Protein Expression and Purification 99 (2014) 64–69
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
A novel self-cleavage system for production of soluble recombinant protein in Escherichia coli Yufei Feng a,b, Qingyuan Xu b, Tao Yang b, Encheng Sun b, Junping Li b, Dongfang Shi a, Donglai Wu a,b,⇑ a Department of Basic Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Xiangfang District, Harbin 150030, Heilongjiang Province, PR China b The Key Laboratory of Veterinary Public Health, Ministry of Agriculture, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Maduan Street, Nangang District, Harbin 150001, Heilongjiang Province, PR China
a r t i c l e
i n f o
Article history: Received 21 January 2014 and in revised form 17 March 2014 Available online 13 April 2014 Keywords: Self-cleavage Protein expression Human rhinovirus 3C protease (HRV3C) Escherichia coli (E. coli)
a b s t r a c t Many approaches for generating large quantities of recombinant protein in Escherichia coli fuse the protein of interest to a protein tag to enhance solubility and improve recovery. However, the fusion tags can confound downstream applications, as the fusion partner can alter the structure and biological activity of the recombinant protein and proteolytic removal of the fusion tags can be expensive. Here we describe a new system for production of native proteins in E. coli that allows for removal of the fusion tag via intracellular self-cleavage by the human rhinovirus 3C (HRV3C) protease. This system allows for parallel cloning of target protein coding sequences into six different expression vectors, each with a different fusion partner tag to enhance solubility during induction. Temperature-regulated expression of the HRV3C protease allows for intracellular removal of the fusion tag following induction, and the liberated recombinant protein can be purified by affinity chromatography by virtue of a short six-histidine tag. This system will be an attractive approach for the expression and purification of recombinant proteins free of solubilityenhancing fusion tags, and should be amenable to high-throughput applications. Ó 2014 Elsevier Inc. All rights reserved.
Introduction Escherichia coli (E. coli)1 is frequently used as a host for heterologous gene expression, as relatively simple and inexpensive approaches are available to produce large quantities of recombinant proteins [1]. Several methods have been developed to co-express the target proteins with solubility-enhancing tags, such as glutathione Stransferase (GST), maltose-binding protein (MBP), thioredoxin (Trx), N-Utilization substance (Nus), trigger factor (TF) and Disulfide bond formation protein A (DsbA) [2,3]. There are numerous commercial and non-commercial E. coli expression vectors available that rely upon fusion tags, protease cleavage sequences, and regulated expression levels to produce soluble recombinant protein. However, the use of fusion tags may interfere with protein structure and biological activity, which can ultimately affect the results of down⇑ Corresponding author. E-mail address: [email protected] (D. Wu). Abbreviations used: E. coli, Escherichia coli; GST, S-transferase; MBP, maltosebinding protein; Trx, thioredoxin; Nus, N-Utilization substance; TF, trigger factor; DsbA, Disulfide bond formation protein A; EK, enterokinase; pHsh, Hsh promoter; tHsh, Hsh terminator; MCS, multiple cloning site; EGFP, Enhanced Green Fluorescent Protein; LB, Luria–Bertani; PBS, phosphate buffered saline; DAB, 3,30 -diaminobenzidine tetrahydrochloride; BTV, Bluetongue virus; GFP, green fluorescent protein. 1
http://dx.doi.org/10.1016/j.pep.2014.04.001 1046-5928/Ó 2014 Elsevier Inc. All rights reserved.
