Bone 64 (2014) 115–123

Contents lists available at ScienceDirect

Bone journal homepage: www.elsevier.com/locate/bone

Original Full Length Article

A novel calcium supplement prepared by phytoferritin nanocages protects against absorption inhibitors through a unique pathway Meiliang Li a,b, Tuo Zhang a, Haixia Yang a,c, Guanghua Zhao a,⁎, Chuanshan Xu d,⁎⁎ a CAU & ACC Joint-Laboratory of Space Food, College of Food Science and Nutritional Engineering, China Agricultural University, Key Laboratory of Functional Dairy, Ministry of Education, Beijing 100083, China b College of Food Science, Sichuan Agricultural University, Yaan, 625014 Sichuan, China c Nutrition and Food Safety Engineering Research Center of Shaanxi Province, Department of Public Health, School of Medicine, Xi'an Jiaotong University, Xi'an 710061, China d School of Chinese Medicine (SCM), Chinese University of Hong Kong, Hong Kong, China

a r t i c l e

i n f o

Article history: Received 1 January 2014 Revised 31 March 2014 Accepted 3 April 2014 Available online 13 April 2014 Editor by: Peter Ebeling Keywords: Calcium-containing phytoferritin Caco-2 cells Cell culture TfR1 Calcium supplement

a b s t r a c t The consumption of milk is declining in industrialized countries, leading to inadequate calcium intake. Therefore, it is important to explore a new class of Ca-enriched nutrient for the fortification of food. In this work, we prepared a novel class of soluble and edible Ca–protein complexes where approximately 140 calcium ions were encapsulated within a phytoferritin nanocage. As an alternative to other organic and/or inorganic carriers, protein nanocages were found to provide a unique vehicle of biological origin for the intracellular delivery of calcium ions for supplementation. Such encapsulation can protect calcium ions within protein cages against dietary factors such as tannic acid (TA), oxalic acid (OA), and other divalent metal ions in foodstuffs. We demonstrated that the calcium-containing ferritin composites can be absorbed by Caco-2 cells through a process where a TfR1 receptor is involved, whereas the uptake of free calcium ions has been known to be associated with another receptor, DMT1, indicating that the calcium ions encapsulated in supramolecular protein cages can be internalized by the Caco-2 cells through a different pathway from its free analogs for calcium supplementation. © 2014 Elsevier Inc. All rights reserved.

Introduction Calcium is an essential nutrient required for critical biological functions such as nerve conduction, muscle contraction, mitosis, blood coagulation, and structural support of the skeleton. Therefore, dietary calcium intake is of general interest for human beings, but particularly for infants and young children in the first years of life and puberty, when growth is accelerated [1–6]. Low dietary intake of calcium is also associated with higher risks of osteoporosis, colon cancer and hypertension [7]. Dairy products are a good source of bioavailable calcium and can be obtained at a low cost in relation to their nutritional value [8,9]. However, it has been reported that the consumption of milk is declining in industrialized countries, leading to inadequate calcium intake [10]. Additionally, the dairy products are not suitable for strict vegetarians. Moreover, in the less developed countries such as China and India, especially in rural areas, the consumption of milk is much lower than that in developed ones [11]. Currently, a large percentage of the population in most countries does not consume the recommended amount of calcium and thus is encouraged to increase their intake. This is one important reason why ⁎ Corresponding author. Fax: +86 10 62738737. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (G. Zhao), [email protected] (C. Xu).

http://dx.doi.org/10.1016/j.bone.2014.04.006 8756-3282/© 2014 Elsevier Inc. All rights reserved.

the food industry has developed calcium-fortified foods to secure adequate calcium intake. In clinical studies carried out in humans, the efficacy of dietary calcium fortification has been demonstrated by an improvement in calcium balance and fractional calcium absorption when the mineral intake increases. Fortification of food with Ca-enriched nutrients has traditionally not been taken into account with regard to its possible negative interactions with other nutrients. For example, calcium ions have been reported to have a negative effect on iron and zinc uptake [12–14], because DMT1 located in the small intestinal is a common receptor for these divalent metal ions [15]. Also, dietary factors such as tannins and oxalate greatly inhibit calcium uptake [16,17]. Thus a new class of Ca-enriched nutrient for the fortification of food which can overcome these shortcomings has the potential to improve calcium nutrition. One approach in solving the above mentioned problems is to prepare a new class of active calcium complexes by identifying novel edible materials that can be utilized as building blocks. The widespread occurrence and shell-like structure of ferritin provide such a good opportunity to make new calcium complexes. Herein, we report the first case of using a natural soybean seed ferritin nanocage to prepare such Caenriched complexes for supplementation. Ferritin is a ubiquitous iron storage protein that plays a crucial role in intracellular iron homeostasis [18,19]. Its three-dimensional structure is highly conserved among plants, animals, and bacteria. As shown in Fig. 1A, all ferritins have 24

116

M. Li et al. / Bone 64 (2014) 115–123

Fig. 1. 3D structure of phytoferritin with views down the 4-fold axes (channels) of the protein shell (A), and the scheme of design and synthesis of edible Ca–SSF complexes (B).

