Pediatric Neurology 51 (2014) 741e744
Contents lists available at ScienceDirect
Pediatric Neurology journal homepage: www.elsevier.com/locate/pnu
Clinical Observations
A Novel Nonsense Mutation in SCN9A in a Moroccan Child With Congenital Insensitivity to Pain Maria Mansouri MD a, *, Siham Chafai Elalaoui MD a, Bouchra Ouled Amar Bencheikh PhD b, c, Mohamed El Alloussi MD d, Patrick A. Dion PhD b, c, Abdelaziz Sefiani MD, PhD a, e, Guy A. Rouleau MD, PhD b, f a
Département de Génétique Médicale, Institut National d’Hygiène, Rabat, Morocco Neurology and Neurosurgery Department, McGill University, Montréal, Quebec, Canada c Pathology and Cell Biology, Université de Montréal, Montréal, Quebec, Canada d Service d’odontologie pédiatrique, Faculté de médecine dentaire, Université Mohammed V Souissi, Rabat, Morocco e Centre de génomique humaine, Faculté de Médecine et de Pharmacie de Rabat, Université Mohammed V Souissi, Rabat, Morocco f Montreal Neurological Institute and Hospital, McGill University, Montréal, Quebec, Canada b
abstract BACKGROUND: Congenital insensitivity to pain is a rare autosomal recessive disease. Individuals who are diagnosed
with congenital insensitivity to pain usually present severely impaired pain perception, and in some cases, they also manifest a decreased sense of smell (anosmia). This disease is caused by loss of function mutations affecting the SCN9A gene, which encodes the voltage-gated sodium channel Nav1.7. It is noteworthy that nearly every mutation linking this particular channel to congenital insensitivity to pain has been demonstrated to underlie the translation of a truncated protein. METHODS: Complete sequencing of the SCN9A gene in a Moroccan 3-year-old child with congenital insensitivity to pain. RESULT: We identified a homozygous nonsense mutation (c.4795C>T) in exon 27, that results in codon stop in the amino acid (p.R1599X). CONCLUSION: In this report we present a previously unreported homozygous nonsense mutation present in a consanguineous Moroccan congenital insensitivity to pain patient with anosmia. The identification of this mutation extends the spectrum of mutations affecting the Nav1.7 channel, and it confirms earlier studies that established Nav1.7 roles in nociception and the sense of smell. Keywords: congenital insensitivity to pain, SCN9A, novel mutation, anosmia
Pediatr Neurol 2014; 51: 741-744 Ó 2014 Elsevier Inc. All rights reserved. Introduction
Pain is a highly pervasive sensory modality in species which confers protection against dangerous and noxious stimuli. Both loss of pain sensation or hypersensitivity to pain can compromise survival. Congenital insensitivity to pain (CIP) is an autosomal recessive disease caused by inactivating mutations of the Nav1.7 channel. To date, almost every SCN9A mutations reported to cause this disease have been demonstrated to lead to a premature truncation of the Nav1.7 protein and presumably to its rapid degradation.1 Article History: Received March 26, 2014; Accepted in final form June 14, 2014 * Communications should be addressed to: Dr. Mansouri; Département de Génétique Médicale; Institut National d’Hygiène; 27 Avenue Ibn Batouta, B.P. 769, 11400 Rabat, Morocco. E-mail address: [email protected] 0887-8994/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pediatrneurol.2014.06.009
Mutations in SCN9A have been associated with three different human pain disorders: biallelic loss of function mutations result in congenital insensitivity to pain (CIP, OMIM: 243000), whereas gain of function mutations cause primary erythermalgia (OMIM: 133020) and episodic pain in paroxysmal extreme pain disorder (OMIM: 167400). SCN9A (sodium channel protein type 9 subunit alpha) encodes the voltage-gated sodium channel Nav1.7, a protein highly expressed in nociceptive neurons. Recently, Weiss et al.2 reported a study proving that Nav1.7 is an essential component of the normal olfactory pathway. We describe a 3-year-old girl with CIP and a congenital general anosmia. She was born to consanguineous Moroccan parents with a novel homozygous nonsense mutation in SCN9A. This is a novel mutation that has never been reported in the literature.
742
M. Mansouri et al. / Pediatric Neurology 51 (2014) 741e744
Material and Methods Patient description The patient was a 3-year-old girl, the third child of healthy consanguineous Moroccan parents, born to a 30-year-old mother and 34-yearold father. Her siblings are all unaffected. Pregnancy course was normal, without complications or any history of drug abuse, and delivery was also normal. There is no known history of other neurological disorders within the family. She had normal psychomotor development. The child was seen in consultation at age 2 years for insensitivity to pain. Her parents reported that the child reacts abnormally to the pain; she had failed to indicate any discomfort with earlier childhood vaccinations or blood samples. The family also reported that the child would bite her fingers during teething, and she did not hurt during falls when learning to walk. The child has no history of bone fracture or oral and corneal lesions, and she has never been operated upon.