stream functional studies or applications using the recombinant protein [4]. Therefore, it is often necessary to remove these tags. Protocols to remove tags commonly involve enzymatic cleavage of the recombinant protein with a site-specific protease. Proteases such as factor Xa, thrombin, enterokinase (EK), tobacco etch virus (TEV) protease and human HRV3C protease can be used to remove fusion tags from target proteins [2]. In previous studies, factor Xa, thrombin and EK did not exhibit stringent sequence specificity and cleavage occurred at unintended sites [5,6]. Similarly, TEV protease produced in E. coli has been problematic due to low solubility [2]. The HRV3C protease, which cleaves between the Gln and Gly residues of the sequence Leu-Glu-Val-Leu-Phe-Gln/Gly-Pro, has been frequently used to remove fusion tags due to its strict cleavage specificity [7]. In the present study, the HRV3C protease was used to develop a novel self-cleavage system for production of recombinant protein in E. coli. This expression system offers a number of advantages. Firstly, this system consists of a set of six expression vectors that differ with respect to the specific solubility-enhancing fusion tag used, but all use the same multiple cloning site to enable parallel cloning from a single PCR product. Thus, it is easy to initially construct multiple vectors for recombinant protein expression and pursue the construct that allows for optimal (or best) soluble
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
recombinant protein production. Secondly, this system uses two independent expression cassettes on a single plasmid to separately regulate expression HRV3C protease and the target protein. Expression of the HRV3C protease is induced by a temperature change to 42 °C whereas recombinant protein expression is induced by addition of IPTG at 25 °C. Finally, the solubility-enhancing fusion tags can be readily separated from the recombinant protein of interest by the induced expression of the HRV3C protease, and the liberated native target can then be purified by affinity chromatography. This novel expression system offers a streamlined approach to identify optimal solubility-enhancing fusion partners and a simple cost-effective intracellular mechanism to remove the fusion tag prior to purification.
Materials and methods Materials The pET-39b, pGEX-6p-1, pET43.1a, pCold-TF, Ptac and PP plasmids were provided by Professor Dongfang Shi (Northeast Agricultural University). The pEASY-Blunt Cloning Kit was purchased from Bejing TransGen Biotech Co. (China). E. coli Top 10 cells were obtained from Beijing Tiangen Biotech Company (China). The pUC19, pET-32a, pMal-c4x, Y2079 and Y1140 plasmids were stored in our laboratory. The Quick T4 DNA Ligation Kit, Afl III, alkaline phosphatase, and calf intestinal phosphatase (CIP) were purchased from New England Biolabs. Restriction endonucleases (Smal I, Pvu II, Pvu I, Sac I, Kpn I, Nde I, Sal I, Aat II, Afl III, Nhe I and Not I), T4 DNA polymerase and PrimeSTAR HS DNA Polymerase were purchased from TaKaRa Biotechnology (Dalian) Co. (China). The AxyPrep DNA Gel Extraction Kit and AxyPrep Plasmid Mini prep Kit were purchased from AxyGen. Ni–NTA agarose was purchased from Invitrogen.
Construction of the pDL-A plasmid To enable control of HRV3C protease expression via changes to culture temperatures, the Hsh promoter (pHsh) and terminator (tHsh) sequences were appended to the 50 -ATG start codon and 30 -TGA stop codon of the GST-HRV3C protease nucleotide coding sequence. The pHsh-GST-HRV3C-tHsh sequence included 50 -Sma I and Pvu II and 30 -Sma I restriction enzyme sites to facilitate shuttling of segments into different vectors in subsequent steps. The ColE1 origin replication and ampicillin resistance genes were obtained from plasmid pUC19 by digestion with Aat II and Afl III restriction endonucleases. The digested product was blunted with T4 DNA polymerase, dephosphorylated with CIP, and then purified by agarose gel electrophoresis. The gel-purified sequence containing the ColE1 origin and ampicillin resistance gene was then ligated to the Sma I-Pvu II-PHsh-GST-HRV3C-THsh-Sma I construct and named plasmid pDL-A (Fig. 1).
Construction of the pDL-B plasmid The Ptac plasmid, containing the lacIq gene, tac promoter, and rrnB terminator, was digested with Kpn I and Sac I and blunted with a T4 DNA polymerase. The cut segment was purified by agarose gel electrophoresis and ligated into the Pvu II-digested and dephosphorylated pDL-A plasmid. The resultant plasmid was named pDL-B (Fig. 1). The pDL-B plasmid was verified by PCR using the primers JDP1 (50 -TTATCTGTTGTTTGTCGGTGAACGC-30 ) and JDP2 (50 -AAGGAAGATTGGGAAACTCCAAACC-30 ).