similar or identical subunits arranged in a 432 symmetry resulting in a hollow protein shell (the outer diameter is 12–13 nm and the inner diameter is 7–8 nm) where ∼4500 Fe atoms can be stored as inorganic complexes. Structural analyses indicate that each subunit consists of a four-α-helix bundle containing two antiparallel helix pairs (A, B and C, D), and a fifth short helix (E helix). The E helix lies at one end of the bundle at 60° to its axis. There are narrow channels along the threefold axes connecting the cavity and the protein exterior, through which iron ions pass into the cavity. In vertebrates, ferritins consist of two types of subunits, H and L. The H subunit has a dinuclear ferroxidase center which catalyzes the rapid oxidation of ferrous ion to ferric ion, while the L subunit lacks such a ferroxidase center but contains a putative nucleation site responsible for slower iron oxidation and mineralization [18]. In the assembled ferritin, the negative charge presents itself on the interior surface as clusters of acidic residues (Glu and Asp) that comprise the mineral nucleation site [18,19]. In contrast to animal ferritin, phytoferritin exhibits different structural features. First, only the H subunit has been identified in phytoferritin thus far. Second, all known naturally occurring phytoferritin is usually composed of two different types of H subunits, H-1 and H-2. The ratio of H-1 to H-2 varies depending on the source. The amino acids involved in the definition of the ferroxidase center are strictly conserved in all reported phytoferritins. Third, in a mature phytoferritin molecule, there are 24 EP domains located on its outer surface [20]. Recent studies from our group have revealed that the EP domains play an important role in iron into and out of phytoferritin [21]. The iron cores in ferritin can be removed easily by dialysis against a solution containing a reducing agent. Ferritin without a ferrihydrite core is called apoferritin, whose exterior and interior surfaces are amenable to both genetic and chemical modifications [20]. Iron oxide nanoparticles have been artificially synthesized in the interior cavity of apoferritin cages in the 1990s [22]. These nanoparticles are almost indistinguishable from the naturally formed iron oxide cores in the complete protein (holoferritin). This pioneering work has opened a new avenue for fabricating nanoparticles using biomimetic processes. Aside from iron oxides, a variety of inorganic nanoparticles have also been synthesized within the ferritin cage based on similar biomimetic strategies [23]. However, the use of ferritin as building blocks

to construct metal–protein complexes for the purpose of human nutrition has, to the best of our knowledge, never been reported. In the present study, we designed and synthesized a novel class of soluble and edible Ca–protein complexes (Fig. 1B) where approximately 140 calcium ions were encapsulated within a phytoferritin nanocage (Fig. 1A). Cell experimental results found that these new complexes have the following advantages over traditional Ca complexes: (1) several factors such as tannic acid (TA), oxalic acid (OA), and zinc ions almost have no effect on calcium uptake from these new complexes, in which they usually have a strong inhibitory effect on calcium absorption; and (2) the complexes could be absorbed by Caco-2 cells in a newly TfR-1 involved pathway different from a known DMT1-mediated one for divalent ions, and therefore calcium ions encapsulated within ferritin do not interfere with absorption of other divalent ion minerals. Materials and methods Materials Dried soybean seeds were obtained from the local market. 3-(NMorpholino) propanesulfonic acid (MOPS) was obtained from Amresco (USA). Ferrous sulfate, sodium dithionite, and 2,2′-bipyridyl were obtained from Sigma-Aldrich Co. (Beijing, PR China). HoloSSF and apoSSF were purified from dried soybean seeds through the reported method [22]. Apoferritin was prepared as described recently [21]. All protein concentrations were determined based on the Lowry method using BSA as a standard sample. Cell culture reagents were obtained from Invitrogen (Carlsbad, CA, USA). All other experimental chemicals and reagents used were of analytical grade. Cell culture Caco-2 cells were obtained from the American Type Culture Collection (Manassas, VA) at passage 11 and used in experiments at passages 17–25. The cells were grown in Dulbecco's modified Eagle medium (Gibco, Grand Island, NY) with 10% v/v fetal bovine serum (Gibco), glucose (4.5 g/L), and L-glutamine. At 80–90% confluence, cells were

M. Li et al. / Bone 64 (2014) 115–123

seeded at a level of 1 × 104 cells/cm2 in 12-well Transwell plates (Corning Inc., Corning, NY) and cultured in an incubator at 37 °C with 5% CO2. The media were changed every 2 days for the first 7 days. After 8 days, the medium in the apical chamber was changed every day while the basolateral chamber medium was changed every other day.

Transmission/scanning electron microscope experiments Liquid samples were diluted with 50 mM MOPS buffer (pH 7.0) prior to placing on carbon-coated copper grids. After excess solution was removed with filter paper, the samples were stained using 2% uranyl acetate or 2% phosphotungstic acid for 10 min. Transmission/scanning electron micrographs (TEM/SEM) were imaged at 30 kV through a Hitachi S-5500 scanning electron microscope, and elementary analyses were carried out with Horiba INCA 450 energy dispersive X-ray analysis spectroscopy.

Measurement of zeta potentials The zeta potential measurements of holoferritin and apoferritin plus different calcium ions were carried out with a Delsa-nanoparticle analyzer (Beckman Coulter Inc., Fullerton, CA, US). Freeze-dried ferritin was dissolved into 50 mM MOPS buffer (pH 7.0). The concentration of ferritin is 0.05 μM and the solution was applied to zeta potential analysis after reaction for 30 min with different calcium concentrations (0–50 mM). The zeta potential was measured at least three times to present an average value with standard deviation.

Isothermal titration calorimetry (ITC) All measurements were carried out at 25 °C with a MicroCal NanoITC calorimeter (MicroCal, Northampton, USA) according to a reported method [24]. The Nano-ITC device was electrically calibrated. All samples were degassed thoroughly before each titration. The solution in the sample cell was stirred at a speed of 250 rpm. Titrations were performed by a number of 25 injections of each 2 μL of CaCl2 (3.04 mM) into the sample cell containing 190 μL apoSSF (2 μM), spaced at 400 s intervals to ensure complete equilibration. A background titration, consisting of the same titrant solution but only the buffer solution in the sample cell, was subtracted from each experimental titration to account for heat of dilution. The change in heat rate during the titration process was registered in real time. Raw data were processed using the Origin 8.0 software.