Examination at age 2 years revealed scars from bites on her fingers, ulceration of her tongue, and scarring from injury on her. She was able to feel pin prick and fine touch but had a complete insensitivity to painful stimuli caused by squeezing finger tips. The deep tendon reflexes were normal. Indifference to balsamic vinegar odor test revealed a smell deficit. The University of Pennsylvania Smell Identification Test could not be performed because of her young age. Otherwise, autonomic function has been normal; she had a normal histamine flare response, sweated normally with no pressure trouble, or digestive abnormalities. Nerve conduction studies revealed normal motor conduction. The electromyogram and brain scan were normal.
Methods Informed consent was obtained from the proband’s parents before implementation of the clinical and genetic studies. Peripheral blood was collected from the affected child and their parents. Genomic DNA was
TABLE 1. Primer Sequences and Amplification Conditions
Exon
Forward Primers
Reverse Primers
Conditions and Program
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27_a 27_b 27_c
TTCTTGGCAGGCAAATAGTTAAG AGATGCGTTGATGACATTGG CCTCAAATATTTCAAATTCCCAC AAAGATTTACATGGTGGTTGTATTC CCCCAAACGTAGAAAATACCTTG TTTGATATAATGCATGACTTTCTAGG TTTACCTCCTTTATCACAATCACAG AAGGCTATTTAGCTTGTGTCCTG CAGATTTGCTCATGCCTGTC TGTCCTGTCCTAGGGTTTCC AGGCCAGTGGGTTCAGTG aacccagcaatctaggctctac GGAGTGAAACAGACAAATGGC ggaacacagtaaatgctaagcaac TCAAGATTGGAAACATTGAAAAG GAGGAGTCTACCCTCGCCTC TTTTGGCCACGTACTTGTTAG TTTGGTTGAGGGAGTATCACAG CTGGCCCATGTCAATATTATG tgcttcatcattttattgacacaa GTCTGCATGGCATTTCTTTC GGACTAAGATTTAGAATGTTACTTGGG TGTTTGAATTACCTGGTCAAACC AGAAAGATGTAGACAATGATTCTGG ACAAAAGCCAATTCCTCGAC gagtcatcatttcaggtagcataca TCAGTTGAAGGAGACTGTGGTAAC TTAGTGGTGACCGGATCCAT
TTTTATACAGAAGGAAGCCAACAG AATATTGCCACTCTCCCAGTC GGCAGGAAAAGGAAAGGATG CTGTGCTGCCTGAGATTTTC TGATTGTGGAAAACAGAAGAAATC CCAAATTCACACTGTAGCAGC CAAACTGACTGAACATTCTTTTCC AAAACCTCCTAATACAGGCTCTTAAC TCTAGCTGGAGAAGGCCAAG TCTCTAGCATTCTGCCTCGG TGACTGATGCAGGAACAAGG TCTTCCTAAGAATTTCATGTGCC AAAATATGAAATGACAATGATGACAAC TGCAAAACCAAAGAAATACCC CACATCATCACAAAATAATTTCCAC TGGGAAGGCTCAAAGATACC tgaatcagcatggaatggag TTAATTCTAGGTAAAACAACTTGCC TTTCTAAAAGAATAAACCTATAGCCTG caactcataatttctacatacccattg ggccAAGACTGGCACTG TCTATGTGAGTCCCAAGGGC GGAAAATAATTGTTCATCCCTTTC CCTTGGATTTTGTTCTGCAAAG GAATTCAGCATATACTTCCTTGAGC TGGCAACACTAAAATTCTCCA AATCCATCTCCCCACTCTCA ACTGCACTGCCTTCGAGAAT
MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 (expansion 1 min) MM7/GC19 MM7/GC19 MM7/GC19 MM7/TD 55/48 then 50 MM7/GC19 MM7/GC19 MM7/GC19 MM7/TD 55/48 then 50 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19
MM7 Component
Stock Concentration
Final Concentration
For 15 ml Reaction
DNA H2O MgCl2 Buffer dNTP AmpliTaqGold Oligo F Oligo R
1.0 ng/mL 25 mM 10X 2,5 mM 5 U/mL 10 mM 10 mM
5 ng 1.5 mM 1X 167 mM 0.6 U 0.38 mM 0.38 mM
5.00 5.34 0.90 1.50 1.00 0.12 0.57 0.57
PCR Program: GC19 95 C 94 C 65 C 72 C 94 C 58 C 72 C 72 C
5 min 20 seconds 20 seconds 30 seconds 20 seconds 20 seconds 30 seconds 5 min
8 cycles (1.0 C/cycle)
34 cycles
42 cycles
M. Mansouri et al. / Pediatric Neurology 51 (2014) 741e744
743
FIGURE. Electropherogram depicting the homozygous mutation (A) and the heterozygous mutation (B, C) in the patient. (Color version of this figure is available in the online edition.) extracted from blood using QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA). Primers were designed using the ExonPrimer software from The University of California Santa Cruz (UCSC) Genome Browser website (www.genome.ucsc.edu). Twenty-eight sets of primers were sufficient to cover the 27 exons in SCN9A (NM_002977.2). Primer sequences and amplification conditions are listed in Table 1. PCR products were sequenced on an Applied Biosystems 3730 Sequencer.
