene. Upon analysis of the crystal structural details of human RPK (pdb: 2VGB), both of the heterozygous mutations (Ile314Thr and Val395Leu) are localized in the hydrophobic core of the A domain. Ile314 is essentially buried in the interior of the molecule and undergoes numerous hydrophobic contacts with spatial adjacent residues Val320, Phe323, Ile326, Ile333, Val335 and Leu340 in the interior of the A domain (β/α)8 barrel, as illustrated in Figure 3A. In this way, the impairment caused by Ile314Thr is mainly attributed to the different physicochemical properties of Ile, which is a hydrophobic residue, and of Thr, which is a hydrophilic residue. The hydrophobic to hydrophilic substitution disrupts the broad hydrophobic interaction network centered around Ile314 and might alter the structural integrity and stability of the molecule. The novel mutation Val395 was inspected. It is located at the C terminus of helix α7 with a side chain inserted between helix α7 and helix α8 of the A domain (Figure 3B). The replacement of the highly conserved Val395 with Leu, which has a bulkier aliphatic side chain, can cause steric clashes with spatial adjacent residues in such a tightly packed interior space. In this way, such amino acid replacement is unfavorable and can deform local structures, causing folding destabilization. The analysis given above may explain the significant decrease in PK activity and drastic reduction of stability, causing the very severe hemolytic anemia [11]. Analysis of the 3D structure of the enzyme may help in predicting the severity of the molecular defect. Further data on clinical features and mutation patterns may establish more precise correlations between genotype and phenotype [16,17]. A considerable number of different defects of the enzymes of the red blood cells can cause nonspherocytic hemolytic anemia. Currently, there is no definitive treatment for Fetal and Pediatric Pathology
PKLR Gene Mutations Causing Pyruvate Kinase Deficiency
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
severe PKD because the PK-R isoenzyme is not functionally compensated in the erythrocyte by PK-M isoenzymes. In most affected persons, PKD is detected during childhood, but in individuals who are only mildly affected, PKD may not be detected until late adulthood [18]. Red blood cell transfusion tends to occur during early childhood and during periods of physiological stress, such as during infection. Splenectomy is only clinically useful in patients with severe anemia. Hematopoietic stem cell (HSC) gene therapy might be a more effective treatment, and the gene repair strategy may be a feasible way to address enzyme defects [19]. Animal models of R-type PKD HSC have been attempted and the data indicate that this can produce partial correction of the disease [20,21].
ACKNOWLEDGMENTS We would like to thank the PKD patient and his family for participating in our study. We thank Min Wang (Ruijin hospital, Shanghai Jiaotong University School of Medicine) for providing the crystal structural analysis. Ethical Approval: The study was approved by the Ethical Committee of Shanghai Children’s Medical Center (Approval No. SCMCIRB-2012053) Contributors: Huiming Li collected the data and wrote the draft, Ping Gu, Ru-en Yao and Jian Wang analyzed data, Qihua Fu and Jing Wang designed the protocol and interpreted the results and edited the manuscript. All authors have approved the content of the manuscript.
Declaration of Interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. This study was supported by Shanghai Municipal Health Bureau “Excellent Academic Leader of Public Health” (No.GWDTR201226).