Confocal microscope for calcium location Cells were incubated at 37 °C with Ca–SSF (the concentration of Ca2+ is 10 μM) for 1 h after cells were grown on slides for 7 days and washed with PBS 3 times. Medium was then removed, and cells were washed three times with ice-cold PBS and fixed using 4% paraformaldehyde in PBS for 15 min at room temperature. After a PBS wash, the cells were permeabilized with 0.2% Triton X-100 in PBS for 10 min at room temperature, followed by three more washes with PBS. Then the cells were incubated with 5% BSA to block non-specific binding at 4 ºC overnight. After that, the cells were robed with anti-SSF (1:100, raised in rabbit) for 40 min at room temperature. Subsequently, the cells were incubated with FITC-labeled anti-rabbit IgG (1:200) or Fluo-3-AM (4 μM) for 40 min at room temperature in the dark. Antibody was diluted in PBS containing 1% BSA. Each step followed three washes with 0.1% Tween20 (diluted in PBS) for 5 min. Finally, coverslips were mounted on slides using a Mowiol antifade reagent, and cells were observed under a confocal laser scanning microscope (Leica).

117

Fluo-3-AM loading for flow cytometry analysis Caco-2 cells were pre-incubated with CaCl2, Ca–SSF, TA plus CaCl2 at different ratios, and TA plus Ca–SSF, respectively, for 1 h after cells were grown in 12-well for 7 days. The cells then were washed with PBS three times, followed by treatment with 10 μM Fluo-3-AM. After incubation for 0.5 h, cells were washed with PBS and harvested for analysis on a FL-1 channel by FACSCalibur (Becton Dickinson). The mean fluorescence intensity of the stained cells was analyzed with CellQuest software. The net fluorescence value for each case was acquired by the determined value subtracting that of the negative control. Calcium cell uptake experiments The uptake experiment was conducted when the transepithelial electrical resistance of the Caco-2 cell membranes was N 500 Ω cm2, typically at 16 days of seeding. Briefly, growth medium was removed from the Transwells by aspiration, and the upper and lower chambers were rinsed with Hank's balanced salt solution (HBSS, pH 7.2–7.4, without calcium and magnesium). All treated and untreated CaCl2 and Ca– SSF samples were dissolved in 0.5 mL of HBSS (without calcium and magnesium), each of which contains 375 μM of calcium. After these samples were added to the apical chambers, respectively, 1.5 mL of HBSS was added to the basolateral chambers [25]. Transport was carried out at 37 °C for 2 h as previously described [26]. At the end of uptake the 1.5 mL solutions in basolateral chambers were collected. Then, each of the basolateral chambers was washed with 1.5 mL of phosphatebuffered saline (pH 7.4). Rinsing solutions were added into the HBSS. After collection of all solutions, cells were lysed and harvested by adding 2 volumes (0.5 mL) of 1 M NaOH to each insert to measure calcium retention within Caco-2 cells. Uptake experiments were carried out on 3 individual wells for each sample. Wells with a trans-monolayer electrical resistance value below 300 Ω cm2 at the end of transport were discarded to ensure the integrity of monolayers [27]. A standard Agilent triple quadrupole ICP-MS mainframe (Agilent 7500, America) was used to measure calcium transport and retention. The sample introduction system features a quartz torch and spray chamber, and a concentric PFA nebulizer. Platinum interface cones were also used. Cool plasma conditions were used throughout and plasma parameters are as follows: carrier gas was 0.7 L/min. Make up gas was 1 L/min and sampling depth was 18 mm. Preparation of TfR1-Caco-2 cells and comparison of its uptake between CaCl2 and Ca2+–SSF Short hairpin RNAs (shRNAs) specifically targeting Caco-2 cell based on published transferrin receptor 1 (TfR1) sequence were designed to knock down TfR1 expression. The shRNA sequences were as follows: R1: CACAAAGGCCAATGTCACA; R2: GCTGGTCAGTTCGTGATTAAA; and R3: GGTGTAGTGGAAGTATCTG. All of the three duplex shRNA oligos were synthesized and annealed. The oligos were cloned into the pLVshRNA-eGFP plasmids according to the instructions of pLVshRNA (Inovogen Tech). The 293 T cells at 50% confluency were expanded into R1, R2, R3, and control groups, respectively, and transfected with polybrene (Invitrogen, USA) including 4 mg shRNA and 6 μg/mL of polybrene for 24 h, and cultured in complete DMEM containing 10% FBS after 24 h. The transient transfected cells were selected at 24 h post-transfection by RT-PCR for selecting the maximum interference shRNA oligos. The recombinant RNAi lentiviruses were produced by transient transfection of 293 T cells according to standard protocols [28]. For transfection, Caco-2 cells were seeded into a 6-well plate and allowed to adhere for 24 h. The cells were infected with either Caco-2 RNA interference lentivirus vector or control RNA interference vector in complete medium for 48 h. Following transduction, cells were selected with 1 μg/mL puromycin. The cells are named TfR1-Caco-2. Then, it

118

M. Li et al. / Bone 64 (2014) 115–123

was used to evaluate the uptake effect between CaCl2 and ferritin–Ca according to 2.8. Statistical analysis Results are presented as means ± SD (n = 3). Statistical analysis was performed using SAS v. 9.0. Post hoc Tukey's test was used to determine whether treatment groups differed significantly from the control groups. Differences were considered significant when P b 0.05. Calcium uptake levels from all groups were subjected to one-way ANOVA and Tukey test. Means with different letters are significantly different (P b 0.05). Results Preparation and characterization of apo soybean seed ferritin, and its ability to encapsulate calcium ions within the protein shell Holo soybean seed ferritin (holoSSF) was isolated and purified from dried soybean seeds with an apparent molecular mass estimated to be approx. 560 kDa by native PAGE (Supporting information, Fig. S1A). In addition, SDS/PAGE analysis shows that the ferritin complex contains two kinds of subunits (28.0 and 26.5 kDa) (Supporting information, Fig. S1B) at a 1:1 ratio. After holoSSF molecules were stained using 2% uranyl acetate, transmission electron micrograph (TEM) analyses revealed that the exterior diameter of the protein shell of holoSSF is around 12 nm (Fig. 2A). The size of the iron cores encapsulated within the protein is about 8 nm approaching the interior diameter of the protein shell. Such iron cores were confirmed by energy dispersive X-ray detection (Fig. 2C). As to apoferritin, after staining by uranyl acetate solution under identical experimental conditions, TEM analyses of apo soybean seed ferritin (apoSSF) showed discrete electron-dense