Results We identified a single homozygous base substitution in coding exon 27, c.4795C>T that results in codon stop in the amino acid, p.R1599X. This mutation was present in heterozygote state in both of the girl’s parents (Fig).
Discussion
Perceiving, transmitting, and interpreting pain stimulus is an essential sense that is present in all complex
organisms. Because pain is the first line of defense to minimize the occurrence of cellular and tissue damages that would occur in the event they had no such sensation, pain perception likely increases the likelihood of survival. Furthermore, pain protects against aggression of environment, by teaching us what behaviors lead to injury. CIP (OMIM 243000) is an autosomal recessive disorder characterized by congenital indifference to pain.1,3 The first individual with CIP was reported in the early twentieth century.4 This disease is rare: only about 30 patients have been reported to date. Patients exhibit total insensitivity to pain with painless injuries beginning in infancy. Otherwise they have normal sensory responses on examination. Also they have a normal perception of joint position, passive movement, and vibration, as are tactile thresholds and light touch perception. There is intact ability to detect differences in temperature
TABLE 2. Mutations Reported in All Patients With Congenital Insensitivity to Pain
Mutation
Protein Nomenclature
Position
NP
Origin
Anosmia
Reference
c.2691G>A c. 2298delT c.1376C>G c.829C>T c.2488C>T c.3600delT c.4462C>T c.5067G>A c.2076dupT c.4366-10_4366-7 delGTTT c.3703_3713del11 c.4975A>T c.984C>A c.774_775delGT c.2488C>T c.2687G>A c.4108_4122del15 c.4477delA c.1567C>T c.5155T>C c.3439þ4delA c.966-2A>G c.4795C>T
W897X I767X S459X R277X R830X Phe1200LeufsX33 R1488X W1689X Glu693X
Exon 15 Exon 13 Exon 10 Exon 6 Exon 15 Exon 19 Exon 24 Exon 26 Exon 19 Intron 24 Exon 19 Exon 26 Exon 8 Exon 15
1 1 1 2 1 1 1 1 1
Northern Pakistan
Unknown
1
Switzerland France Italy United States Argentina United state
Yes Yes Yes Unknown Yes Yes
17
1
England
Yes
2 1
Canada Central Europe
Unknown Yes
16,17
Exon 15 Exon 21
1 1
England Israeli Bedouin
Partial Partial
19
Exon 10 Exon 26 Intron 17 Intron 8 Exon 27
1 1
Northern Pakistan Northern Europe
Unknown Yes
20
1
Moroccan
Unknown Yes
Abbreviations: NP ¼ Number of patients SJM ¼ Splice-junction mutation
Ile1235leufsX2 K1659X Y328X R830X R896Q DR1370_L1374 I1493SfsX8 R523X C1719R SJM R1599X
17,18
21
22
Our study
744
M. Mansouri et al. / Pediatric Neurology 51 (2014) 741e744
and to distinguish between dull and sharp stimuli. This inability to feel pain leads to various complications, such as injuries to lip or tongue caused by biting themselves in the first 4 years of life. Frequent bruises, cuts, and unnoticed fractures are reported.5-9 CIP is caused by loss of function of SCN9A (OMIM 603415) which encodes for the voltage-gated sodium channel 9, composed of 1,977amino acids. The protein is one of nine voltage-gated sodium channels (SCN) (1-9A) that constitute four similar domains with each domain comprising six ahelical transmembrane segments. Transmembrane segments 5 and 6 are the pore-lining segments, and the voltage sensor is located in transmembrane segment 4 of each domain. This channel is involved in the conversion of mechanical or chemical stimuli into electrical signals within excited cells, attached to different neurological disease.10,11 SCN9A is a tetrodotoxin-sensitive sodium channel that is expressed in the peripheral nervous system and predominantly in the dorsal root ganglia. It is implicated in pain perception including mechanical and inflammatory pain but not neuropathic pain.12,13 SCN9A is associated with indifference to pain in patients of inactivating recessive mutations and the opposite phenotype, hyperalgesia in patients of activating mutations.1,14,15 Functional studies revealed that SCN9A mutations cause loss of function of the gene.1,16 First mutations were first described in 2006, by Cox et al. in three Pakistani families, with identification of three different nonsense mutations in homozygous state.1 Goldberg et al. and Ahmad et al. confirmed these results in European, American, and a large Canadian family by finding 10 truncating SCN9A mutations.16,17 Until now, 19 families have been reported with CIP confirmed by molecular biology. These families are from different origins with eight European families, four American families, four Pakistani families, one Israeli Bedouin family, and one family of unknown origin. Different mutations have been described across these families: nine nonsense mutations, two missense mutations, eight small deletions, one insertion, and one splicing mutation. All mutations reported are truncating, and about 43% of them are nonsense (Table 2). Weiss et al.2 hypothesized that SCN9A is not only involved in pain sensation, but also an essential requirement for odor perception. Loss of this function prevents the initiation of synaptic signalization from the axon terminals at the first synapse in the olfactory system of mice. This hypothesis could explain the presence of a complete anosmia in most of the patients with CIP; 11 of 19 patients with loss of function of SCN9A have complete or partial anosmia (Table 1). We identified a novel nonsense mutation in a Moroccan patient, with typical CIP presenting complete anosmia. The mutation changes the arginine amino acid at the position 1,599 to stop codon R1599X, which is located in exon 27. This amino acid that is highly conserved is in the third transmembrane unit of the fourth domain of the sodium channel SCN9A protein. This SCN9A mutation has not been previously reported. This site is critical for the normal
function of the channel, supporting the critical role of the SCN9A channel in the perception of pain and odor perception (the olfaction system). In conclusion, we have extended the spectrum of mutations in SCN9A channels in CIP, providing a framework for unraveling the complex mechanisms of pain perception.
