Curr Microbiol (2014) 68:381–386 DOI 10.1007/s00284-013-0487-2
A Novel Method of Identifying Mycobacterium tuberculosis Beijing Strains by Detecting SNPs in Rv0444c and Rv2629 Lu Zhang • Wenxi Xu • Zhenling Cui • Yanyan Liu • Wenjie Wang • Jie Wang • Ding Hu • Dingqian Liu • Honghai Wang
Received: 1 June 2013 / Accepted: 22 September 2013 / Published online: 12 November 2013 Ó Springer Science+Business Media New York 2013
Abstract A particular genotype of tuberculosis, named Beijing strain, is strongly associated with drug resistance and high virulence. Therefore, rapid prospective identification of Mycobacterium tuberculosis Beijing strains is very important for identifying and controlling tuberculosis of Beijing genotype. In the present study, we found that the co-mutation, A191C in Rv2629 and G243C in Rv0444c, is closely related to Beijing genotype. Gene Rv2629 and Rv0444c of 139 clinical isolates of M. tuberculosis were analyzed by PCR amplification and sequencing. Among 99 Beijing strains, 86 % (n = 85) isolates had the mutation G243C in Rv0444c and 92.93 % (n = 92) isolates had the mutation A191C in Rv2629. Among 40 non-Beijing isolates, only six isolates carried the mutation G243C in Rv0444c and eight isolates carried the mutation A191C in Rv2629. The co-mutation existed in 84.85 % (n = 84) of 99 clinical genome samples of W-Beijing strains and in
Lu Zhang and Wenxi Xu contributed equally to this work and share first author. L. Zhang W. Xu Y. Liu W. Wang D. Hu H. Wang (&) State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433, People’s Republic of China e-mail: [email protected] L. Zhang e-mail: [email protected] Z. Cui J. Wang Shanghai Key Laboratory of Tuberculosis, Shanghai Pulmonary Hospital, Medical School, Tongji University, Shanghai 200433, People’s Republic of China D. Liu Shanghai Medical College of Fudan University, Shanghai 200032, People’s Republic of China
only 12.5 % (n = 5) of the 40 non-Beijing strains, and the positive predictive value of 94.38 %, obtained in our experiment with a designed ratio of Beijing isolates, is similar to that in China at present. This result suggested that the detection method of the co-mutation, A191C in Rv2629 and G243C in Rv0444c, proposed in this study was a rapid, reliable, and sensitive one for identifying tuberculosis with Beijing genotype.
Introduction Mycobacterium tuberculosis is one of the most threatening human pathogens, infecting nearly one-third of the world’s population. As a major problem concerning public health, tuberculosis remains extremely detrimental to human health, resulting in over 8.7 million new cases and 1.4 million deaths each year [1]. Recent studies have suggested a particular genotype of tuberculosis, named Beijing strain, which is strongly associated with drug resistance and high virulence of M. tuberculosis and contributes to the epidemic in Asia, Europe, Africa, and the USA [2–7]. It is estimated that more than a quarter of worldwide TB cases are caused by Beijing strains [8, 9]. These strains have caused outbreaks of multidrug-resistant (MDR) tuberculosis [10, 11] and show a distinct association with drug resistance, given the findings of some recent investigations [3]. Their wide distribution suggests that they have selective advantages over other M. tuberculosis strains [2, 9]. Given the prevalence of the W-Beijing strain, a simple and rapid typing method for this family is urgently needed for epidemiology and control of the disease. At present, there are two main methods for the identification of Beijing genotype strains: IS6110 DNA
123
382
L. Zhang et al.: Method of Identifying M. tuberculosis
DNA from clinical strains was extracted using genomic DNA extraction kit (Axygen Biosciences). Incubating duration of Lysozyme and RNaseA ranged from 30 min to 4 h to make sure that the thick cell wall of H37Rv and clinical strains were completely digested. PCR primers (P1: GGAGTCGTTGAGGGTGTTCATCAGCTCAGTC and P2: CGCCAAGGCCGCATAGTCACGGTCG) were designed to detect the presence or the absence of this deletion in the genome of clinical strains. PCR products were separated on 0.8 % agarose gels.
fingerprinting (restriction fragment length polymorphism typing) [12] and Spoligotyping [13]. However, both methodologies contain multifarious working steps in the laboratory, and especially, the IS6110 fingerprinting method requires a high level of standardization and normalization procedures to ensure comparable results. In addition to this, the sensitivities of both the methods are too low to identify the presence of subpopulations of Beijing or non-Beijing strains, if the samples are mixed infections or clinical material [14]. In this article, we present a novel methodology based on the single nucleotide polymorphism (SNP) of key genes in M. tuberculosis genome. In contrast to these two methods, detecting SNP of certain gene is fast, inexpensive, convenient, and even equally accurate if we detect the appropriate genes. In our preliminary study, we discovered a close correlation between clinical strains of Beijing genotype and the co-mutations of G243C in Rv0444c as well as A191C in Rv2629. Rv0444c, located immediately downstream of SigK and encoded anti-SigK (RskA), binds to SigK through its N-terminal cytoplasmic domain, and inhibits the activity of SigK in vitro [15]. Rv2629 was predicted to be present in the DosR|Rv3133c regulon in M. tuberculosis 1254 [16], which is a transcription factor that mediates the hypoxic response of M. tuberculosis [17]. Further experiments with a larger clinical sample size supported our earlier results, suggesting that the co-mutation of Rv0444c and Rv2629 is a potential marker of Beijing genotype strains.
Genomic DNAs of M. tuberculosis H37Rv and clinical samples were prepared as described previously [20]. Genomic DNAs from H37Rv and clinical strains were extracted using genomic DNA extraction kit procured from Axygen Biosciences. Genes Rv2629 and Rv0444c were amplified with primers as illustrated in Table 1. The PCR product was purified using PCR purification kit (Axygen Biosciences) and sequenced by ABI-PRISM3730. Sequenced products were analyzed by alignment searches against published genome sequences, namely M. tuberculosis H37Rv, using Tuberculist (http://genolist.pasteur.fr/ TubercuList/). For the detection of SNP positions in couples of closely related strains, genomes of H37Ra, M. marinum, M. ulcerans, M. bovis AF2122 97, M. bovis BCG, M. tuberculosis C, CDC1551, F11, and Haalem were provided at NCBI. (http://www.ncbi.nlm.nih.gov/sutils/ genom_table.cgi).