65
Construction of the pDL-C plasmid A multiple cloning site (MCS) containing cut sites for Sal I, Xho I, Sac I, Nhe I, Tth111 I, EcoT22I, PmaC I, Not I, Hind III, and Kpn I was produced by directly annealing primers P3 (50 -CATATGGAATTCCCACGCGTCGACCTCGAGGAGCTCGCTAGCGACAAAGTCATGCATCACG TGGCGG-30 ) and P4 (50 -CCCGGGTTAATGATGATGATGATGGTG GGT ACCAAGCTTTGCGGCCGCCACGTGATGCATGACTTTGTC-30 ). The above primers were designed to flank the MCS with a 50 -Nde I restriction site and a 30 -6His tag followed by a TAA stop codon and a Sma I restriction site. The Nde I and Sma I sites were included to facilitate construction of the pDL-C plasmid in subsequent steps. This gene was named M fragment (Fig. 1). The M fragment was purified by agarose gel electrophoresis, ligated into the pEASY-Blunt vector, transformed into Trans1-T1 competent cells and sequence verified. The M fragment was removed from the pEASY-Blunt vector by digestion with Nde I and Sma I and ligated into the pDL-B vector following digestion with Nde I and Sma I to produce plasmid pDL-C (Fig. 1). Construction of the expression platform The Trx, DsbA, GST, Nus, TF and MBP fusion tag genes were amplified from the pET32a, pET-39b, pGEX-6p-1, pET43.1a, pCold-TF and pMal-c4x vectors, respectively. Primers used to amplify each fusion tag included a 50 -Nde I restriction site and a 30 -HRV3C protease cleavage site sequence followed by a Sal I restriction site (Fig. 1). Each PCR product was purified by agarose gel electrophoresis, ligated separately into the pEASY-Blunt vector, transformed into Trans1-T1 competent cells and sequence verified. The Trx, DsbA, GST, Nus, TF and MBP fusion tag genes were digested by Nde I and Sal I and ligated independently into the pDL-C vector following Nde I and Sal I digestion. The resultant set of expression vectors each use a different fusion tag to enhance solubility of the recombinant protein of interest. These expression vectors were named pDL-Trx, pDL-DsbA, pDL-GST, pDL-Nus, pDLTF and pDL-MBP, respectively (Fig. 1). EGFP protein expression and Western blot analysis Enhanced Green Fluorescent Protein (EGFP) was selected as a target protein to characterize the set of expression vectors using different fusion tags. The EGFP gene was amplified from the Y1140 vector by PCR with the primers EGFP-F (50 -GCTAGCGTGAGCAAGGGCGAGGA-30 ) and EGFP-R (50 -GCGGCCGCTCTAGATCCGGT GGATCCC-30 ). These primers incorporated 50 Nhe I and 30 Not I restriction sites into the amplified products which were used to ligate the EGFP coding sequence into the pDL-Trx, pDL-DsbA, pDL-GST, pDL-Nus, pDL-TF and pDL-MBP expression plasmids, placing the EGFP sequence in frame with the fusion partner. Each expression construct was transformed into Top10 competent cells. Individual clones were inoculated into 50 mL Luria–Bertani (LB) broth supplemented with 100 lg ampicillin per mL in a 250-milliliter Erlenmeyer flask. Cultures were grown at 30 °C until log phase growth as indicated by the culture achieving an optical density at 600 nm (OD600) of 0.5. Production of the HRV3C protease was then induced by incubating the culture at 42 °C for 1 h. Production of the recombinant target protein (‘‘Tag’’-EGFP) was then induced with 0.35 mM IPTG at 25 °C for an additional 5 h. E. coli were harvested by centrifugation for 20 min at 8000 rpm and 4 °C, and washed three times with phosphate buffered saline (PBS). The cells were resuspended in 5 mL Native Binding Buffer (50 mM NaH2PO4, 0.5 mM NaCl, pH 8.0), sonicated for 30 min, and centrifuged at 9000 rpm at 4 °C for 25 min. The suspension was passed through
66
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
Fig. 1. Overview of expression plasmid construction to generate a novel self-cleavage system for production of soluble recombinant protein in Escherichia coli.