REFERENCES [1] Beutler E, Gelbart T. Estimating the prevalence of pyruvate kinase deficiency from the gene frequency in the general white population. Blood 2000;95(11):3585–3588. [2] Nestor W Meza, Maria E Alonso-Ferrero, Susana Navarro, et al. Rescue of pyruvate kinase deficiencyin mice by gene therapy using the human isoenzyme. Mol Ther 2009 (17):2000–2009. [3] Richard van Wijk, Wouter W. van Solinge, Claus Nerlov, et al. Disruption of a novel regulatory element in the erythroid-specific promoter of the human PKLR gene causes severe pyruvate kinase deficiency. Blood 2003;101(4):1596–1602. [4] Kugler W, Willaschek C, Holtz C, et al. Eight novel mutations and consequences of mRNA and protein level in pyruvate kinase deficient patients with nonspherocytic hemolytic anemia. Hum Mut 2000;15(3): 261–272. [5] Anna Demina, Kottayil I. Varughese, Jose Barbot, et al. Six previously undescribed pyruvate kinase mutations causing enzyme deficiency. Blood 1998;92(2): 647–652. [6] Carey PJ, Chandler J, Hendrick A, et al. Prevalence of pyruvate kinase deficiency in northern European population in the north of England. Northern Region Haematologists Group. Blood, 2000;96(12):4005–4006. [7] Richard van Wijk, Eric G Huizinga, Annet C.W. van Wesel, et al. Fifteen novel mutations in PKLR associated with pyruvate kinase (PK) deficiency: structural implications of amino acid substitutions in PK. Hum Mut 2009(30):446–453. [8] Valentini G, Chiarelli LR, Fortin R, et al. Structure and function of human erythrocyte pyruvate kinase: Molecular basis of nonspherocytic hemolytic anemia. J Biol Chem 2002;277(26):23807–23814. C Informa Healthcare USA, Inc. Copyright
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
H. Li et al.
[9] Enriqueta Munoz M, Ponce E. Pyruvate Kinase: current status of regulatory and functional properties. Comp Biochem Physiol B: Biochemistry and Molecular Biology 2003;135(2): 197–218. [10] Zanella A, Fermo E, Bianchi P, et al. Pyruvate kinase deficiency: the genotype-phenotype association. Blood Rev 2007;21(4):217–231. [11] Zanella A, Fermo E, Bianchi P, et al. Red cell pyruvate kinase deficiency: molecular and clinical aspects. Br J Haematol 2005;30(1):11–25. [12] Abdel Fattah M, Abdel Ghany E, Adel A, et al. Glucose-6-phosphate dehydrogenase and red cell pyruvate kinase deficiency in neonatal jaundice cases in egypt. Pediatr Hematol Oncol 2010;27(4):262–271. [13] Rider NL, Strauss KA, Brown K, et al. Erythrocyte pyruvate kinase deficiency in an old-order Amish cohort: longitudinal risk and disease management. Am J Hematol 2011;86(10):827–834. [14] Yavarian M, Karimi M, Shahriary M, et al. Prevalence of pyruvate kinase deficiency among the south Iranian population: quantitative assay and molecular analysis. Blood Cells Mol Dis 2008;40(3):308–311. [15] Kedar P, Hamada T, Warang P, et al. Spectrum of novel mutations in the human PKLR gene in pyruvate kinase-deficient Indian patients with heterogeneous clinical phenotypes. Clin Genet 2009;75(2):157–162. [16] Zanella A, Bianchi P. Red cell pyruvate kinase deficiency: from genetics to clinical manifestations. Clin Haematol 2000;13(1):57–81. [17] Rajith B, George Priya Doss C. Path to facilitate the prediction of functional amino acid substitutions in red blood cell disorders – A computational approach. PLoS One 2011;6(9):e24607. [18] Titapiwatanakun R, Hoyer JD, Crain K, et al. Relative red blood cell enzyme levels as a clue to the diagnosis of pyruvate kinase deficiency. Pediatr Blood Cancer 2008;51(6):819–821. [19] Alberto Zanella, Paola Bianchi, Elisa Fermo. Pyruvate kinase deficiency. Haematologica /the hematol J, 2007;92(6):721–723. [20] Kanno H, Utsugisawa T, Aizawa S, et al. Transgenic rescue of hemolytic anemia due to red blood cell pyruvate kinase deficiency. Hematologica 2007;92(6):731–737. [21] Nestor W Meza, Maria E Alonso-Ferrero, Susana Navarro, et al. Rescue of pyruvate kinase deficiency in mice by gene therapy using the human isoenzyme. Mol Ther 2009;17(12):2000–2009.