Methods
Cloning and Expressions of Rv0444c and Rv2629, and Antibodies Preparation
Bacterial Strains and Culture Conditions The reference strains H37Rv and 139 clinical M. tuberculosis isolates were obtained from Shanghai Pulmonary Disease Hospital. All the patients from whom we collected strains have signed the Information consent form. Bacteria were grown without shaking in Middlebrook 7H9 medium supplemented with 0.2 % (v/v) glycerol and 10 % albumin-dextrose-catalase (ADC) at 37 °C. The ethics approvals for these studies were obtained from the Ethics Committee of the School of Life Science, Fudan University, and the Ethics Committee of Shanghai Pulmonary Hospital, respectively. Spoligotyping Spoligotyping was performed as previously described [18]. The genomic deletion RD105 is a phylogenetical marker which defines M. tuberculosis Beijing strains [19]. Genome
123
PCR and DNA Sequencing
The experiment was performed as previously described [21] with minor modifications. Both the genes, Rv0444c and Rv2629, were amplified from genome of M. tuberculosis H37Rv. The PCR product was purified, digested with restriction enzyme EcoRI and HindIII (New England Biolabs), and ligated into pET28a vector to obtain two constructed plasmids, pET28a-Rv0444c and pET28aRv2629. These two plasmids were transformed into E. coli strain BL21(DE3), and the expressing strains were
Table 1 Primers for PCR and sequencing of genes Rv2629 and Rv0444c Name
Sequence
Rv0444c forward primer
50 CTTTCAACGACGAAGTTCGAG30
Rv0444c reverse primer
50 ACATTGTTCATCACCAGCAGAC30
Rv2629 forward primer
50 CGACGACTCGCACGACACT30
Rv2629 reverse primer
50 CAGTTCATTCGGATGGCTTCTT30
L. Zhang et al.: Method of Identifying M. tuberculosis
383
incubated at 37 °C and induced overnight after isopropylb-D-thiogalactoside was added into culture solution. Cells were harvested and disrupted by ultrasonication, and inclusion bodies were separated from the cell extract by centrifugation. Thereafter, the pellet was washed and collected by centrifugation. After determining the purity by means of SDS-PAGE, two proteins were used to immunize rabbits. After three immunizations, polyclonal antibodies against the recombinant protein were harvested and tested for reactivity with Rv0444c and Rv2629 by Western blotting. 2. Western Blot of Clinical Isolates M. tuberculosis strains were grown for approximately 15 days and harvested. Bacterial pellets were washed twice, resuspended, and sonicated. Cell lysates were centrifuged, and the supernatants were quantified. Proteins were separated by 12 % SDS-PAGE and then transferred to PVDF membranes in Tris glycine buffer. The membrane was then blocked in 5 % nonfat milk in TBS with 0.05 % Tween 20 (TBST). Blots were incubated by means of the polyclonal antibody against Rv2629 or Rv0444c in TBST. Alkaline-phosphatase-conjugated goat anti-rabbit IgGs (Sigma) were added to the blots at a 1:30,000 dilution. Nitrobluetetrazolium/5-bromo-4-chloro-3-indoylphosphate (NBT/BCIP, Sigma) was used to visualize the location of the bound antibody.
Results 1.
Co-mutations of A191C in Rv2629 and G243C in Rv0444c rarely existed in H37Rv and other non-Beijing strains. In the earlier experiment, we found that two-point mutations, A191C in Rv2629 and G243C in Rv0444c, were closely associated with Beijing genotype. The mutation of A191C in Rv2629 changes the 67 codon
from GAT to GCT, which leads to an amino acid mutation from aspartic acid to alanine; meanwhile, the mutation of G243C in Rv0444c changed the 81 codon from GAG to GAC, which leads to an amino acid mutation from glutamic acid to aspartic acid. In addition, we blasted those SNPs in NCBI, and it turned out that they were rarely found in environment mycobacteria or couples of closely related strains of non-Beijing M. tuberculosis (Figs. 1, 2). It is suggested that the co-mutations of A191C in Rv2629 and G243C in Rv0444c might be a marker of Beijing genotype. Co-mutation of A191C in Rv2629 and G243C in Rv0444c is an available marker of W-Beijing genotype. To confirm this conclusion, we collected and identified 139 clinical M. tuberculosis isolates from Shanghai Pulmonary Disease Hospital by Spoligotyping as mentioned before. Of these, 71 % (n = 99) were revealed to be Beijing strains. The rest 40 were defined as non-Beijing strains. The ratio of Beijing isolates to the whole samples is similar to the current ratio of Beijing strains in China according to several investigations performed in China [22, 23]. Genes Rv2629 and Rv0444c were amplified from the genome of clinical isolates and sequenced to detect two-point mutations, A191C in Rv2629 and G243C in Rv0444c. Then, we counted the frequencies of those two mutations. The statistical result is summarized in Table 2. Among the 99 clinical isolates with Beijing phenotype, 86 % (n = 85) isolates had single-point mutation, G243C in Rv0444c; meanwhile, among the 40 clinical non-Beijing isolates, only six isolates carried the said mutation in Rv0444c. As regards the mutation A191C in Rv2629, we tested the 99 Beijing genotype isolates and the 40 non-Beijing genotype isolates, and the analysis showed that the point mutation A191C existed in 92.93 % (n = 92) of the 99 clinical W-Beijing strains and only in 8 of the 40 non-Beijing strains. When we take into account both
Fig. 1 The mutation, G243C of Rv0444c, in several environment mycobacteria and related strains of M. tuberculosis. Red square shows the mutation, and the blue square shows the base at the same relative position as the mutation in M. tuberculosis Beijing strains (Color figure online)
123
384
L. Zhang et al.: Method of Identifying M. tuberculosis
Fig. 2 The mutation, A191C of Rv2629, in several environment mycobacteria and related strains of M. tuberculosis. Red square shows the mutation, and the blue square shows the base at the same relative position as the mutation in M. tuberculosis Beijing strains (Color figure online)
Table 2 Summary of the statistical result of two-point mutations in Rv2629 and Rv0444c SNPs
A191C in Rv2629
G243C in Rv0444c
Co-mutation of Rv2629 and Rv0444c
Samples number (Beijing/non-Beijing)a
99/40
99/40
99/40
Sensibility (%)
92.93
86
84.85
Specificity (%)
80.00
85.00
87.50
Positive predictive value (%)
92.00
93
94.38
Negative predictive value (%)
82.05
70.83
70
a
Beijing and non-Beijing means Beijing strains and non-Beijing strains of M. tuberculosis, respectively
Fig. 3 Western blot analysis of expression levels about Rv2629 and Rv0444c. Lanes 1 H37Rv, 2–8, seven clinical strains with the comutations of Rv0444c and Rv2629. a Rv2629, b Rv0444c
3.
the two-point mutations, it is observed that the comutations, A191C in Rv2629 and G243C in Rv0444c, existed in 84.85 % (n = 84) of the 99 clinical genome samples of W-Beijing strains, and only in 12.5 % (n = 5) of the 40 non-Beijing strains. Based on these findings, the positive predictive value and negative predictive value of the co-mutations are 94.38 and 70 %, respectively. Confirmation of the expressions of Rv0444c and Rv2629 in clinical isolates. To confirm that genes Rv0444c and Rv2629 indeed express in clinical isolates, these two proteins were cloned and expressed. Corresponding rabbit polyclonal antibodies were prepared. We randomly chose seven clinical strains and prepared the whole cell protein. The expression levels of these two proteins in clinical isolates were detected by western blotting (Fig. 3).