uranium-containing cores with a mean diameter of ~ 8 nm (Fig. 2B), which was confirmed by energy dispersive X-ray detection (Fig. 2D). To determine whether apoSSF could also store calcium ions within its inner cavity, apoSSF was incubated with different amounts of calcium chloride in 100 mM MOPS, at pH 7.0, and 25 °C, followed by TEM analyses. As displayed in Fig. 3, the size of the formed uranium cores within the inner cavity gradually decreased with an increase in the concentration of calcium chloride upon pre-incubation of CaCl2 with apoSSF prior to treatment with uranyl acetate (Fig. 3). When the ratio of Ca2+ to apoSSF reaches 1000:1, the uranium cores are hardly observed. The Ca2+/protein shell stoichiometry of the calcium–ferritin complex To obtain the Ca2+/protein shell stoichiometry for this newly synthesized complex, the zeta potential of apoSSF was first determined as a function of a ratio of Ca2 +/protein shell with holoSSF as control. It was observed that the zeta potential increased with increasing the ratio of Ca2+/apoSSF, reaching its maximal value at ~140 Ca2+/apoSSF (Fig. 4), indicating that one apoSSF molecule binds with about 140 calcium ions. In contrast, the zeta potential of holoSSF almost kept unchanged when it was incubated with Ca2+ under the same experimental conditions. Moreover, the content of calcium in the protein was further determined by inductively coupled plasma mass spectrometry (ICP-MS), upon treatment of apoSSF with calcium chloride, followed by dialysis to remove free calcium ions. The very high ion intensity for calcium was observed in this mixture. Based on three independent experiments, the ratio of bound calcium to the protein was determined as (142.1 ± 2.0)/1. In parallel, analysis of the ITC data demonstrates that the ratio of bound calcium ions to apoSSF is (140.1 ± 6.4)/1 with the association constant K of (1.62 ± 0.39) × 105 M−1 at pH 7.03 in 100 mM MOPS and 50 mM sodium chloride at 25 °C (Fig. 5). Thus, the results obtained by ICP-MS and calorimetric methods are in excellent agreement with each other.

Fig. 2. TEM images of holoSSF (A) and apoSSF (B) negatively stained by 2% uranyl acetate. (C) and (D) are EDX analyses of the cores corresponding to (A) and (B), respectively. Scale bars are 50 nm.

M. Li et al. / Bone 64 (2014) 115–123

119

Fig. 3. TEM images of apoSSF upon treatment with different concentrations of calcium ions. (A) apoSSF alone; (B) Ca2+/apoSSF = 50:1; (C) Ca2+/apoSSF = 100:1; and (D) Ca2+/apoSSF = 1000:1. Conditions: [apoSSF] is 0.05 μM in 50 mM MOPS (pH 7.0). All samples were negatively stained by 2% uranyl acetate. Scale bars are 50 nm.

1.2

Heat Release (µJ/sec)

Absorption of the Ca2+–SSF complexes by Caco-2 cells To elucidate whether the Ca2 +–SSF complexes could enter into Caco-2 cells, apical internalization of these complexes was determined by immunofluorescence using an antibody specific for SSF with BSA as a control sample (Fig. 6A); SSF polypeptides N 10 kDa are immunoreactive. Upon incubation with the complexes followed by the antibody, cells exhibited green fluorescence (Fig. 6B), while almost no such fluorescence was observed when BSA was used instead of the complexes (Fig. 6A), indicating that the calcium complexes are able to enter into the cells. In parallel, the cells also exhibited green fluorescence upon

holoSSF plus Ca2+

0.8 0.6 0.4

0.0 0

-10

4000

8000

12000

Time(s)

-12

B

0

-14

µJ

Zeta-potential / mV

1.0

0.2

apoSSF plus Ca2+ -8

A

-16

-20 -40 0

-18 0

200

400

600

800

1000

Ca2+/SSF Fig. 4. Comparison of zeta potentials between apoSSF and holoSSF plus different concentrations of Ca2+. Conditions: [apo or holo SSF] = 26 μg/mL in 50 mM MOPS, pH 7.0, and [CaCl2] = 0–5.55 mg/mL. Values are the means ± standard deviations (n = 3).

50

100

150

200

250

300

Ca2+/apoSSF Fig. 5. ITC measurement of exothermic binding of calcium ions to apoSSF solution. (A) Raw data. (B) Titration plot derived from the integrated heats of binding, corrected for the heat of dilution. Conditions: 2.0 μM of ferritin titrated with 2.0 μL injections of 3.04 mM of CaCl2; and protein was buffered with 100 mM MOPS, at pH 7.0, containing 50 mM NaCl, at 25 °C.

120

M. Li et al. / Bone 64 (2014) 115–123

Fig. 6. Cell uptake of Ca–SSF complexes by Caco-2 cells analyzed by a confocal microscope. (A) Incubation of BSA with anti-SSF supplied to cells; (B) incubation of Ca–SSF with anti-SSF supplied to cells; and (C) incubation of Ca–SSF with Fluo-3-AM supplied to cells.

treatment with the complexes followed by the addition of a specific fluorescence probe Fluo-3-AM for Ca2+ rather than anti-SSF (Fig. 6C), indicating that calcium ions can be also absorbed by the cells accompanied by uptake of ferritin molecules. We next evaluated the cell uptake efficiency of both newly synthesized Ca2 +–SSF complexes and CaCl2 by Caco-2 cells. Following the treatment of the cells with these two calcium complexes, respectively, changes in Ca2 + were monitored by flow cytometry using Ca2 +binding dyes Fluo-3-AM. As depicted in Fig. 7, the increase in Ca2 + was observed as a shift in the peak in the cell number versus fluorescence intensity distribution upon incubation with Ca2+–SSF complexes and CaCl2 at identical calcium ion concentration (10 μM), respectively. It was observed that the degree of the increase in the fluorescence intensity in sample CaCl2 is nearly the same as that in sample Ca2+–SSF.