Fetal and Pediatric Pathology
ORIGINAL ARTICLE
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
A Novel and a Previously Described Compound Heterozygous PKLR Gene Mutations Causing Pyruvate Kinase Deficiency in a Chinese Child Huimin Li, Ping Gu, Ru-en Yao, Jian Wang, Qihua Fu, and Jing Wang Department of Laboratory Medicine, Shanghai Jiaotong University School of Medicine, Shanghai, China
Background: Pyruvate kinase deficiency (PKD) is one of the most common enzymatic defects in humans and it is an autosomal recessive disorder causing chronic nonspherocytic hemolytic anemia. Methods: A two-year-old male baby with severe hemolytic anemia and low level of pyruvate kinase (PK) activity was enrolled in this study. All exons of PKLR gene and their flanking sequences were amplified from the patient’s genomic DNA using PCR. Bioinformatics software was used to evaluate the functional impacts of the mutations found in this study. Results: It was here demonstrated that the boy harbored a previously described mutation (c. 941T>C) in exon 7 and a novel mutation (c. 1183 G>C) in exon 9 of PKLR gene. Both mutations led to significant structural alterations and decreased enzymatic activity of PK, as predicted by tool software. Conclusions: The compound heterozygous mutations in the PKLR gene were the cause of inherited PKD for this patient. Keywords: pyruvate kinase deficiency, PKLR gene, mutation, chronic hemolytic anemia
INTRODUCTION Pyruvate kinase (PK) catalyzes the conversion of phosphoenolpyruvate to pyruvate. It is one of glycolytic reactions in erythrocyte resulting in the production of ATP. A discrepancy was observed between erythrocyte energy requirements and ATPgenerating capacity. This induces irreversible membrane injury, resulting in cellular distortion, rigidity and dehydration and leading to the destruction of defective erythrocytes by the spleen and liver. In this way, PK deficiency (PKD) affects erythrocyte function. Human erythrocyte PKD was first identified in the early 1960s. It is an enzyme disease of the glycolytic pathway. It is a rare autosomal recessive genetic disorder. The prevalence of PKD is about 51 cases per million among Caucasians, and the global incidence is unknown [1,2]. The clinical severity of this disorder varies widely, ranging from a mildly compensated anemia to severe anemia in childhood. Even within the same family, individuals can have different symptoms and different levels of severity [3,4]. Affected patients are usually homozygous or compound heterozygous for Received 11 August 2013; Revised 28 January 2014; accepted 29 January 2014. Address correspondence to Jing Wang, Department of Laboratory Medicine, Shanghai Children’s Medical Center, Shanghai Jiaotong University School of Medicine, 1678 Dong-fang Road, Shanghai 200127, China. Tel: +86–21–38625548. Fax: +86–21–58756923. E-mail:[email protected]
PKLR Gene Mutations Causing Pyruvate Kinase Deficiency
mutated versions of the PKLR gene. A total number of 240 mutations have been identified in PKD (http://www.lovd.nl/pklr). In this study, a compound heterozygous PKLR gene mutation, namely c. 941 T> C in exon 7 and c. 1183 G>C in exon 9, was identified in a Chinese baby boy with lifethreatening anemia.