123
Discussion The threat posed by the M. tuberculosis Beijing strains due to their drug resistance, higher infectivity, and higher transmissibility necessitate diagnostic strategies based on rapid identification [2, 3, 24]. Two classical methods, IS6110 fingerprinting and Spoligotyping, are widely being used currently. During a complete IS6110 fingerprinting test, we need to get abundant high-quality genomic DNA of clinical strains at first. Usually, bacteria in clinical samples are not enough, and bacterial incubation is needed to be performed to get plenty of bacteria. Afterward, genomic DNA is digested, electrophoresed through agarose gel, and blotted onto a nylon membrane. After blotting, the membranes are hybridized with an IS6110 probe and scanned in an appropriate instrument. As the acknowledged Golden Standard, IS6110 fingerprinting is not perfect, for it requires high-quality genomic DNA and multiple working steps, and does not ensure that all the Beijing strains are identified. Laboratory conditions and experiment materials can largely influence the results of IS6110 fingerprinting and interfere with making firm conclusion, especially when two labs need to compare these results or to store a great number of results for future use. Spoligotyping is a time-consuming method, which requires 45 isolates to be analyzed in each assay and expensive equipment. Prohibitive costof equipment and time constraints limit the applicability of these methods in some under-developed countries [8, 25]. Compared with IS6110 fingerprinting, SNPs assay of clinical strains is more convenient in terms of cost and time consumed. During the SNPs assay, there is no need to get high-quality genomic DNAs of strains. Sometimes, clinical samples like blood and sputum are enough for PCR amplification, and even if bacterial incubation is needed, the incubation time is far less than that incurred in the IS6110 fingerprinting test. After DNAs’ amplification and DNAs’ sequencing, data of SNPs are acquired and analyzed. The key that determines the accuracy of the SNPs
L. Zhang et al.: Method of Identifying M. tuberculosis
assay is the SNP site, but not laboratory conditions, which means that the results of SNPs assay can be easily described and compared. Depending on the convenience and low cost and the time consumed, SNPs assays have been widely used to differentiate between clinical isolates. In this study, Rv2629 and Rv0444c proteins were confirmed to be expressed in all clinical strains by Western blot analysis. The experiment is based on the detection of two SNPs of these genes, A191C in Rv2629 and G243C in Rv0444c. SNPs in Rv0444c are concerned with virulence diversity between different strains of M. tuberculosis. Rv0444c, located immediately downstream of SigK and encoding anti-SigK (RskA), binds to SigK through its N-terminal cytoplasmic domain and inhibits its activity in vitro [15]. The mutations in Rv0444c like C320T and C551T of Rv0444c are closely related to each other and alters strain virulence by means of regulating the expressions of MPB70 and MPB83[26–29]. The SNP G243C in Rv0444c on which we focus is just located in the N-terminal cytoplasmic domain. This mutation results in a change of amino acid 81 from glutamic acid to aspartic acid, probably leading to aborted binding between RskA and SigK, and then causing a high expression levels of MPB70 and MPB83 in W-Beijing strains. The forecast of the close relation between the SNP of G243C and the high virulence of Beijing strains is reasonably good. The understanding of gene Rv2629 is poor and far from satisfactory. This gene was predicted to be in the DosR|Rv3133c regulon in M. tuberculosis 1254 [16], which is a transcription factor that mediates the hypoxic response of M. tuberculosis [17]. Besides, other details concerning the functions of Rv2629 and corresponding protein are still unclear. Alonso et al. [25] evaluated a real-time PCR followed by high-resolution melting (HRM) based on the identification of a single SNP position in the Rv2629 gene which is qualified as a marker of W-Beijing strains (A191C for Beijing genotype and A191A for non-Beijing genotype). By means of the combined methodology, they succeeded in assigning a Beijing/non-Beijing type in a high percentage (84.1 %) of 44 clinical respiratory samples analyzed; however, as the effect of this method depended on the sample quality, they were unable to assign a corresponding genotype in 26.9 % of the specimens, especially for those with a low/ intermediate load. We analyzed gene sequences of Rv2629 and Rv0444c in 99 Beijing strains and 40 non-Beijing strains, and found that the co-mutations of A191C in Rv2629 and G243C in Rv0444c existed in 84 Beijing strains (84.85 % of 99 Beijing strains) and five non-Beijing strains (12.5 % of 40 non-Beijing strains). Single SNP position seems to be not good enough for being a valuable marker of W-Beijing
385
strains. In our experiment, the combination of two SNPs in Rv2629 and Rv0444c, respectively, resulted in the best Positive predictive value of Beijing/non-Beijing type 94.38 %, compared with each single mutation. Two independent researches showed that the ratio of M. tuberculosis with Beijing genotype is 77.8 % in five China provinces and 69.2 % in rural China [22, 23]. It is similar to the ratio of Beijing strains (73.8 %) in our experiment, which means that the positive predictive value of comutation, 94.38 %, is available for reference in clinical practice in China. Low consumption of time and cost, high sensitivity, and requirement of samples of low-purity quality and quantity enable the analysis of SNPs in Rv2629 and Rv0444c to be a rapid, reliable, and sensitive method for the efficient prospective survey of high-risk M. tuberculosis Beijing strains, for adoption even among developing countries. To the present authors’ knowledge, this is the first report on the unique mutations associated with Rv0444c in M. tuberculosis W-Beijing strains. Further studies are underway to investigate the associations of Rv2629 and Rv0444c mutations in W-Beijing strains with a larger sample analysis and to determine the effects of such mutations on the pathogenesis of W-Beijing strains. Acknowledgments This study was supported by grants from the 12th Five Year Programs for the prevention and cure of great infectious diseases (No. 2012ZX10003-002); The National Technology Programs for Invention and Production of a Great New Drug (No. 2011ZX09506-001); The National Post-doctorate Science Foundation of China (No. 20070410688); and Shanghai Municipal Natural Science Foundation (No. 12ZR1402100). [The sponsors for the funding had no role in the study design, data collection, and analysis, decision to publish, or in the preparation of the manuscript. The authors are grateful to Ms. LiJuan ChunYu, Mr. JunTao Mai, Ms Jing Zhang (Fudan University) for their technical support, and Dr. RuiLiang Jin (Shanghai Pulmonary Hospital) for assistance in the preparation of M. tuberculosis clinical strains.]