Effect of dietary factors on absorption of calcium from both Ca2 +–SSF complexes and CaCl2 by Caco-2 cells We tried to evaluate whether some typical inhibitors from food also affect uptake of calcium ions encapsulated with ferritin shell. Three well-established inhibitors of calcium uptake, such as tannic acid (TA), oxalic acid (OA) and zinc ions were chosen to evaluate their effect on cell uptake of Ca2+–SSF with CaCl2 as control. The cell uptake consists of two parts, retention and transport. In the absence of the inhibitors, the efficiency of calcium uptake from CaCl2 by Caco-2 cells reached 22.7%. As expected, addition of TA (Fig. S2), OA, and Zn2+ to CaCl2 greatly decreased its uptake efficiency by Caco-2 cells to 11.6%, 6.13%, and 6.59%, respectively (Fig. 8A) under the same experimental conditions. The decline in calcium uptake by Caco-2 cells was statistically significant between the free CaCl2 sample and the three treated samples (P b 0.05).

Fig. 7. The absorption of calcium in Caco-2 cells detected by flow cytometry. The data presented here are representative of at least three independent experiments.

Such difference in calcium uptake was found to mainly stem from the difference in retention between these samples (Fig. 8A). The calcium uptake efficiency by Caco-2 cells from Ca–SSF was found to be 24.32% (Fig. 8B), a value comparable with that from free CaCl2, while their corresponding uptake efficiency was 23.96%, 26.92%, and 25.15% upon treatment of Ca–SSF complex with TA, OA, and Zn, respectively. Although the OA and Zn treated samples had slightly higher calcium cell uptake efficiency, there were no significant difference between Ca–SSF and the two treated samples (P N 0.05). Absorption of calcium from Ca2+–SSF and CaCl2 by Caco-2 cells without TfR1 gene To shed light on whether calcium from Ca2+–SSF and CaCl2 in Caco2 cells without TfR1 gene could enter into cells, TfR1-Caco-2 cells in which TfR1 gene was silenced was prepared, followed by determination of cell uptake of these two different calcium supplements. According to this study, TfR1 expression was greatly down-regulated after treatment with lentiviral vector-mediated shRNAs (Fig. S3). As a result, the calcium uptake efficiency of Ca2+–SSF by TfR1-Caco-2 cells largely decreased to 9.35% (Fig. 8C) as compared to that by normal Caco-2 cells (24.32%) (Fig. 8B). By contrast, the calcium uptake efficiency from free CaCl2 by TfR1-Caco-2 cells reached 26.8%, a value similar to that by normal Caco2 cells (22.7%). Discussion Although dairy products are a good source for calcium supplementation, the consumption of milk is declining in industrialized countries, leading to inadequate calcium intake [10]. Therefore, it is very important to explore a new class of calcium supplements. It has been reported that some Ca-enriched nutrients have negative interactions with other nutrients such as iron and zinc ions, finally inhibiting their uptake [12–14]. Such inhibition was believed to stem from the fact that DMT1 located in the small intestine is a common receptor for these divalent metal ions [15]. On the other hand, dietary factors in foodstuffs such as tannins and oxalate greatly inhibit calcium uptake [16,17]. Thus, a new class of Ca-enriched nutrients should overcome the above mentioned shortcomings. One approach to solving this problem is to explore new edible materials which can not only carry calcium ions, but also protect against absorption inhibitors through a unique pathway. Widespread phytoferritins in nature provide a good opportunity to make such Ca-enriched nutrients due to their novel property of mineral uptake through naturally occurring channels located in protein. In this work, we demonstrated that apo soybean seed ferritin (apoSSF) can be used as a carrier to store up to ~140 calcium ions within the protein shell; such complexes have advantages over other Ca-enriched nutrients in that they protect the calcium ions inside the protein from dietary factors such as tannic acid and oxalate, and that they can be absorbed by Caco-2 cells through a different mechanism from their free analogs. SDS/PAGE analysis implied that the ferritin complex contained two kinds of subunits (28.0 and 26.5 kDa) (Supporting information,

M. Li et al. / Bone 64 (2014) 115–123

A

Transport Retention

Calcium Absorption in Caco-2 cells / %

24 20 16

*

12

*

*

8 4 0 Ca

TA/Ca

OA/Ca

Zn/Ca

Groups

Calcium Absorption in Caco-2 cells / %

32

Transport Retention

B

28 24 20 16 12 8 4 0 Ca-SSF

TA/Ca-SSF OA/Ca-SSF Zn/Ca-SSF

Groups 28

C Transport % Retention %

Calcium Absorption in TfR1-Caco-2 cell /%

24 20 16 12

#

8 4 0 Ca

Ca-SSF

Groups Fig. 8. Effect of dietary factors on calcium absorption from Ca2+–SSF and free CaCl2 by both Caco-2 and TfR1-Caco-2 cells. (A) Effect of tannins (TA), oxalate (OA) and zinc ions on calcium absorption from CaCl2 by Caco-2 cells. Conditions: TA/Ca or OA/Ca or Zn/Ca = 20:1. *Compared with Ca absorption. (B) Effect of tannins, oxalate and zinc ions on calcium absorption from Ca2+–SSF by Caco-2 cells. Conditions: TA/Ca2+–SSF or OA/Ca2+–SSF or Zn/Ca2+–SSF = 20:1. The concentration of calcium is 1.5 mg/L. (C) Comparison of calcium uptake efficiency between CaCl2 and Ca2+–SSF in TfR1-Caco-2 cells. Ca corresponds to CaCl2, and Ca–Ft corresponds to Ca2+–SSF. Values are the means ± standard deviations (n = 3). #Compared with Ca absorption, P b 0.05.