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
MATERIALS AND METHODS Patients The patient enrolled in this study was a male Chinese baby born with neonatal edema and yellow skin. The gestational age at his birth was 38 weeks and his birth weight was 2985 g. Laboratory screening tests revealed high levels of jaundice and low levels of hemoglobin on the day of his birth. Serum total bilirubin, direct bilirubin, hemoglobin and hematocrit levels were 184.5 μmol/L (normal range was 1.7–17.1 μmol/L), 14.1 μmol/L (normal range 0–5 μmol/L), 89 g/L (normal range for newborns 170–200 g/L) and 27.1% (normal range was 33.0–47.3%), respectively. The blood group of infant’s mother was type O and the infant was type B. Although the Coombs’ test for this patient was negative, the IgG anti-B was eluted from patient’s red blood cells and was existed in the patient’s serum, indicated that the patient had ABO hemolytic diseases of newborn (ABO HDN). 50 hours after his birth, serum total bilirubin and direct bilirubin levels increased to 407.0 μmol/L and 29.5 μmol/L, respectively. While the hemoglobin and hematocrit levels decreased to 66 g/L and 20.5%, respectively. The infant experienced life-threatening hemolytic anemia, so exchange blood transfusion was arranged to remove the antibodies and increase the level of hemoglobin in his blood. Ten hours and 33 hours after exchange blood transfusion, the patient’s total bilirubin levels decreased to 233.7 μmol/L and 140.1 μmol/L, respectively. Over the next four months, the baby’s anemia persisted. He required transfusions of red blood cells once every month. This indicated that HDN was not the only cause of his anemia. Hematological screening tests were arranged. Erythrocyte morphology was abnormal. Polychromatophilia, anisocytosis and nucleated red blood cells were present in peripheral blood. Coombs’ test was negative. Enzyme biochemical tests showed that patient had low levels of PK activity. These results allowed the establishment of a diagnosis of PKD. Sample Collection and DNA Extraction Peripheral venous blood was collected from the patient and his family members with their informed consent. The samples were collected into 0.109 mol/L sodium citrate (9:1 v/v). Genomic DNA was extracted from whole blood using a Genomic DNA Purification Kit (Qiagen GmbH, Hilden, Germany) according to the manufactory’s instruction. Biochemical Analysis The PK activity levels of all family members were measured using colorimetry method (Pyruvate Kinase Assay Kit, Jiancheng Bioengineering Institute, Nanjing, China), as recommended by the International Council for Standardization in Hematology (ICSH). Hemoglobin concentrations and serum bilirubin levels were measured with an automatic hematological analyzer Sysmex XS-800i(Sysmex Corporation, Hyogo, Japan) and automatic biochemical analyzer Vitro 350 (Johnson and Johnson, NY, USA). Antibody screening tests for hemolytic disease were performed with a BioVue Ortho Micro-column (Johnson and Johnson, NJ, USA). C Informa Healthcare USA, Inc. Copyright
H. Li et al. Table 1. Exon E1 E3 E4–6 E7–8
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
E9–10 E11 E12
PCR primers of PKLR gene. Sequence
Length (bp)
F: gatgagaggaaatgccagga R: caccactgtctcctgttcca F: atatgcatgatgcccagctc R: cccaagggtagggatttttg F: agggaaggggagtctgtgat R: aaggtgtgatcggtctgagg F: gaggaggacatggttcctga R: cagcctggatgacagagtga F: ttcaggggttgtgactgtga R: gaatggacttgcctctgagc F: caccaaggcccagagaagta R: tgtggctatgctgatggaag F: ccaccacacccagctaattt R: ccaccacacccagctaattt
582 500 900 762 802 507 460
Genetic Analysis The PCR primers were designed according to the published PKLR sequence (GenBank Accession No. NG 011677.1) (Table 1). All of the exons and intron–exon boundaries of the PKLR gene, except for Exon 2, which encodes a liver-specific PK protein, were amplified with PCR Amplification Kit (Takara, Dalian, China). PCR was carried out for each fragment in a total volume of 50 μL containing about 100 ng of genomic DNA, 1×PCR buffer, 2 U Taq DNA polymerase, 2 μmol/L dNTP, 0.5 μmol of each primer and 1.5 mmol MgCl2 . The PCR conditions were as follows: 95◦ C for 5 minutes, then 30 cycles of denaturation at 95 ◦ C for 30 seconds, annealing at 59 ◦ C to 61 ◦ C for 30 seconds R pro thermal and extension at 72 ◦ C for 45 seconds with an Eppendorf Mastercycler cycler (Eppendorf, Hamburg, Germany). The PCR products were then sequenced on an