References 1. Anonymous, WHO report 2012 (2012) Global tuberculosis report. World Health Organization, Geneva 2. Bifani PJ, Mathema B, Kurepina NE, Kreiswirth BN (2002) Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends Microbiol 10:45–52 3. Glynn JR, Whiteley J, Bifani PJ, Kremer K, van Soolingen D (2002) Worldwide occurrence of Beijing/W strains of Mycobacterium tuberculosis: a systematic review. Emerg Infect Dis 8:843–849 4. van Soolingen D, Qian L, de Haas PE, Douglas JT, Traore H et al (1995) Predominance of a single genotype of Mycobacterium tuberculosis in countries of East Asia. J Clin Microbiol 33:3234–3238 5. Agerton TB, Valway SE, Blinkhorn RJ, Shilkret KL, Reves R et al (1999) Spread of strain W, a highly drug-resistant strain of Mycobacterium tuberculosis, across the United States. Clin Infect Dis 29:85–92 (discussion 93–95)
123
386 6. Bifani PJ, Plikaytis BB, Kapur V, Stockbauer K, Pan X et al (1996) Origin and interstate spread of a New York City multidrug-resistant Mycobacterium tuberculosis clone family. JAMA 275:452–457 7. Bifani PJ, Mathema B, Liu Z, Moghazeh SL, Shopsin B et al (1999) Identification of a W variant outbreak of Mycobacterium tuberculosis via population-based molecular epidemiology. JAMA 282:2321–2327 8. Kremer K, Glynn JR, Lillebaek T, Niemann S, Kurepina NE et al (2004) Definition of the Beijing/W lineage of Mycobacterium tuberculosis on the basis of genetic markers. J Clin Microbiol 42:4040–4049 9. European Concerted Action on New Generation Genetic Markers and Techniques for the Epidemiology and Control of Tuberculosis RIVM, Bilthoven, the Netherlands (2006) Beijing/W genotype Mycobacterium tuberculosis and drug resistance. Emerg Infect Dis 12:736–743 10. Moss AR, Alland D, Telzak E, Hewlett D Jr, Sharp V et al (1997) A city-wide outbreak of a multiple-drug-resistant strain of Mycobacterium tuberculosis in New York. Int J Tuberc Lung Dis 1:115–121 11. Narvskaya O, Otten T, Limeschenko E, Sapozhnikova N, Graschenkova O et al (2002) Nosocomial outbreak of multidrugresistant tuberculosis caused by a strain of Mycobacterium tuberculosis W-Beijing family in St. Petersburg, Russia. Eur J Clin Microbiol Infect Dis 21:596–602 12. Matsumoto T, Ano H, Nagai T, Danno K, Takashima T et al (2005) IS6110 DNA fingerprinting analysis of individually separated colonies of Mycobacterium tuberculosis. Tuberculosis (Edinb) 85:207–212 13. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D et al (1997) Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 35:907–914 14. Hillemann D, Warren R, Kubica T, Ru¨sch-Gerdes S, Niemann S (2006) Rapid detection of Mycobacterium tuberculosis Beijing genotype strains by real-time PCR. J Clin Microbiol 44:302–306 15. Saı¨d-Salim B, Mostowy S, Kristof AS, Behr MA (2006) Mutations in Mycobacterium tuberculosis Rv0444c, the gene encoding anti-SigK, explain high level expression of MPB70 and MPB83 in Mycobacterium bovis. Mol Microbiol 62:1251–1263 16. Voskuil MI, Schnappinger D, Visconti KC, Harrell MI, Dolganov GM et al (2003) Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. J Exp Med 198:705–713 17. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI et al (2003) Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 48:833–843
123
L. Zhang et al.: Method of Identifying M. tuberculosis 18. Chen J, Tsolaki AG, Shen X, Jiang X, Mei J et al (2007) Deletion-targeted multiplex PCR (DTM-PCR) for identification of Beijing/W genotypes of Mycobacterium tuberculosis. Tuberculosis (Edinb) 87:446–449 19. Tsolaki AG, Gagneux S, Pym AS, Goguet de la Salmoniere YO, Kreiswirth BN et al (2005) Genomic deletions classify the Beijing/W strains as a distinct genetic lineage of Mycobacterium tuberculosis. J Clin Microbiol 43:3185–3191 20. Noordhoek GT, Kaan JA, Mulder S, Wilke H, Kolk AH (1995) Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. J Clin Pathol 48:810–814 21. Jiang X, Zhang Y, Zhang W, Gao F, Jin J et al (2007) Identification of unique genetic markers in Rv0927c among Mycobacterium tuberculosis W-Beijing strains. Microbes Infect 9:241–246 22. Hu Y, Jiang WL, Zhao Q, Wang WB, Xu B (2009) The combined application of multiple genotyping methods in identifying genotypes of Mycobacterium tuberculosis strain circulating in rural China. Zhonghua Jie He He Hu Xi Za Zhi 32:576–580 23. Guo YL, Liu Y, Wang SM, Li CY, Jiang GL et al (2011) Genotyping and drug resistance patterns of Mycobacterium tuberculosis strains in five provinces of China. Int J Tuberc Lung Dis 15:789–794 24. Theus SA, Cave MD, Eisenach KD (2005) Intracellular macrophage growth rates and cytokine profiles of Mycobacterium tuberculosis strains with different transmission dynamics. J Infect Dis 191:453–460 25. Alonso M, Navarro Y, Barletta F, Martı´nez Lirola M, Gotuzzo E et al (2011) A novel method for the rapid and prospective identification of Beijing Mycobacterium tuberculosis strains by highresolution melting analysis. Clin Microbiol Infect 17:349–357 26. Malkhed V, Gudlur B, Kondagari B, Dulapalli R, Vuruputuri U (2010) Study of interactions between Mycobacterium tuberculosis proteins: SigK and anti-SigK. J Mol Model 17(5):1109–1119 27. Wiker HG (2009) MPB70 and MPB83–major antigens of Mycobacterium bovis. Scand J Immunol 69:492–499 28. Medina E, Ryan L, LaCourse R, North RJ (2006) Superior virulence of Mycobacterium bovis over Mycobacterium tuberculosis (Mtb) for Mtb-resistant and Mtb-susceptible mice is manifest as an ability to cause extrapulmonary disease. Tuberculosis (Edinb) 86:20–27 29. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA et al (2003) Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J Exp Med 198:693–704
A Novel Method of Identifying Mycobacterium tuberculosis Beijing Strains by Detecting SNPs in Rv0444c and Rv2629 Lu Zhang • Wenxi Xu • Zhenling Cui • Yanyan Liu • Wenjie Wang • Jie Wang • Ding Hu • Dingqian Liu • Honghai Wang
Received: 1 June 2013 / Accepted: 22 September 2013 / Published online: 12 November 2013 Ó Springer Science+Business Media New York 2013