Fig. S1B) at a 1:1 ratio, as reported previously [21]. The exterior diameter of the protein shell of holoSSF is about 12 nm (Fig. 2A) as revealed by TEM, nearly the same as previously reported [29]. Ca–SSF complexes

121

were prepared by incubation of apoSSF with different amounts of CaCl2, as directed by TEM imaging. As displayed in Fig. 3, the size of the formed uranium cores within the inner cavity gradually decreased with an increase in the concentration of calcium chloride which was preincubated with apoSSF prior to treatment with uranyl acetate (Fig. 3). When the ratio of Ca2+ to apoSSF reaches 1000:1, the uranium cores are hardly observed. These results indicated that calcium ions were able to bind on the exterior surface of SSF molecules, and such binding inhibits the entrance of uranyl cation, UO2+ 2 , into the protein. We believe that the binding of calcium ions to the protein is electrostatically induced at either the interior surface of the protein surrounding the cavity or the 3-fold channels. Consistent with this idea, the crystal structure showed that there are more than 100 binding sites inside of the recombinant soybean seed H-4 ferritin, and these sites contain the nucleation center on the inner surface, the 3-fold iron entry channel, the ferroxidase center, and a new transit site between the iron entry channels to the ferroxidase center [30]. Since the hydrophilic channels penetrating along the 3-fold symmetry axes are considered to be the entry channel of metal ions to the inner cavity of the ferritin shell, the binding of calcium ions at the 3fold channels of the protein plays an important role, at least partially, in preventing uranyl cations from diffusing into the inner cavity, thereby inhibiting the formation of the uranium cores (Fig. 3). Further support for the binding of calcium to apoSSF comes from zeta potential measurements showing that the zeta potential of apoSSF increased with increasing the ratio of Ca2+/apoSSF, while that of holoSSF almost kept unchanged [31–33]. The ratio of bound calcium ions to apoSSF was determined as (142.1 ± 2.0)/1 by ICP-MS analysis. This result was confirmed by isothermal titration calorimetry (ITC) measurements [34], analyses of which gave the stoichiometry of Ca2 +/apoSSF as (140.1 ± 6.4)/1 with the association constant K of (1.62 ± 0.39) × 105 M− 1 (Fig. 5). The central region of immunoglobulin-like protein, LigB naturally binds to Ca2 + through oxygen atoms provided by several charged glutamate or aspirate residues with the association constant as 1.32 × 105 M− 1 [35], this reported value is very similar to that of Ca 2 + binding to apoSSF (1.62 ± 0.39) × 105 M− 1, suggesting that these two different proteins bind with calcium ions in a similar mode. Indeed, SSF is an acidic protein with a pI of ~5.6 and rich in glutamate or aspirate residues within its inner cavity [36]. Caco-2 cells have been established as a good model for the assessment of factors affecting calcium absorption, and results from this in vitro model have been shown to correlate well with absorption studies in human subjects [9,10,15,17]. Upon incubation with the Ca– SSF complexes, followed by the antibody, the cells exhibited green fluorescence (Fig. 6B), while almost no such fluorescence was observed when BSA was used instead of the Ca–SSF complexes (Fig. 6A), indicating that Ca2+–SSF is able to enter into the cells. In parallel, the cells also exhibited green fluorescence upon treatment with the specific fluorescence probe Fluo-3-AM for Ca2+ (Fig. 6C), indicating that the calcium ions within the protein shell were also absorbed by the cells accompanied by the uptake of ferritin molecules. Consistent with the above observation, it has been established that naturally occurring SSF containing iron cores can be absorbed by Caco-2 cells by a receptor-mediated endocytic pathway [37]. Following the treatment of the cells with these two calcium complexes, respectively, changes in the concentration of Ca2+ in the cells were monitored by flow cytometry using Ca2 +-binding dyes Fluo-3AM [38]. As seen in Fig. 7, the increase in the concentration of Ca2+ in the cells treated by CaCl2 is nearly the same as that treated with Ca2 +–SSF, demonstrating that the two samples appear to possess a similar ability to facilitate Ca2+ uptake of Caco-2 cells. Similar results were obtained using protein samples from three different protein preparations, suggesting that the observed degradation is not sample dependent. These results again demonstrate that the newly synthesized Ca– SSF complex can be absorbed by the Caco-2 cells, the absorption efficiency of which is nearly the same as CaCl2.