ABI 3730 sequencer (Applied Biosystems, Foster City, CA, U.S.). Structural and Functional Analysis of Missense Mutations An online protein analysis software package, PyMOL (http://www.pymol.org), was used to evaluate the potential structural impacts of the nonsynonymous mutations identified in this study on the structures of the proteins. SIFT (http://sift. jcvi.org/www/SIFT dbSNP.html) and PolyPhen (http://genetics.bwh.harvard.edu/ pph2/index.shtml) were used to evaluate the functional effects of these mutations. RESULTS Phenotype Analysis Hematological screening tests showed that the patient had low levels of PK activity. After transfusion, the PK activity of the patient increased to 13.44 U/gHb from 5.02 U/gHb when he was five month old. The patient’s parents also showed low level of PK activity (Table 2), however, only the patient presented symptoms of hemolytic anemia. Genotype Analysis The patient had two heterozygous mutations in the PKLR gene: the previously described mutation [5] c. 941 T> C in exon 7 (Figure 1a) and a novel mutation c. 1183 G> C in exon 9 (Figure 1b). The c. 941 T> C mutation produced Ile314Thr substitution and c. 1183 G> C caused Val395Leu substitution. The patient inherited the compound heterozygous mutations from his parents. His father had the novel c. 1183 G> C mutation and his mother had c. 941 T> C mutation. The patient’s six year-old sister also had Fetal and Pediatric Pathology
57 121 129 119 129 170–200 (newborn) 110–160 (adult)
Hb (g/L)
Ret (%) 18.0 5.0 / / / 3–6 (newborn) 0.5–1.5 (adult)
Data collected on the 17th day post-transfusion; HA: hemolytic anemia.
5.02 13.44 10.18 7.06 11.7 17.17 ± 3.16
Patient Patient∗ Father Mother Sister Normal range
∗
PK activity (U/gHb)
Summary of clinical and laboratory data for the patient and his family members.
Individual
Table 2.
16.5 35.1 39.5 33.8 38.4 33.0–47.3
Hct (%) 95.8 89.7 82.8 90.4 83.1 78.5–92.3
MCV (fl)
29.8 29.2 27.3 31.6 27.9 26.9–33.3
MCH (pg)
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
311 328 329 349 336 322–362
MCHC (g/L)
yes no no no no /
HA
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
H. Li et al.
Figure 1. The results of PKLR gene sequencing analysis for the patient. a. Arrow indicated the T (red one) to C (blue one) heterozygous mutation (c. 941 T> C) in exon 7 of PKLR gene, which would cause Ile(ATT) to Thr(ACT) substitution (Ile314Thr) in the coding protein. b. Arrow indicated the G (black one) to C (blue one) heterozygous mutation (c. 1183 G> C) in exon 9 of PKLR gene, which would cause Val(GTG) to Leu(CTG) substitution (Val395Leu) in the coding protein.
the novel c. 1183 G> C mutation. The pedigree is shown in Figure 2. The possibility that the novel mutation might be a polymorphism was excluded through analysis of an additional 100 normal controls. Evaluation of Functional Impact Both missense mutations, Ile314Thr and Val395Leu, were in the hydrophobic core of the conserved A domain (Figure 3). Ile314Thr caused a hydrophobic to hydrophilic substitution, changing the structural integrity and stability of the molecule. Val395Leu introduced a bulkier aliphatic side chain that produced steric clashes with spatial adjacent residues, causing folding destabilization. Analysis performed using the software packages SIFT and PolyPhen indicated that the probability of damaging score of the novel mutation Val395Leu was 0.994 (sensitivity was 0.69 and specificity was 0.97). The Val395 in PK protein is highly conserved in many mammals (Figure 4). DISCUSSION PKD (OMIM 266200), inherited in an autosomal recessive mode, is one of the most common diseases of hereditary nonspherocytic hemolytic anemia. To date, more than 500 affected families have been described. Although PKD occurs worldwide, most cases have been reported in northern Europe, Japan and the United States [6]. PK (EC: 2.7.1.40) is a tetrameric enzyme and four different isozymes, R, L, M1 and M2, are expressed in mammals. These isozymes perform the same function but each isozyme is structurally unique and works in different tissues and organs. The redblood-cell-specific isozyme PK-R is encoded by the PKLR gene, which is located on chromosome 1q21. This gene also encodes the PK-L isozyme, which is predominantly Fetal and Pediatric Pathology
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
PKLR Gene Mutations Causing Pyruvate Kinase Deficiency
Figure 2. Pedigree of pyruvate kinase deficiency.