References 1. Cox JJ, Reimann F, Adeline KN, et al. An SCN9A channelopathy causes congenital inability to experience pain. Nature. 2006;444:894-898. 2. Weiss J, Pyrski M, Jacobi E, et al. Loss-of-function mutations in sodium channel Nav1.7 cause anosmia. Nature. 2011;472:186-190. 3. Silverman FN, Gilden J. Congenital insensitivity to pain: a neurologic syndrome with bizarre skeletal lesions. Radiology. 1959;72:176-190. 4. Dearborn GJ. A case of congenital general pure analgesia. Nerv Ment Dis. 1932;75:612-615. 5. Nagasako EM, Oaklander AL, Dworkin RH. Congenital insensitivity to pain: an update. Pain. 2003;101:213-219. 6. Axelrod FB, Hilz MJ. Inherited autonomic neuropathies. Semin Neurol. 2003;23:381-390. 7. Hirsch E, Moye D, Dimon III JH. Congenital indifference to pain: long-term follow-up of two cases. South Med J. 1995;88:851-857. 8. Sibley BG, Broussard CD, Vincent DS. A report of congenital indifference to pain as diagnosed in infancy. J La State Med Soc. 1999;151: 310-312. 9. Dimon III JH, Funk Jr FJ, Wells RE. Congenital indifference to pain with associated orthopedic abnormalities. South Med J. 1965;58: 524-529. 10. Isom LL. Sodium channel beta subunits: anything but auxiliary. Neuroscientist. 2001;7:42-54. 11. Waxman SG. The neuron as a dynamic electrogenic machine: modulation of sodium channel expression as a basis for functional plasticity in neurons. Philos Trans R Soc Lond B Biol Sci. 2000;355: 199-213. 12. Nassar MA, Levato A, Stirling LC. Neuropathic pain develops normally in mice lacking both Nav1.7 and Nav1.8. Mol Pain. 2005;22: 1-24. 13. Akopian AN, Souslova V, England S. The tetrodotoxin-resistant sodium channel SNS has a specialized function in pain pathways. Nat Neurosci. 1999;2:541-548. 14. Drenth JP, te Morsche RH, Guillet G. SCN9A mutations define primary erythermalgia as a neuropathic disorder of voltage gated sodium channels. J Invest Dermatol. 2005;124:1333-1338. 15. Fertleman CR, Baker MD, Parker KA. SCN9A mutations in paroxysmal extreme pain disorder: allelic variants underlie distinct channel defects and phenotypes. Neuron. 2006;52:767-774. 16. Ahmad S, Dahllund L, Eriksson AB, et al. A stop codon mutation in SCN9A causes lack of pain sensation. Hum. Mol. Genet. 2007;16: 2114-2121. 17. Goldberg YP, MacFarlane J, MacDonald ML, et al. Loss-of-function mutations in the Nav1.7 gene underlie congenital indifference to pain in multiple human populations. Clin Genet. 2007;71:311-319. 18. Nilsen KB, Nicholas AK, Woods CG, Mellgren SI, Nebuchennykh M, Aasly J. Two novel SCN9A mutations causing insensitivity to pain. Pain. 2009;143:155-158. 19. Cox JJ, Sheynin J, Shorer Z, et al. Congenital insensitivity to pain: novel SCN9A missense and in-frame deletion mutations. Hum Mutat. 2010;31:1670-1686. 20. Kurban M, Wajid M, Shimomura Y, Christiano AM. A nonsense mutation in the SCN9A gene in congenital insensitivity to pain. Dermatology. 2010;221:179-183. 21. Staud R, Price DD, Janicke D, et al. Two novel mutations of SCN9A (Nav1.7) are associated with partial congenital insensitivity to pain. Eur J Pain. 2011;15(3):223-230. 22. Klein CJ, Wu Y, Kilfoyle DH, et al. Infrequent SCN9A mutations in congenital insensitivity to pain and erythromelalgia. J Neurol Neurosurg Psychiatry. 2013;84:386-391.