122

M. Li et al. / Bone 64 (2014) 115–123

It has been established that dietary factors such as tannic acid (TA), oxalic acid (OA) and divalent ions may limit the absorption of dietary calcium [16,17], so it is important to elucidate the effect of these factors on the uptake of the calcium ions encapsulated with ferritin shell. We found that the addition of TA, OA, and Zn2+ to CaCl2 greatly decreased the uptake efficiency of Caco-2 cells to 11.6%, 6.13%, and 6.59% (Fig. 8A). The decline in calcium uptake of Caco-2 cells was statistically significant between the free CaCl2 sample and the three treated samples (P b 0.05). Such difference in calcium uptake was found to mainly stem from the difference in retention between these samples (Fig. 8A). These present results are in good agreement with previous observation that TA and OA were reported to markedly inhibit metal ions including calcium absorption by cells [16,17]. This inhibitory effect was believed to be associated with the formation of insoluble complexes with these metal ions, thereby decreasing its bioaccessibility and bioavailability further. This phenomenon occurs in a dose-dependent fashion equivalent to its content of gallic acid (galloyl groups) [16,17]. Although the calcium uptake efficiency by Caco-2 cells from Ca2+–SSF was comparable with that from free CaCl2 (Figs. 7 and 8B), interestingly, dietary factors including TA, OA, and Zn exhibit different effects on calcium uptake from the Ca–SSF complexes and their free analogs. For example, OA- or OA- or Zn-treatment slightly increased or almost had no effect on calcium cell uptake efficiency from the ferritin–Ca complexes, whereas such treatment greatly decreased the uptake efficiency from CaCl2 by Caco-2 cells to 11.6%, 6.13%, and 6.59%, respectively (Fig. 8A). Thus, calcium uptake from the Ca2 +–SSF complexes by Caco-2 cells appears to be more efficient than that from CaCl2 in the presence of these three dietary factors. Different effects of these dietary factors on calcium uptake from Ca2 +–SSF complexes and CaCl 2 by the cells suggest that these two types of calcium supplements have different mechanisms in calcium uptake. Many studies from different groups showed that holoferritin, especially holo soybean seed ferritin containing iron cores within the protein inner cavity can be safely absorbed as a new iron supplement by animals, and human beings [39]. In this study, we just replaced iron cores within soybean seed ferritin with calcium ions to prepare Ca2+–SSF complexes, so safety should not be a considerable concern with the Ca2+–SSF complexes. In a future study, we will evaluate the safety of Ca2+–SSF complexes using an animal model. Recent studies have revealed that human H-chain ferritin (HuHF) could be absorbed by human B cells through a TfR1-mediated mechanism [37]. Since plant ferritin is composed of only H-type subunits, it is reasonable to believe that Ca2 +–SSF complexes also enter into the cell through this mechanism. In contrast, free calcium ions enter into Caco-2 cells through a DMT1-mediated endocytic pathway which corresponds to their active transport [15]. Thus, the uptake pathway of Ca2+– SSF seems to be different from that of its free analogs. If TfR1 acted as a receptor in Caco-2 cells for SSF, we would expect that the calcium uptake from Ca2 +–SSF composites decreases greatly by TfR1-Caco-2 cells. Indeed, the calcium uptake efficiency of Ca2+–SSF by TfR1-Caco2 cells largely decreased to 9.35% (Fig. 8C) as compared to that by normal Caco-2 cells (Fig. 8B). By contrast, the calcium uptake efficiency from free CaCl2 by TfR1-Caco-2 cells reached 26.8%, a value similar to that of normal Caco-2 cells. The disparity in calcium uptake efficiency between the Ca2+–SSF composites and free CaCl2 is statistically significant (P b 0.05) (Fig. 8C). Thus, the silence of TfR-1 gene in Caco-2 cells has a great effect on calcium uptake from Ca2+–SSF composites rather than CaCl2, demonstrating that the pathway of calcium uptake from Ca2+–SSF by Caco-2 cells is distinct from that from CaCl2. Additionally, these results indicated that, similar to the recent observation with HuHF [37], the TfR-1 gene is also closely associated in the uptake of plant ferritin such as SSF by Caco-2 cells, although H-type subunits in SSF only share ~ 40% sequence identity with the animal H-subunits [20], and each of them contains a specific extension peptide (EP) at its N-terminal sequence. Thus the difference in sequence and EP between plant and animal ferritins appears to have no great effect on the uptake

of ferritin by Caco-2 cells, reflecting the important of other structures of these two different ferritins. Conclusion We have reported the first case of using edible protein cages as a scaffold to encapsulate essential nutrient element Ca2+. Unlike previous preparations, soluble calcium ions but not metal nanoparticles were trapped within the protein in this study in order to be absorbed directly after their transport across human intestinal cells. By the use of a directing electrostatic influence of the protein concentrating cations, ~140 Ca2+/protein enter into the protein shell and bind to the protein through carboxyl groups of its acidic residues such as Glu and Asp. We then evaluated the feasibility of such complexes in a Caco-2 enterocyte cell model. As compared to traditional calcium supplements, these complexes exhibited several improved features. First, the calcium ions inside phytoferritin are protected by a protein shell from interacting with other dietary factors, such as TA and OA. Second, the calcium ions inside the protein do not interfere with uptake of other divalent ions, because TfR-1, a different receptor from DMT1, is involved in their cell absorption. Third, these complexes are suitable for all persons including vegetarians because of plant source. These findings indicate that the broad role of ferritin as a nanoplatform can play in the field of nutrition. Exploration of a novel, alternative dietary calcium source with a different cell absorption mechanism may help improve calcium nutritional status and may prevent calcium deficiency problems. Conflict of interest statement The authors confirm that there are no conflicts of interest. Acknowledgments This project was supported by the Ministry of Education of the People's Republic of China, Specialized Research Fund for the Doctoral Program of Higher Education (20110008130005). Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bone.2014.04.006. References [1] Heaney RP. Effect of calcium on skeletal development, bone loss, and risk of fractures. Am J Med 1991;91:S23–8. [2] Heaney RP. Age considerations in nutrient needs for bone health: older adults. J Am Coll Nutr 1996;15:575–8. [3] Abrams SA. Calcium turnover and nutrition through the life cycle. Proc Nutr Soc 2001;60:283–9. [4] Sandler RB, Slemenda CW, LaPorte RE, Cauley JA, Schramm MM, Barresi ML, et al. Postmenopausal bone density and milk consumption in childhood and adolescence. Am J Clin Nutr 1985;42:270–4. [5] Miller GD, Jarvis JK, McBean LD. The importance of meeting calcium needs with foods. J Am Coll Nutr 2001;20:S168–85. [6] Nicklas TA. Calcium intake trends and health consequences from childhood through adulthood. J Am Coll Nutr 2003;22:340–56. [7] Diet, nutrition and the prevention of chronic diseases. World Health Organ Tech Rep Ser 2003;916:1–149. [8] Subar AF, Krebs-Smith SM, Cook A, Kahle LL. Dietary sources of nutrients among US adults, 1989 to 1991. J Am Diet Assoc 1998;98:537–47. [9] Perales S, Barberá R, Lagarda MJ, Farré R. Fortification of milk with calcium: effect on calcium bioavailability and interactions with iron and zinc. J Agric Food Chem 2006;54:4901–6. [10] De la Fuente MA, Belloque J, Juárez M. Mineral contents and distribution between the soluble and the micellar phases in calcium-enriched UHT milks. J Sci Food Agric 2004;84:1708–14. [11] Weaver CM. Closing the gap between calcium intake and requirements. J Am Diet Assoc 2009;109:812–3. [12] Lönnerdal B. Effects of milk and milk components on calcium, magnesium, and trace element absorption during infancy. Physiol Rev 1997;77:643–69. [13] Lynch SR. The effect of calcium on iron absorption. Nutr Res Rev 2000;13:141–58.