Figure 3. Close-up views of parts structure of the conserved A domain for PK protein. The yellow parts represent the α helix structures, the blue parts represent the ß sheet structures. A. The magenta indicated the Ile314 residue buried in the interior of the molecule. B. The magenta indicated the Val395 residue located at the C terminus of helix α7 with a side chain inserted between helix α7 and helix α8 of the A domain.
Human Rat Dog Rattus norvegicus Xenopus tropicalis
TRAETSDVANAVLDGADCIMLS TRAETSDVANAVLDGADCIMLS TRAETSDVANAVLDGADCIMLS TRAETSDVANAVLDGADCIMLS TRAEGSDVANAVLDGADCIMLS
Figure 4. Comparison of amino acid sequences in species at the sites of Val395.
C Informa Healthcare USA, Inc. Copyright
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
H. Li et al.
expressed in the liver. The PKLR gene consists of 12 exons and spans 9.5 kb. Exon 1 is erythrocyte-specific and exon 2 is liver-specific. The erythrocyte-specific mRNA is 2 kb in length and encodes a PK-R subunit of 574 amino acids. The two other isozymes, PKM1 and PK-M2, are produced from the PKM gene [7]. Each PK-R subunit can be divided into four domains: N-terminal (residues 57–84), A (residues 85–159 and 263–431), B (residues 160–262) and C (residues 432–574) [8]. The A domain is the most highly conserved, B and C domain are more variable [9]. The active site lies in a cleft between the A domain and the flexible B domain [7]. The C domain contains the binding site for fructose-1,6-bisphosphate (FBP). The A and C domains, together with the small N-terminal domain, form the main body of the subunit. The B domain is loosely packed to the rest of the molecule and adopts slightly different orientations in the four crystallographically independent polypeptide chains [8]. The clinical symptoms of PKD usually occur in compound heterozygotes and homozygotes [10]. The degree of hemolysis for PKD varies widely, ranging from very mild or fully compensated forms to life-threatening neonatal anemia and jaundice, necessitating exchange transfusions [11]. Newborns suffer from severe hemolytic crisis and hyperbilirubinemia [12]. Adults are at risk of infections because of asplenia, organ damage and systemic iron overload [13]. Severe individuals have life-threatening manifestations and require long-term transfusion therapy and splenectomy during early childhood [13]. While many mutations have been found in the PKLR gene, data on the relationship between the specific mutation and the severity of the disorder and on the relationship between the residual enzymatic activity and the severity of hemolysis are still rare [4, 11, 14]. It has been reported that mutations near the substrate and fructose 1,6-diphosphate binding site may change the conformation of the active site, resulting in very low PK activity and severe clinical symptoms [15]. In the present study, one previously described mutation and one novel mutation in PKLR gene were identified in the patient. These mutations caused Ile314Thr and Val395Leu substitution, respectively. Both were in the A domain, which is highly conserved in the PKLR gene. Upon analysis of the crystal structural details of human RPK (pdb: 2VGB), both of the heterozygous mutations (Ile314Thr and Val395Leu) are localized in the hydrophobic core of the A domain. Ile314 is essentially buried in the interior of the molecule and undergoes numerous