Contents lists available at ScienceDirect
Pediatric Neurology journal homepage: www.elsevier.com/locate/pnu
Clinical Observations
A Novel Nonsense Mutation in SCN9A in a Moroccan Child With Congenital Insensitivity to Pain Maria Mansouri MD a, *, Siham Chafai Elalaoui MD a, Bouchra Ouled Amar Bencheikh PhD b, c, Mohamed El Alloussi MD d, Patrick A. Dion PhD b, c, Abdelaziz Sefiani MD, PhD a, e, Guy A. Rouleau MD, PhD b, f a
Département de Génétique Médicale, Institut National d’Hygiène, Rabat, Morocco Neurology and Neurosurgery Department, McGill University, Montréal, Quebec, Canada c Pathology and Cell Biology, Université de Montréal, Montréal, Quebec, Canada d Service d’odontologie pédiatrique, Faculté de médecine dentaire, Université Mohammed V Souissi, Rabat, Morocco e Centre de génomique humaine, Faculté de Médecine et de Pharmacie de Rabat, Université Mohammed V Souissi, Rabat, Morocco f Montreal Neurological Institute and Hospital, McGill University, Montréal, Quebec, Canada b
abstract BACKGROUND: Congenital insensitivity to pain is a rare autosomal recessive disease. Individuals who are diagnosed
with congenital insensitivity to pain usually present severely impaired pain perception, and in some cases, they also manifest a decreased sense of smell (anosmia). This disease is caused by loss of function mutations affecting the SCN9A gene, which encodes the voltage-gated sodium channel Nav1.7. It is noteworthy that nearly every mutation linking this particular channel to congenital insensitivity to pain has been demonstrated to underlie the translation of a truncated protein. METHODS: Complete sequencing of the SCN9A gene in a Moroccan 3-year-old child with congenital insensitivity to pain. RESULT: We identified a homozygous nonsense mutation (c.4795C>T) in exon 27, that results in codon stop in the amino acid (p.R1599X). CONCLUSION: In this report we present a previously unreported homozygous nonsense mutation present in a consanguineous Moroccan congenital insensitivity to pain patient with anosmia. The identification of this mutation extends the spectrum of mutations affecting the Nav1.7 channel, and it confirms earlier studies that established Nav1.7 roles in nociception and the sense of smell. Keywords: congenital insensitivity to pain, SCN9A, novel mutation, anosmia
Pediatr Neurol 2014; 51: 741-744 Ó 2014 Elsevier Inc. All rights reserved. Introduction
Pain is a highly pervasive sensory modality in species which confers protection against dangerous and noxious stimuli. Both loss of pain sensation or hypersensitivity to pain can compromise survival. Congenital insensitivity to pain (CIP) is an autosomal recessive disease caused by inactivating mutations of the Nav1.7 channel. To date, almost every SCN9A mutations reported to cause this disease have been demonstrated to lead to a premature truncation of the Nav1.7 protein and presumably to its rapid degradation.1 Article History: Received March 26, 2014; Accepted in final form June 14, 2014 * Communications should be addressed to: Dr. Mansouri; Département de Génétique Médicale; Institut National d’Hygiène; 27 Avenue Ibn Batouta, B.P. 769, 11400 Rabat, Morocco. E-mail address: [email protected] 0887-8994/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pediatrneurol.2014.06.009
Mutations in SCN9A have been associated with three different human pain disorders: biallelic loss of function mutations result in congenital insensitivity to pain (CIP, OMIM: 243000), whereas gain of function mutations cause primary erythermalgia (OMIM: 133020) and episodic pain in paroxysmal extreme pain disorder (OMIM: 167400). SCN9A (sodium channel protein type 9 subunit alpha) encodes the voltage-gated sodium channel Nav1.7, a protein highly expressed in nociceptive neurons. Recently, Weiss et al.2 reported a study proving that Nav1.7 is an essential component of the normal olfactory pathway. We describe a 3-year-old girl with CIP and a congenital general anosmia. She was born to consanguineous Moroccan parents with a novel homozygous nonsense mutation in SCN9A. This is a novel mutation that has never been reported in the literature.
742
M. Mansouri et al. / Pediatric Neurology 51 (2014) 741e744
Material and Methods Patient description The patient was a 3-year-old girl, the third child of healthy consanguineous Moroccan parents, born to a 30-year-old mother and 34-yearold father. Her siblings are all unaffected. Pregnancy course was normal, without complications or any history of drug abuse, and delivery was also normal. There is no known history of other neurological disorders within the family. She had normal psychomotor development. The child was seen in consultation at age 2 years for insensitivity to pain. Her parents reported that the child reacts abnormally to the pain; she had failed to indicate any discomfort with earlier childhood vaccinations or blood samples. The family also reported that the child would bite her fingers during teething, and she did not hurt during falls when learning to walk. The child has no history of bone fracture or oral and corneal lesions, and she has never been operated upon.