Abstract A particular genotype of tuberculosis, named Beijing strain, is strongly associated with drug resistance and high virulence. Therefore, rapid prospective identification of Mycobacterium tuberculosis Beijing strains is very important for identifying and controlling tuberculosis of Beijing genotype. In the present study, we found that the co-mutation, A191C in Rv2629 and G243C in Rv0444c, is closely related to Beijing genotype. Gene Rv2629 and Rv0444c of 139 clinical isolates of M. tuberculosis were analyzed by PCR amplification and sequencing. Among 99 Beijing strains, 86 % (n = 85) isolates had the mutation G243C in Rv0444c and 92.93 % (n = 92) isolates had the mutation A191C in Rv2629. Among 40 non-Beijing isolates, only six isolates carried the mutation G243C in Rv0444c and eight isolates carried the mutation A191C in Rv2629. The co-mutation existed in 84.85 % (n = 84) of 99 clinical genome samples of W-Beijing strains and in
Lu Zhang and Wenxi Xu contributed equally to this work and share first author. L. Zhang W. Xu Y. Liu W. Wang D. Hu H. Wang (&) State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433, People’s Republic of China e-mail: [email protected] L. Zhang e-mail: [email protected] Z. Cui J. Wang Shanghai Key Laboratory of Tuberculosis, Shanghai Pulmonary Hospital, Medical School, Tongji University, Shanghai 200433, People’s Republic of China D. Liu Shanghai Medical College of Fudan University, Shanghai 200032, People’s Republic of China
only 12.5 % (n = 5) of the 40 non-Beijing strains, and the positive predictive value of 94.38 %, obtained in our experiment with a designed ratio of Beijing isolates, is similar to that in China at present. This result suggested that the detection method of the co-mutation, A191C in Rv2629 and G243C in Rv0444c, proposed in this study was a rapid, reliable, and sensitive one for identifying tuberculosis with Beijing genotype.
Introduction Mycobacterium tuberculosis is one of the most threatening human pathogens, infecting nearly one-third of the world’s population. As a major problem concerning public health, tuberculosis remains extremely detrimental to human health, resulting in over 8.7 million new cases and 1.4 million deaths each year [1]. Recent studies have suggested a particular genotype of tuberculosis, named Beijing strain, which is strongly associated with drug resistance and high virulence of M. tuberculosis and contributes to the epidemic in Asia, Europe, Africa, and the USA [2–7]. It is estimated that more than a quarter of worldwide TB cases are caused by Beijing strains [8, 9]. These strains have caused outbreaks of multidrug-resistant (MDR) tuberculosis [10, 11] and show a distinct association with drug resistance, given the findings of some recent investigations [3]. Their wide distribution suggests that they have selective advantages over other M. tuberculosis strains [2, 9]. Given the prevalence of the W-Beijing strain, a simple and rapid typing method for this family is urgently needed for epidemiology and control of the disease. At present, there are two main methods for the identification of Beijing genotype strains: IS6110 DNA
123
382
L. Zhang et al.: Method of Identifying M. tuberculosis
DNA from clinical strains was extracted using genomic DNA extraction kit (Axygen Biosciences). Incubating duration of Lysozyme and RNaseA ranged from 30 min to 4 h to make sure that the thick cell wall of H37Rv and clinical strains were completely digested. PCR primers (P1: GGAGTCGTTGAGGGTGTTCATCAGCTCAGTC and P2: CGCCAAGGCCGCATAGTCACGGTCG) were designed to detect the presence or the absence of this deletion in the genome of clinical strains. PCR products were separated on 0.8 % agarose gels.
fingerprinting (restriction fragment length polymorphism typing) [12] and Spoligotyping [13]. However, both methodologies contain multifarious working steps in the laboratory, and especially, the IS6110 fingerprinting method requires a high level of standardization and normalization procedures to ensure comparable results. In addition to this, the sensitivities of both the methods are too low to identify the presence of subpopulations of Beijing or non-Beijing strains, if the samples are mixed infections or clinical material [14]. In this article, we present a novel methodology based on the single nucleotide polymorphism (SNP) of key genes in M. tuberculosis genome. In contrast to these two methods, detecting SNP of certain gene is fast, inexpensive, convenient, and even equally accurate if we detect the appropriate genes. In our preliminary study, we discovered a close correlation between clinical strains of Beijing genotype and the co-mutations of G243C in Rv0444c as well as A191C in Rv2629. Rv0444c, located immediately downstream of SigK and encoded anti-SigK (RskA), binds to SigK through its N-terminal cytoplasmic domain, and inhibits the activity of SigK in vitro [15]. Rv2629 was predicted to be present in the DosR|Rv3133c regulon in M. tuberculosis 1254 [16], which is a transcription factor that mediates the hypoxic response of M. tuberculosis [17]. Further experiments with a larger clinical sample size supported our earlier results, suggesting that the co-mutation of Rv0444c and Rv2629 is a potential marker of Beijing genotype strains.
Genomic DNAs of M. tuberculosis H37Rv and clinical samples were prepared as described previously [20]. Genomic DNAs from H37Rv and clinical strains were extracted using genomic DNA extraction kit procured from Axygen Biosciences. Genes Rv2629 and Rv0444c were amplified with primers as illustrated in Table 1. The PCR product was purified using PCR purification kit (Axygen Biosciences) and sequenced by ABI-PRISM3730. Sequenced products were analyzed by alignment searches against published genome sequences, namely M. tuberculosis H37Rv, using Tuberculist (http://genolist.pasteur.fr/ TubercuList/). For the detection of SNP positions in couples of closely related strains, genomes of H37Ra, M. marinum, M. ulcerans, M. bovis AF2122 97, M. bovis BCG, M. tuberculosis C, CDC1551, F11, and Haalem were provided at NCBI. (http://www.ncbi.nlm.nih.gov/sutils/ genom_table.cgi).