hydrophobic contacts with spatial adjacent residues Val320, Phe323, Ile326, Ile333, Val335 and Leu340 in the interior of the A domain (β/α)8 barrel, as illustrated in Figure 3A. In this way, the impairment caused by Ile314Thr is mainly attributed to the different physicochemical properties of Ile, which is a hydrophobic residue, and of Thr, which is a hydrophilic residue. The hydrophobic to hydrophilic substitution disrupts the broad hydrophobic interaction network centered around Ile314 and might alter the structural integrity and stability of the molecule. The novel mutation Val395 was inspected. It is located at the C terminus of helix α7 with a side chain inserted between helix α7 and helix α8 of the A domain (Figure 3B). The replacement of the highly conserved Val395 with Leu, which has a bulkier aliphatic side chain, can cause steric clashes with spatial adjacent residues in such a tightly packed interior space. In this way, such amino acid replacement is unfavorable and can deform local structures, causing folding destabilization. The analysis given above may explain the significant decrease in PK activity and drastic reduction of stability, causing the very severe hemolytic anemia [11]. Analysis of the 3D structure of the enzyme may help in predicting the severity of the molecular defect. Further data on clinical features and mutation patterns may establish more precise correlations between genotype and phenotype [16,17]. A considerable number of different defects of the enzymes of the red blood cells can cause nonspherocytic hemolytic anemia. Currently, there is no definitive treatment for Fetal and Pediatric Pathology
PKLR Gene Mutations Causing Pyruvate Kinase Deficiency
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
severe PKD because the PK-R isoenzyme is not functionally compensated in the erythrocyte by PK-M isoenzymes. In most affected persons, PKD is detected during childhood, but in individuals who are only mildly affected, PKD may not be detected until late adulthood [18]. Red blood cell transfusion tends to occur during early childhood and during periods of physiological stress, such as during infection. Splenectomy is only clinically useful in patients with severe anemia. Hematopoietic stem cell (HSC) gene therapy might be a more effective treatment, and the gene repair strategy may be a feasible way to address enzyme defects [19]. Animal models of R-type PKD HSC have been attempted and the data indicate that this can produce partial correction of the disease [20,21].
ACKNOWLEDGMENTS We would like to thank the PKD patient and his family for participating in our study. We thank Min Wang (Ruijin hospital, Shanghai Jiaotong University School of Medicine) for providing the crystal structural analysis. Ethical Approval: The study was approved by the Ethical Committee of Shanghai Children’s Medical Center (Approval No. SCMCIRB-2012053) Contributors: Huiming Li collected the data and wrote the draft, Ping Gu, Ru-en Yao and Jian Wang analyzed data, Qihua Fu and Jing Wang designed the protocol and interpreted the results and edited the manuscript. All authors have approved the content of the manuscript.
Declaration of Interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. This study was supported by Shanghai Municipal Health Bureau “Excellent Academic Leader of Public Health” (No.GWDTR201226).