Examination at age 2 years revealed scars from bites on her fingers, ulceration of her tongue, and scarring from injury on her. She was able to feel pin prick and fine touch but had a complete insensitivity to painful stimuli caused by squeezing finger tips. The deep tendon reflexes were normal. Indifference to balsamic vinegar odor test revealed a smell deficit. The University of Pennsylvania Smell Identification Test could not be performed because of her young age. Otherwise, autonomic function has been normal; she had a normal histamine flare response, sweated normally with no pressure trouble, or digestive abnormalities. Nerve conduction studies revealed normal motor conduction. The electromyogram and brain scan were normal.
Methods Informed consent was obtained from the proband’s parents before implementation of the clinical and genetic studies. Peripheral blood was collected from the affected child and their parents. Genomic DNA was
TABLE 1. Primer Sequences and Amplification Conditions
Exon
Forward Primers
Reverse Primers
Conditions and Program
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27_a 27_b 27_c
TTCTTGGCAGGCAAATAGTTAAG AGATGCGTTGATGACATTGG CCTCAAATATTTCAAATTCCCAC AAAGATTTACATGGTGGTTGTATTC CCCCAAACGTAGAAAATACCTTG TTTGATATAATGCATGACTTTCTAGG TTTACCTCCTTTATCACAATCACAG AAGGCTATTTAGCTTGTGTCCTG CAGATTTGCTCATGCCTGTC TGTCCTGTCCTAGGGTTTCC AGGCCAGTGGGTTCAGTG aacccagcaatctaggctctac GGAGTGAAACAGACAAATGGC ggaacacagtaaatgctaagcaac TCAAGATTGGAAACATTGAAAAG GAGGAGTCTACCCTCGCCTC TTTTGGCCACGTACTTGTTAG TTTGGTTGAGGGAGTATCACAG CTGGCCCATGTCAATATTATG tgcttcatcattttattgacacaa GTCTGCATGGCATTTCTTTC GGACTAAGATTTAGAATGTTACTTGGG TGTTTGAATTACCTGGTCAAACC AGAAAGATGTAGACAATGATTCTGG ACAAAAGCCAATTCCTCGAC gagtcatcatttcaggtagcataca TCAGTTGAAGGAGACTGTGGTAAC TTAGTGGTGACCGGATCCAT
TTTTATACAGAAGGAAGCCAACAG AATATTGCCACTCTCCCAGTC GGCAGGAAAAGGAAAGGATG CTGTGCTGCCTGAGATTTTC TGATTGTGGAAAACAGAAGAAATC CCAAATTCACACTGTAGCAGC CAAACTGACTGAACATTCTTTTCC AAAACCTCCTAATACAGGCTCTTAAC TCTAGCTGGAGAAGGCCAAG TCTCTAGCATTCTGCCTCGG TGACTGATGCAGGAACAAGG TCTTCCTAAGAATTTCATGTGCC AAAATATGAAATGACAATGATGACAAC TGCAAAACCAAAGAAATACCC CACATCATCACAAAATAATTTCCAC TGGGAAGGCTCAAAGATACC tgaatcagcatggaatggag TTAATTCTAGGTAAAACAACTTGCC TTTCTAAAAGAATAAACCTATAGCCTG caactcataatttctacatacccattg ggccAAGACTGGCACTG TCTATGTGAGTCCCAAGGGC GGAAAATAATTGTTCATCCCTTTC CCTTGGATTTTGTTCTGCAAAG GAATTCAGCATATACTTCCTTGAGC TGGCAACACTAAAATTCTCCA AATCCATCTCCCCACTCTCA ACTGCACTGCCTTCGAGAAT
MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19 (expansion 1 min) MM7/GC19 MM7/GC19 MM7/GC19 MM7/TD 55/48 then 50 MM7/GC19 MM7/GC19 MM7/GC19 MM7/TD 55/48 then 50 MM7/GC19 MM7/GC19 MM7/GC19 MM7/GC19
MM7 Component
Stock Concentration
Final Concentration
For 15 ml Reaction
DNA H2O MgCl2 Buffer dNTP AmpliTaqGold Oligo F Oligo R
1.0 ng/mL 25 mM 10X 2,5 mM 5 U/mL 10 mM 10 mM
5 ng 1.5 mM 1X 167 mM 0.6 U 0.38 mM 0.38 mM
5.00 5.34 0.90 1.50 1.00 0.12 0.57 0.57
PCR Program: GC19 95 C 94 C 65 C 72 C 94 C 58 C 72 C 72 C
5 min 20 seconds 20 seconds 30 seconds 20 seconds 20 seconds 30 seconds 5 min
8 cycles (1.0 C/cycle)
34 cycles
42 cycles
M. Mansouri et al. / Pediatric Neurology 51 (2014) 741e744
743
FIGURE. Electropherogram depicting the homozygous mutation (A) and the heterozygous mutation (B, C) in the patient. (Color version of this figure is available in the online edition.) extracted from blood using QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA). Primers were designed using the ExonPrimer software from The University of California Santa Cruz (UCSC) Genome Browser website (www.genome.ucsc.edu). Twenty-eight sets of primers were sufficient to cover the 27 exons in SCN9A (NM_002977.2). Primer sequences and amplification conditions are listed in Table 1. PCR products were sequenced on an Applied Biosystems 3730 Sequencer.