a 0.22 lm filter, purified using NI–NTA agarose according to manufacturer’s instructions and separated by SDS–PAGE. Briefly, the purified EGFP was subjected to electrophoresis on 12% SDS–PAGE and transferred onto a nitrocellulose membrane. Non-specific binding was blocked by incubating the membrane with 5% skim milk overnight at 4 °C. The membrane was incubated with a murine anti-His antibody followed by a peroxidaseconjugated goat anti-mouse IgG (H + L) antibody (ZSGB-BIO). Color was developed using 3,30 -diaminobenzidine tetrahydrochloride (DAB) and the reaction was stopped by rinsing the membrane with distilled water and drying the membrane [8].
Bluetongue viruses protein expression Bluetongue virus (BTV) protein was selected as a target protein to clone into the pDL-Trx, pDL-DsbA, pDL-GST, pDL-Nus, pDL-TF, pDL-MBP and pET-30a vectors. The BTV gene was amplified from the Y2079 vector by PCR with the primers BT-PF: (50 -CTCGAGTCAGCGGCGATCGATGGATTAGTA-30 ) and BT-PR: (50 -AAGCTTATGCG TTAAATCGATCCCGCTT-30 ). These primers incorporated 50 Xho I and 30 Hind III restriction sites which were used to clone sequence into the set of pDL expression plasmids. The primers BT-30F: (50 -CAT ATGTCAGCGGCGATCGATGGATTAGTA-30 ) and BT-PR incorporated
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
50 Nde I and 30 Hind III restriction sites were used to amplify the BTV gene. The amplified product was cloned into pET-30a and transformed into BL21 (DE3) competent cells. The procedure of protein expression was performed as described above. Results Production of the EGFP protein Six expression plasmids were constructed to produce EGFP in the soluble fraction of E .coli. The soluble fraction was harvested after IPTG induction and bacterial cell processing for analysis by SDS–PAGE. For each of the six expression constructs, a prominent protein band corresponding to the predicted size of recombinant EGFP was clearly visible (Fig. 2A). In some cases, the cleaved tag used to enhance EGFP solubility was also identifiable (for example, note the presence of a band corresponding to the GST fusion tag in lane 2 of Fig. 2A). And according to the gel in Fig. 2A, we tried to analysis the amount of the target protein (EGFP) with the 6 tags using the Image J software. The analysis of gray scale results showed that: Trx-EGFP (41577) > MBP-EGFP (32365) > Nus-EGFP (28584) > GST-EGFP (27641) > TF-EGFP (23005) > DsbA-EGFP (15757). Further, the soluble material harvested from E. coli
67
following induction displayed a green appearance suggesting significant production of soluble EGFP (Fig. 2B). The EGFP protein was further purified from E. coli transformed with pDL-Trx-EGFPTop10 using Ni–NTA affinity chromatography. EGFP was greatly enriched following purification on a nickel column as indicated by a protein stain of material separated by SDS–PAGE (Fig. 2C) and was recognized as expected by an anti-His antibody by Western Blot (Fig. 2D). The purified recombinant EGFP migrated with the expected molecular weight, indicating efficient removal of the solubility-enhancing Trx tag (Fig. 2C and D). HRV3C protease was induced by incubating the culture at 42 °C for 1 h and the bacterial cells were harvested for analysis by SDS– PAGE (Fig. 2E). Besides, there were no significant differences of the pDL-MBP-EGFP-Top10 incubated at 42 °C for 0 h, 1 h, 2 h, 3 h and 4 h on SDS–PAGE (Fig. 2F). The expression of HRV3C was leaky which made the fusion tag protein cleave and liberate the EGFP protein. Production of the BTV protein BTV protein was expressed using pET30a and the set of pDL expression vectors. The result showed that the protein formed the inclusion bodies with a negligible solubility when directly expressed in pET30a without a fusion tag. However, the solubility