Methods
Cloning and Expressions of Rv0444c and Rv2629, and Antibodies Preparation
Bacterial Strains and Culture Conditions The reference strains H37Rv and 139 clinical M. tuberculosis isolates were obtained from Shanghai Pulmonary Disease Hospital. All the patients from whom we collected strains have signed the Information consent form. Bacteria were grown without shaking in Middlebrook 7H9 medium supplemented with 0.2 % (v/v) glycerol and 10 % albumin-dextrose-catalase (ADC) at 37 °C. The ethics approvals for these studies were obtained from the Ethics Committee of the School of Life Science, Fudan University, and the Ethics Committee of Shanghai Pulmonary Hospital, respectively. Spoligotyping Spoligotyping was performed as previously described [18]. The genomic deletion RD105 is a phylogenetical marker which defines M. tuberculosis Beijing strains [19]. Genome
123
PCR and DNA Sequencing
The experiment was performed as previously described [21] with minor modifications. Both the genes, Rv0444c and Rv2629, were amplified from genome of M. tuberculosis H37Rv. The PCR product was purified, digested with restriction enzyme EcoRI and HindIII (New England Biolabs), and ligated into pET28a vector to obtain two constructed plasmids, pET28a-Rv0444c and pET28aRv2629. These two plasmids were transformed into E. coli strain BL21(DE3), and the expressing strains were
Table 1 Primers for PCR and sequencing of genes Rv2629 and Rv0444c Name
Sequence
Rv0444c forward primer
50 CTTTCAACGACGAAGTTCGAG30
Rv0444c reverse primer
50 ACATTGTTCATCACCAGCAGAC30
Rv2629 forward primer
50 CGACGACTCGCACGACACT30
Rv2629 reverse primer
50 CAGTTCATTCGGATGGCTTCTT30
L. Zhang et al.: Method of Identifying M. tuberculosis
383
incubated at 37 °C and induced overnight after isopropylb-D-thiogalactoside was added into culture solution. Cells were harvested and disrupted by ultrasonication, and inclusion bodies were separated from the cell extract by centrifugation. Thereafter, the pellet was washed and collected by centrifugation. After determining the purity by means of SDS-PAGE, two proteins were used to immunize rabbits. After three immunizations, polyclonal antibodies against the recombinant protein were harvested and tested for reactivity with Rv0444c and Rv2629 by Western blotting. 2. Western Blot of Clinical Isolates M. tuberculosis strains were grown for approximately 15 days and harvested. Bacterial pellets were washed twice, resuspended, and sonicated. Cell lysates were centrifuged, and the supernatants were quantified. Proteins were separated by 12 % SDS-PAGE and then transferred to PVDF membranes in Tris glycine buffer. The membrane was then blocked in 5 % nonfat milk in TBS with 0.05 % Tween 20 (TBST). Blots were incubated by means of the polyclonal antibody against Rv2629 or Rv0444c in TBST. Alkaline-phosphatase-conjugated goat anti-rabbit IgGs (Sigma) were added to the blots at a 1:30,000 dilution. Nitrobluetetrazolium/5-bromo-4-chloro-3-indoylphosphate (NBT/BCIP, Sigma) was used to visualize the location of the bound antibody.
Results 1.
Co-mutations of A191C in Rv2629 and G243C in Rv0444c rarely existed in H37Rv and other non-Beijing strains. In the earlier experiment, we found that two-point mutations, A191C in Rv2629 and G243C in Rv0444c, were closely associated with Beijing genotype. The mutation of A191C in Rv2629 changes the 67 codon
from GAT to GCT, which leads to an amino acid mutation from aspartic acid to alanine; meanwhile, the mutation of G243C in Rv0444c changed the 81 codon from GAG to GAC, which leads to an amino acid mutation from glutamic acid to aspartic acid. In addition, we blasted those SNPs in NCBI, and it turned out that they were rarely found in environment mycobacteria or couples of closely related strains of non-Beijing M. tuberculosis (Figs. 1, 2). It is suggested that the co-mutations of A191C in Rv2629 and G243C in Rv0444c might be a marker of Beijing genotype. Co-mutation of A191C in Rv2629 and G243C in Rv0444c is an available marker of W-Beijing genotype. To confirm this conclusion, we collected and identified 139 clinical M. tuberculosis isolates from Shanghai Pulmonary Disease Hospital by Spoligotyping as mentioned before. Of these, 71 % (n = 99) were revealed to be Beijing strains. The rest 40 were defined as non-Beijing strains. The ratio of Beijing isolates to the whole samples is similar to the current ratio of Beijing strains in China according to several investigations performed in China [22, 23]. Genes Rv2629 and Rv0444c were amplified from the genome of clinical isolates and sequenced to detect two-point mutations, A191C in Rv2629 and G243C in Rv0444c. Then, we counted the frequencies of those two mutations. The statistical result is summarized in Table 2. Among the 99 clinical isolates with Beijing phenotype, 86 % (n = 85) isolates had single-point mutation, G243C in Rv0444c; meanwhile, among the 40 clinical non-Beijing isolates, only six isolates carried the said mutation in Rv0444c. As regards the mutation A191C in Rv2629, we tested the 99 Beijing genotype isolates and the 40 non-Beijing genotype isolates, and the analysis showed that the point mutation A191C existed in 92.93 % (n = 92) of the 99 clinical W-Beijing strains and only in 8 of the 40 non-Beijing strains. When we take into account both
Fig. 1 The mutation, G243C of Rv0444c, in several environment mycobacteria and related strains of M. tuberculosis. Red square shows the mutation, and the blue square shows the base at the same relative position as the mutation in M. tuberculosis Beijing strains (Color figure online)
123
384
L. Zhang et al.: Method of Identifying M. tuberculosis
Fig. 2 The mutation, A191C of Rv2629, in several environment mycobacteria and related strains of M. tuberculosis. Red square shows the mutation, and the blue square shows the base at the same relative position as the mutation in M. tuberculosis Beijing strains (Color figure online)
Table 2 Summary of the statistical result of two-point mutations in Rv2629 and Rv0444c SNPs
A191C in Rv2629
G243C in Rv0444c
Co-mutation of Rv2629 and Rv0444c
Samples number (Beijing/non-Beijing)a
99/40
99/40
99/40
Sensibility (%)
92.93
86
84.85
Specificity (%)
80.00
85.00
87.50
Positive predictive value (%)
92.00
93
94.38
Negative predictive value (%)
82.05
70.83
70
a
Beijing and non-Beijing means Beijing strains and non-Beijing strains of M. tuberculosis, respectively
Fig. 3 Western blot analysis of expression levels about Rv2629 and Rv0444c. Lanes 1 H37Rv, 2–8, seven clinical strains with the comutations of Rv0444c and Rv2629. a Rv2629, b Rv0444c
3.
the two-point mutations, it is observed that the comutations, A191C in Rv2629 and G243C in Rv0444c, existed in 84.85 % (n = 84) of the 99 clinical genome samples of W-Beijing strains, and only in 12.5 % (n = 5) of the 40 non-Beijing strains. Based on these findings, the positive predictive value and negative predictive value of the co-mutations are 94.38 and 70 %, respectively. Confirmation of the expressions of Rv0444c and Rv2629 in clinical isolates. To confirm that genes Rv0444c and Rv2629 indeed express in clinical isolates, these two proteins were cloned and expressed. Corresponding rabbit polyclonal antibodies were prepared. We randomly chose seven clinical strains and prepared the whole cell protein. The expression levels of these two proteins in clinical isolates were detected by western blotting (Fig. 3).