Results We identified a single homozygous base substitution in coding exon 27, c.4795C>T that results in codon stop in the amino acid, p.R1599X. This mutation was present in heterozygote state in both of the girl’s parents (Fig).
Discussion
Perceiving, transmitting, and interpreting pain stimulus is an essential sense that is present in all complex
organisms. Because pain is the first line of defense to minimize the occurrence of cellular and tissue damages that would occur in the event they had no such sensation, pain perception likely increases the likelihood of survival. Furthermore, pain protects against aggression of environment, by teaching us what behaviors lead to injury. CIP (OMIM 243000) is an autosomal recessive disorder characterized by congenital indifference to pain.1,3 The first individual with CIP was reported in the early twentieth century.4 This disease is rare: only about 30 patients have been reported to date. Patients exhibit total insensitivity to pain with painless injuries beginning in infancy. Otherwise they have normal sensory responses on examination. Also they have a normal perception of joint position, passive movement, and vibration, as are tactile thresholds and light touch perception. There is intact ability to detect differences in temperature
TABLE 2. Mutations Reported in All Patients With Congenital Insensitivity to Pain
Mutation
Protein Nomenclature
Position
NP
Origin
Anosmia
Reference
c.2691G>A c. 2298delT c.1376C>G c.829C>T c.2488C>T c.3600delT c.4462C>T c.5067G>A c.2076dupT c.4366-10_4366-7 delGTTT c.3703_3713del11 c.4975A>T c.984C>A c.774_775delGT c.2488C>T c.2687G>A c.4108_4122del15 c.4477delA c.1567C>T c.5155T>C c.3439þ4delA c.966-2A>G c.4795C>T
W897X I767X S459X R277X R830X Phe1200LeufsX33 R1488X W1689X Glu693X
Exon 15 Exon 13 Exon 10 Exon 6 Exon 15 Exon 19 Exon 24 Exon 26 Exon 19 Intron 24 Exon 19 Exon 26 Exon 8 Exon 15
1 1 1 2 1 1 1 1 1
Northern Pakistan
Unknown
1
Switzerland France Italy United States Argentina United state
Yes Yes Yes Unknown Yes Yes
17
1
England
Yes
2 1
Canada Central Europe
Unknown Yes
16,17
Exon 15 Exon 21
1 1
England Israeli Bedouin
Partial Partial
19
Exon 10 Exon 26 Intron 17 Intron 8 Exon 27
1 1
Northern Pakistan Northern Europe
Unknown Yes
20
1
Moroccan
Unknown Yes
Abbreviations: NP ¼ Number of patients SJM ¼ Splice-junction mutation
Ile1235leufsX2 K1659X Y328X R830X R896Q DR1370_L1374 I1493SfsX8 R523X C1719R SJM R1599X
17,18
21
22
Our study
744
M. Mansouri et al. / Pediatric Neurology 51 (2014) 741e744
and to distinguish between dull and sharp stimuli. This inability to feel pain leads to various complications, such as injuries to lip or tongue caused by biting themselves in the first 4 years of life. Frequent bruises, cuts, and unnoticed fractures are reported.5-9 CIP is caused by loss of function of SCN9A (OMIM 603415) which encodes for the voltage-gated sodium channel 9, composed of 1,977amino acids. The protein is one of nine voltage-gated sodium channels (SCN) (1-9A) that constitute four similar domains with each domain comprising six ahelical transmembrane segments. Transmembrane segments 5 and 6 are the pore-lining segments, and the voltage sensor is located in transmembrane segment 4 of each domain. This channel is involved in the conversion of mechanical or chemical stimuli into electrical signals within excited cells, attached to different neurological disease.10,11 SCN9A is a tetrodotoxin-sensitive sodium channel that is expressed in the peripheral nervous system and predominantly in the dorsal root ganglia. It is implicated in pain perception including mechanical and inflammatory pain but not neuropathic pain.12,13 SCN9A is associated with indifference to pain in patients of inactivating recessive mutations and the opposite phenotype, hyperalgesia in patients of activating mutations.1,14,15 Functional studies revealed that SCN9A mutations cause loss of function of the gene.1,16 First mutations were first described in 2006, by Cox et al. in three Pakistani families, with identification of three different nonsense mutations in homozygous state.1 Goldberg et al. and Ahmad et al. confirmed these results in European, American, and a large Canadian family by finding 10 truncating SCN9A mutations.16,17 Until now, 19 families have been reported with CIP confirmed by molecular biology. These families are from different origins with eight European families, four American families, four Pakistani families, one Israeli Bedouin family, and one family of unknown origin. Different mutations have been described across these families: nine nonsense mutations, two missense mutations, eight small deletions, one insertion, and one splicing mutation. All mutations reported are truncating, and about 43% of them are nonsense (Table 2). Weiss et al.2 hypothesized that SCN9A is not only involved in pain sensation, but also an essential requirement for odor perception. Loss of this function prevents the initiation of synaptic signalization from the axon terminals at the first synapse in the olfactory system of mice. This hypothesis could explain the presence of a complete anosmia in most of the patients with CIP; 11 of 19 patients with loss of function of SCN9A have complete or partial anosmia (Table 1). We identified a novel nonsense mutation in a Moroccan patient, with typical CIP presenting complete anosmia. The mutation changes the arginine amino acid at the position 1,599 to stop codon R1599X, which is located in exon 27. This amino acid that is highly conserved is in the third transmembrane unit of the fourth domain of the sodium channel SCN9A protein. This SCN9A mutation has not been previously reported. This site is critical for the normal
function of the channel, supporting the critical role of the SCN9A channel in the perception of pain and odor perception (the olfaction system). In conclusion, we have extended the spectrum of mutations in SCN9A channels in CIP, providing a framework for unraveling the complex mechanisms of pain perception.