REFERENCES [1] Beutler E, Gelbart T. Estimating the prevalence of pyruvate kinase deficiency from the gene frequency in the general white population. Blood 2000;95(11):3585–3588. [2] Nestor W Meza, Maria E Alonso-Ferrero, Susana Navarro, et al. Rescue of pyruvate kinase deficiencyin mice by gene therapy using the human isoenzyme. Mol Ther 2009 (17):2000–2009. [3] Richard van Wijk, Wouter W. van Solinge, Claus Nerlov, et al. Disruption of a novel regulatory element in the erythroid-specific promoter of the human PKLR gene causes severe pyruvate kinase deficiency. Blood 2003;101(4):1596–1602. [4] Kugler W, Willaschek C, Holtz C, et al. Eight novel mutations and consequences of mRNA and protein level in pyruvate kinase deficient patients with nonspherocytic hemolytic anemia. Hum Mut 2000;15(3): 261–272. [5] Anna Demina, Kottayil I. Varughese, Jose Barbot, et al. Six previously undescribed pyruvate kinase mutations causing enzyme deficiency. Blood 1998;92(2): 647–652. [6] Carey PJ, Chandler J, Hendrick A, et al. Prevalence of pyruvate kinase deficiency in northern European population in the north of England. Northern Region Haematologists Group. Blood, 2000;96(12):4005–4006. [7] Richard van Wijk, Eric G Huizinga, Annet C.W. van Wesel, et al. Fifteen novel mutations in PKLR associated with pyruvate kinase (PK) deficiency: structural implications of amino acid substitutions in PK. Hum Mut 2009(30):446–453. [8] Valentini G, Chiarelli LR, Fortin R, et al. Structure and function of human erythrocyte pyruvate kinase: Molecular basis of nonspherocytic hemolytic anemia. J Biol Chem 2002;277(26):23807–23814. C Informa Healthcare USA, Inc. Copyright
Fetal Pediatr Pathol Downloaded from informahealthcare.com by Yale Dermatologic Surgery on 09/30/14 For personal use only.
H. Li et al.
[9] Enriqueta Munoz M, Ponce E. Pyruvate Kinase: current status of regulatory and functional properties. Comp Biochem Physiol B: Biochemistry and Molecular Biology 2003;135(2): 197–218. [10] Zanella A, Fermo E, Bianchi P, et al. Pyruvate kinase deficiency: the genotype-phenotype association. Blood Rev 2007;21(4):217–231. [11] Zanella A, Fermo E, Bianchi P, et al. Red cell pyruvate kinase deficiency: molecular and clinical aspects. Br J Haematol 2005;30(1):11–25. [12] Abdel Fattah M, Abdel Ghany E, Adel A, et al. Glucose-6-phosphate dehydrogenase and red cell pyruvate kinase deficiency in neonatal jaundice cases in egypt. Pediatr Hematol Oncol 2010;27(4):262–271. [13] Rider NL, Strauss KA, Brown K, et al. Erythrocyte pyruvate kinase deficiency in an old-order Amish cohort: longitudinal risk and disease management. Am J Hematol 2011;86(10):827–834. [14] Yavarian M, Karimi M, Shahriary M, et al. Prevalence of pyruvate kinase deficiency among the south Iranian population: quantitative assay and molecular analysis. Blood Cells Mol Dis 2008;40(3):308–311. [15] Kedar P, Hamada T, Warang P, et al. Spectrum of novel mutations in the human PKLR gene in pyruvate kinase-deficient Indian patients with heterogeneous clinical phenotypes. Clin Genet 2009;75(2):157–162. [16] Zanella A, Bianchi P. Red cell pyruvate kinase deficiency: from genetics to clinical manifestations. Clin Haematol 2000;13(1):57–81. [17] Rajith B, George Priya Doss C. Path to facilitate the prediction of functional amino acid substitutions in red blood cell disorders – A computational approach. PLoS One 2011;6(9):e24607. [18] Titapiwatanakun R, Hoyer JD, Crain K, et al. Relative red blood cell enzyme levels as a clue to the diagnosis of pyruvate kinase deficiency. Pediatr Blood Cancer 2008;51(6):819–821. [19] Alberto Zanella, Paola Bianchi, Elisa Fermo. Pyruvate kinase deficiency. Haematologica /the hematol J, 2007;92(6):721–723. [20] Kanno H, Utsugisawa T, Aizawa S, et al. Transgenic rescue of hemolytic anemia due to red blood cell pyruvate kinase deficiency. Hematologica 2007;92(6):731–737. [21] Nestor W Meza, Maria E Alonso-Ferrero, Susana Navarro, et al. Rescue of pyruvate kinase deficiency in mice by gene therapy using the human isoenzyme. Mol Ther 2009;17(12):2000–2009.
Fetal and Pediatric Pathology