123
Discussion The threat posed by the M. tuberculosis Beijing strains due to their drug resistance, higher infectivity, and higher transmissibility necessitate diagnostic strategies based on rapid identification [2, 3, 24]. Two classical methods, IS6110 fingerprinting and Spoligotyping, are widely being used currently. During a complete IS6110 fingerprinting test, we need to get abundant high-quality genomic DNA of clinical strains at first. Usually, bacteria in clinical samples are not enough, and bacterial incubation is needed to be performed to get plenty of bacteria. Afterward, genomic DNA is digested, electrophoresed through agarose gel, and blotted onto a nylon membrane. After blotting, the membranes are hybridized with an IS6110 probe and scanned in an appropriate instrument. As the acknowledged Golden Standard, IS6110 fingerprinting is not perfect, for it requires high-quality genomic DNA and multiple working steps, and does not ensure that all the Beijing strains are identified. Laboratory conditions and experiment materials can largely influence the results of IS6110 fingerprinting and interfere with making firm conclusion, especially when two labs need to compare these results or to store a great number of results for future use. Spoligotyping is a time-consuming method, which requires 45 isolates to be analyzed in each assay and expensive equipment. Prohibitive costof equipment and time constraints limit the applicability of these methods in some under-developed countries [8, 25]. Compared with IS6110 fingerprinting, SNPs assay of clinical strains is more convenient in terms of cost and time consumed. During the SNPs assay, there is no need to get high-quality genomic DNAs of strains. Sometimes, clinical samples like blood and sputum are enough for PCR amplification, and even if bacterial incubation is needed, the incubation time is far less than that incurred in the IS6110 fingerprinting test. After DNAs’ amplification and DNAs’ sequencing, data of SNPs are acquired and analyzed. The key that determines the accuracy of the SNPs
L. Zhang et al.: Method of Identifying M. tuberculosis
assay is the SNP site, but not laboratory conditions, which means that the results of SNPs assay can be easily described and compared. Depending on the convenience and low cost and the time consumed, SNPs assays have been widely used to differentiate between clinical isolates. In this study, Rv2629 and Rv0444c proteins were confirmed to be expressed in all clinical strains by Western blot analysis. The experiment is based on the detection of two SNPs of these genes, A191C in Rv2629 and G243C in Rv0444c. SNPs in Rv0444c are concerned with virulence diversity between different strains of M. tuberculosis. Rv0444c, located immediately downstream of SigK and encoding anti-SigK (RskA), binds to SigK through its N-terminal cytoplasmic domain and inhibits its activity in vitro [15]. The mutations in Rv0444c like C320T and C551T of Rv0444c are closely related to each other and alters strain virulence by means of regulating the expressions of MPB70 and MPB83[26–29]. The SNP G243C in Rv0444c on which we focus is just located in the N-terminal cytoplasmic domain. This mutation results in a change of amino acid 81 from glutamic acid to aspartic acid, probably leading to aborted binding between RskA and SigK, and then causing a high expression levels of MPB70 and MPB83 in W-Beijing strains. The forecast of the close relation between the SNP of G243C and the high virulence of Beijing strains is reasonably good. The understanding of gene Rv2629 is poor and far from satisfactory. This gene was predicted to be in the DosR|Rv3133c regulon in M. tuberculosis 1254 [16], which is a transcription factor that mediates the hypoxic response of M. tuberculosis [17]. Besides, other details concerning the functions of Rv2629 and corresponding protein are still unclear. Alonso et al. [25] evaluated a real-time PCR followed by high-resolution melting (HRM) based on the identification of a single SNP position in the Rv2629 gene which is qualified as a marker of W-Beijing strains (A191C for Beijing genotype and A191A for non-Beijing genotype). By means of the combined methodology, they succeeded in assigning a Beijing/non-Beijing type in a high percentage (84.1 %) of 44 clinical respiratory samples analyzed; however, as the effect of this method depended on the sample quality, they were unable to assign a corresponding genotype in 26.9 % of the specimens, especially for those with a low/ intermediate load. We analyzed gene sequences of Rv2629 and Rv0444c in 99 Beijing strains and 40 non-Beijing strains, and found that the co-mutations of A191C in Rv2629 and G243C in Rv0444c existed in 84 Beijing strains (84.85 % of 99 Beijing strains) and five non-Beijing strains (12.5 % of 40 non-Beijing strains). Single SNP position seems to be not good enough for being a valuable marker of W-Beijing
385
strains. In our experiment, the combination of two SNPs in Rv2629 and Rv0444c, respectively, resulted in the best Positive predictive value of Beijing/non-Beijing type 94.38 %, compared with each single mutation. Two independent researches showed that the ratio of M. tuberculosis with Beijing genotype is 77.8 % in five China provinces and 69.2 % in rural China [22, 23]. It is similar to the ratio of Beijing strains (73.8 %) in our experiment, which means that the positive predictive value of comutation, 94.38 %, is available for reference in clinical practice in China. Low consumption of time and cost, high sensitivity, and requirement of samples of low-purity quality and quantity enable the analysis of SNPs in Rv2629 and Rv0444c to be a rapid, reliable, and sensitive method for the efficient prospective survey of high-risk M. tuberculosis Beijing strains, for adoption even among developing countries. To the present authors’ knowledge, this is the first report on the unique mutations associated with Rv0444c in M. tuberculosis W-Beijing strains. Further studies are underway to investigate the associations of Rv2629 and Rv0444c mutations in W-Beijing strains with a larger sample analysis and to determine the effects of such mutations on the pathogenesis of W-Beijing strains. Acknowledgments This study was supported by grants from the 12th Five Year Programs for the prevention and cure of great infectious diseases (No. 2012ZX10003-002); The National Technology Programs for Invention and Production of a Great New Drug (No. 2011ZX09506-001); The National Post-doctorate Science Foundation of China (No. 20070410688); and Shanghai Municipal Natural Science Foundation (No. 12ZR1402100). [The sponsors for the funding had no role in the study design, data collection, and analysis, decision to publish, or in the preparation of the manuscript. The authors are grateful to Ms. LiJuan ChunYu, Mr. JunTao Mai, Ms Jing Zhang (Fudan University) for their technical support, and Dr. RuiLiang Jin (Shanghai Pulmonary Hospital) for assistance in the preparation of M. tuberculosis clinical strains.]