References 1. Cox JJ, Reimann F, Adeline KN, et al. An SCN9A channelopathy causes congenital inability to experience pain. Nature. 2006;444:894-898. 2. Weiss J, Pyrski M, Jacobi E, et al. Loss-of-function mutations in sodium channel Nav1.7 cause anosmia. Nature. 2011;472:186-190. 3. Silverman FN, Gilden J. Congenital insensitivity to pain: a neurologic syndrome with bizarre skeletal lesions. Radiology. 1959;72:176-190. 4. Dearborn GJ. A case of congenital general pure analgesia. Nerv Ment Dis. 1932;75:612-615. 5. Nagasako EM, Oaklander AL, Dworkin RH. Congenital insensitivity to pain: an update. Pain. 2003;101:213-219. 6. Axelrod FB, Hilz MJ. Inherited autonomic neuropathies. Semin Neurol. 2003;23:381-390. 7. Hirsch E, Moye D, Dimon III JH. Congenital indifference to pain: long-term follow-up of two cases. South Med J. 1995;88:851-857. 8. Sibley BG, Broussard CD, Vincent DS. A report of congenital indifference to pain as diagnosed in infancy. J La State Med Soc. 1999;151: 310-312. 9. Dimon III JH, Funk Jr FJ, Wells RE. Congenital indifference to pain with associated orthopedic abnormalities. South Med J. 1965;58: 524-529. 10. Isom LL. Sodium channel beta subunits: anything but auxiliary. Neuroscientist. 2001;7:42-54. 11. Waxman SG. The neuron as a dynamic electrogenic machine: modulation of sodium channel expression as a basis for functional plasticity in neurons. Philos Trans R Soc Lond B Biol Sci. 2000;355: 199-213. 12. Nassar MA, Levato A, Stirling LC. Neuropathic pain develops normally in mice lacking both Nav1.7 and Nav1.8. Mol Pain. 2005;22: 1-24. 13. Akopian AN, Souslova V, England S. The tetrodotoxin-resistant sodium channel SNS has a specialized function in pain pathways. Nat Neurosci. 1999;2:541-548. 14. Drenth JP, te Morsche RH, Guillet G. SCN9A mutations define primary erythermalgia as a neuropathic disorder of voltage gated sodium channels. J Invest Dermatol. 2005;124:1333-1338. 15. Fertleman CR, Baker MD, Parker KA. SCN9A mutations in paroxysmal extreme pain disorder: allelic variants underlie distinct channel defects and phenotypes. Neuron. 2006;52:767-774. 16. Ahmad S, Dahllund L, Eriksson AB, et al. A stop codon mutation in SCN9A causes lack of pain sensation. Hum. Mol. Genet. 2007;16: 2114-2121. 17. Goldberg YP, MacFarlane J, MacDonald ML, et al. Loss-of-function mutations in the Nav1.7 gene underlie congenital indifference to pain in multiple human populations. Clin Genet. 2007;71:311-319. 18. Nilsen KB, Nicholas AK, Woods CG, Mellgren SI, Nebuchennykh M, Aasly J. Two novel SCN9A mutations causing insensitivity to pain. Pain. 2009;143:155-158. 19. Cox JJ, Sheynin J, Shorer Z, et al. Congenital insensitivity to pain: novel SCN9A missense and in-frame deletion mutations. Hum Mutat. 2010;31:1670-1686. 20. Kurban M, Wajid M, Shimomura Y, Christiano AM. A nonsense mutation in the SCN9A gene in congenital insensitivity to pain. Dermatology. 2010;221:179-183. 21. Staud R, Price DD, Janicke D, et al. Two novel mutations of SCN9A (Nav1.7) are associated with partial congenital insensitivity to pain. Eur J Pain. 2011;15(3):223-230. 22. Klein CJ, Wu Y, Kilfoyle DH, et al. Infrequent SCN9A mutations in congenital insensitivity to pain and erythromelalgia. J Neurol Neurosurg Psychiatry. 2013;84:386-391.