M. Li et al. / Bone 64 (2014) 115–123 [14] Cámara F, Amaro MA. Nutritional aspect of zinc availability. Int J Food Sci Nutr 2003;54:143–51. [15] Hallberg L, Brune M, Erlandsson M, Sandberg AS, Rossander-Hultén L. Calcium: effect of different amounts on nonheme- and heme-iron absorption in humans. Am J Clin Nutr 1991;53:112–9. [16] Weaver CM, Proulx WR, Heaney R. Choices for achieving adequate dietary calcium with a vegetarian diet. Am J Clin Nutr 1999;70:S543–8. [17] Perales S, Barberá R, Lagarda MJ, Farré R. Bioavailability of calcium from milk-based formulas and fruit juices containing milk and cereals estimated by in vitro methods (solubility, dialyzability, and uptake and transport by Caco-2 cells). J Agric Food Chem 2005;53:3721–6. [18] Harrison PM, Arosio P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1996;1275:161–203. [19] Chasteen ND, Harrison PM. Mineralization in ferritin: an efficient means of iron storage. J Struct Biol 1999;126:182–94. [20] Zhao G. Phytoferritin and its implications for human health and nutrition. Biochim Biophys Acta 1800;2010:815–23. [21] Fu X, Deng J, Yang H, Masuda T, Goto F, Yoshihara T, et al. A novel EP-involved pathway for iron release from soya bean seed ferritin. Biochem J 2010;427:313–21. [22] Meldrum FC, Wade VJ, Nimmo DL, Heywood BR, Mann S. Synthesis of inorganic nanophase materials in supramolecular protein cages. Nature 1991;349: 684–7. [23] Uchida M, Kang S, Reichhardt C, Harlen K, Douglas T. The ferritin superfamily: supramolecular templates for materials synthesis. Biochim Biophys Acta 1800;2010:834–45. [24] Al-Kaddah S, Reder-Christ K, Klocek G, Wiedemann I, Brunschweiger M, Bendas G. Analysis of membrane interactions of antibiotic peptides using ITC and biosensor measurements. Biophys Chem 2010;152:145–52. [25] Ou K, Percival SS, Zou T, Khoo C, Gu L. Transport of cranberry A-type procyanidin dimers, trimers, and tetramers across monolayers of human intestinal epithelial Caco-2 cells. J Agric Food Chem 2012;6:1390–6. [26] Ou K, Liu Y, Zhang L, Yang X, Huang Z, Nout MJ, et al. Effect of neutrase, alcalase, and papain hydrolysis of whey protein concentrates on iron uptake by Caco-2 cells. J Agric Food Chem 2010;58:4894–900. [27] Manna C, Galletti P, Maisto G, Cucciolla V, D'Angelo S, Zappia V. Transport mechanism and metabolism of olive oil hydroxytyrosol in Caco-2 cells. FEBS Lett 2000;470:341–4.

123

[28] Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 1997;15:871–5. [29] Yang H, Fu X, Li M, Leng X, Chen B, Zhao G. Protein association and dissociation regulated by extension peptide: a mode for iron control by phytoferritin in seeds. Plant Physiol 2010;154:1481–91. [30] Masuda T, Goto F, Yoshihara T, Mikami B. Crystal structure of plant ferritin reveals a novel metal binding site that functions as a transit site for metal transfer in ferritin. J Biol Chem 2010;285:4049–59. [31] Lawson DM, Artymiuk PJ, Yewdall SJ, Smith JM, Livingstone JC, Treffry A, et al. Solving the structure of human H ferritin by genetically engineering intermolecular crystal contacts. Nature 1991;349:541–4. [32] Uchida M, Klem MT, Allen M, Suci P, Flenniken M, Gillitzer E, et al. Biological containers: protein cages as multifunctional nanoplatforms. Adv Mater 2007;19: 1025–42. [33] Li M, Viravaidya C, Mann S. Polymer-mediated synthesis of ferritin-encapsulated inorganic nanoparticles. Small 2007;3:1477–81. [34] Bou-Abdallah F, Arosio P, Santambrogio P, Yang X, Janus-Chandler C, Chasteen ND. Ferrous ion binding to recombinant human H-chain ferritin. An isothermal titration calorimetry study. Biochemistry 2002;41:11184–91. [35] Hand TW, Cui W, Jung YW, Sefik E, Joshi NS, Chandele A, et al. Differential effects of STAT5 and PI3K/AKT signaling on effector and memory CD8 T-cell survival. Proc Natl Acad Sci U S A 2010;107:16601–6. [36] Lin YP, Raman R, Sharma Y, Chang YF. Calcium binds to leptospiral immunoglobulinlike protein, LigB, and modulates fibronectin binding. J Biol Chem 2008;283:25140–9. [37] Li L, Fang CJ, Ryan JC, Niemi EC, Lebrón JA, Björkman PJ, et al. Binding and uptake of H-ferritin are mediated by human transferrin receptor-1. Proc Natl Acad Sci U S A 2010;107:3505–10. [38] Assefa Z, Bultynck G, Szlufcik K, Nadif Kasri N, Vermassen E, Gori J, et al. Caspase-3induced truncation of type 1 inositol trisphosphate receptor accelerates apoptotic cell death and induces inositol trisphosphate-independent calcium release during apoptosis. J Biol Chem 2004;279:43227–36. [39] Lönnerdal B. Soybean ferritin: implications for iron status of vegetarians. Am J Clin Nutr 2009;89:1680S–5S.