References 1. Anonymous, WHO report 2012 (2012) Global tuberculosis report. World Health Organization, Geneva 2. Bifani PJ, Mathema B, Kurepina NE, Kreiswirth BN (2002) Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends Microbiol 10:45–52 3. Glynn JR, Whiteley J, Bifani PJ, Kremer K, van Soolingen D (2002) Worldwide occurrence of Beijing/W strains of Mycobacterium tuberculosis: a systematic review. Emerg Infect Dis 8:843–849 4. van Soolingen D, Qian L, de Haas PE, Douglas JT, Traore H et al (1995) Predominance of a single genotype of Mycobacterium tuberculosis in countries of East Asia. J Clin Microbiol 33:3234–3238 5. Agerton TB, Valway SE, Blinkhorn RJ, Shilkret KL, Reves R et al (1999) Spread of strain W, a highly drug-resistant strain of Mycobacterium tuberculosis, across the United States. Clin Infect Dis 29:85–92 (discussion 93–95)
123
386 6. Bifani PJ, Plikaytis BB, Kapur V, Stockbauer K, Pan X et al (1996) Origin and interstate spread of a New York City multidrug-resistant Mycobacterium tuberculosis clone family. JAMA 275:452–457 7. Bifani PJ, Mathema B, Liu Z, Moghazeh SL, Shopsin B et al (1999) Identification of a W variant outbreak of Mycobacterium tuberculosis via population-based molecular epidemiology. JAMA 282:2321–2327 8. Kremer K, Glynn JR, Lillebaek T, Niemann S, Kurepina NE et al (2004) Definition of the Beijing/W lineage of Mycobacterium tuberculosis on the basis of genetic markers. J Clin Microbiol 42:4040–4049 9. European Concerted Action on New Generation Genetic Markers and Techniques for the Epidemiology and Control of Tuberculosis RIVM, Bilthoven, the Netherlands (2006) Beijing/W genotype Mycobacterium tuberculosis and drug resistance. Emerg Infect Dis 12:736–743 10. Moss AR, Alland D, Telzak E, Hewlett D Jr, Sharp V et al (1997) A city-wide outbreak of a multiple-drug-resistant strain of Mycobacterium tuberculosis in New York. Int J Tuberc Lung Dis 1:115–121 11. Narvskaya O, Otten T, Limeschenko E, Sapozhnikova N, Graschenkova O et al (2002) Nosocomial outbreak of multidrugresistant tuberculosis caused by a strain of Mycobacterium tuberculosis W-Beijing family in St. Petersburg, Russia. Eur J Clin Microbiol Infect Dis 21:596–602 12. Matsumoto T, Ano H, Nagai T, Danno K, Takashima T et al (2005) IS6110 DNA fingerprinting analysis of individually separated colonies of Mycobacterium tuberculosis. Tuberculosis (Edinb) 85:207–212 13. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D et al (1997) Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 35:907–914 14. Hillemann D, Warren R, Kubica T, Ru¨sch-Gerdes S, Niemann S (2006) Rapid detection of Mycobacterium tuberculosis Beijing genotype strains by real-time PCR. J Clin Microbiol 44:302–306 15. Saı¨d-Salim B, Mostowy S, Kristof AS, Behr MA (2006) Mutations in Mycobacterium tuberculosis Rv0444c, the gene encoding anti-SigK, explain high level expression of MPB70 and MPB83 in Mycobacterium bovis. Mol Microbiol 62:1251–1263 16. Voskuil MI, Schnappinger D, Visconti KC, Harrell MI, Dolganov GM et al (2003) Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. J Exp Med 198:705–713 17. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI et al (2003) Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 48:833–843
123
L. Zhang et al.: Method of Identifying M. tuberculosis 18. Chen J, Tsolaki AG, Shen X, Jiang X, Mei J et al (2007) Deletion-targeted multiplex PCR (DTM-PCR) for identification of Beijing/W genotypes of Mycobacterium tuberculosis. Tuberculosis (Edinb) 87:446–449 19. Tsolaki AG, Gagneux S, Pym AS, Goguet de la Salmoniere YO, Kreiswirth BN et al (2005) Genomic deletions classify the Beijing/W strains as a distinct genetic lineage of Mycobacterium tuberculosis. J Clin Microbiol 43:3185–3191 20. Noordhoek GT, Kaan JA, Mulder S, Wilke H, Kolk AH (1995) Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. J Clin Pathol 48:810–814 21. Jiang X, Zhang Y, Zhang W, Gao F, Jin J et al (2007) Identification of unique genetic markers in Rv0927c among Mycobacterium tuberculosis W-Beijing strains. Microbes Infect 9:241–246 22. Hu Y, Jiang WL, Zhao Q, Wang WB, Xu B (2009) The combined application of multiple genotyping methods in identifying genotypes of Mycobacterium tuberculosis strain circulating in rural China. Zhonghua Jie He He Hu Xi Za Zhi 32:576–580 23. Guo YL, Liu Y, Wang SM, Li CY, Jiang GL et al (2011) Genotyping and drug resistance patterns of Mycobacterium tuberculosis strains in five provinces of China. Int J Tuberc Lung Dis 15:789–794 24. Theus SA, Cave MD, Eisenach KD (2005) Intracellular macrophage growth rates and cytokine profiles of Mycobacterium tuberculosis strains with different transmission dynamics. J Infect Dis 191:453–460 25. Alonso M, Navarro Y, Barletta F, Martı´nez Lirola M, Gotuzzo E et al (2011) A novel method for the rapid and prospective identification of Beijing Mycobacterium tuberculosis strains by highresolution melting analysis. Clin Microbiol Infect 17:349–357 26. Malkhed V, Gudlur B, Kondagari B, Dulapalli R, Vuruputuri U (2010) Study of interactions between Mycobacterium tuberculosis proteins: SigK and anti-SigK. J Mol Model 17(5):1109–1119 27. Wiker HG (2009) MPB70 and MPB83–major antigens of Mycobacterium bovis. Scand J Immunol 69:492–499 28. Medina E, Ryan L, LaCourse R, North RJ (2006) Superior virulence of Mycobacterium bovis over Mycobacterium tuberculosis (Mtb) for Mtb-resistant and Mtb-susceptible mice is manifest as an ability to cause extrapulmonary disease. Tuberculosis (Edinb) 86:20–27 29. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA et al (2003) Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J Exp Med 198:693–704