Fig. 2. Production and characterization of EGFP produced using a novel self-cleavage system for production of soluble recombinant protein in Escherichia coli. (A) SDS–PAGE analysis of soluble material recovered from E. coli following induction of recombinant EGFP production and HRV3C-mediated removal of the fusion tag. Lane M: Protein marker. Lanes 1–6: Soluble material recovered from transformed E. coli following IPTG and HRV3C protease induction. Lane 1: pDL-DsbA-EGFP-Top10. Lane 2: pDL-GST-EGFPTop10. Lane 3: pDL-Trx-EGFP-Top10. Lane 4: pDL-MBP-EGFP-Top10. Lane 5: pDL-Nus-EGFP-Top10. Lane 6: pDL-TF-EGFP-Top10. (B) Soluble supernatants of pDL-DsbA-EGFPTop10, pDL-GST-EGFP-Top10, pDL-Trx-EGFP-Top10, pDL-MBP-EGFP-Top10, pDL-Nus-EGFP-Top10, pDL-TF-EGFP-Top10 after IPTG induction. (C) EGFP purified by Ni-affinity chromatography following IPTG induction and HRV3C-mediated removal of the Trx fusion tag was analyzed by PAGE. Lane M: Protein marker. Lane 1: Purified EGFP. (D) EGFP purified by Ni-affinity chromatography following IPTG induction and HRV3C-mediated removal of the Trx fusion tag was analyzed by Western blot. Lane M: Protein marker. Lane 1: Purified EGFP. (E) SDS–PAGE analysis of HRV3C protease. Lane M: Protein marker. Lane 1: HRV3C without induction. Lane 2: GST-HRV3C. (F) Lane M: Protein marker. Lane 1: pDL-MBP-EGFP-Top10 without induction. Lane 2–6: pDL-MBP-EGFP-Top10 was inducted with IPTG and incubating at 42 °C for 0 h, 1 h, 2 h, 3 h and 4 h. Lane 7–8: Supernatants and pellet of pDL-MBP-EGFP-Top10 without induction. Lane 9–10:Supernatants and pellet of pDL-MBP-EGFP-Top10 incubating at 42 °C for 1 h. Lane 11–12: Supernatants and pellet of pDL-MBP-EGFP-Top10 incubating with IPTG after incubating at 42 °C for 1 h.
68
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
Fig. 3. Results of SDS–PAGE of BTV protein. Red arrow is target protein; black arrow is fusion tag. Lane M: Protein marker. Lane 1–2: Pellet and supernatants of pDL-DsbA-BT incubating with IPTG. Lane 3–4: Pellet and supernatants of pDL-GST-BT incubating with IPTG. Lane 5–6: Pellet and supernatants of pDL-TF-BT incubating with IPTG. Lane 7–8: Pellet and supernatants of pDL-Trx-BT incubating with IPTG. Lane 9–10: Pellet and supernatants of pDL-MBP-BT incubating with IPTG. Lane 11–12: Pellet and supernatants of pDL-Nus-BT incubating with IPTG. Lane 13–14: Pellet and supernatants of pET30a-BT incubating with IPTG. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
of the protein was significantly enhanced when the fusion tags were used (Fig. 3). Discussion The efficient production and recovery of recombinant proteins is an important technological platform for many academic, industrial and pharmaceutical laboratories. In many cases, large quantities of purified, natively folded, and biologically active recombinant protein products are needed, as is the case for crystallographic studies and the production of protein-based therapeutic agents [9]. This is often difficult to achieve due to the limitations associated with the expression of heterologous gene products in E. coli and other expression systems. Several expression systems are available to produce recombinant proteins, including both prokaryotic and eukaryotic expression systems in E. coli, yeast, and insect and mammalian cells. E. coli is an attractive system in which to produce recombinant proteins, as bacterial cells can be grown in large quantities using straight forward culture techniques and are associated with relatively low manufacturing costs [3]. Despite these advantages, however, E. coli expression systems have critical limitations that hamper synthesis of some recombinant proteins. Some recombinant proteins are toxic to E. coli and transmembrane and hydrophobic proteins can often accumulate as insoluble aggregates in inclusion bodies. Furthermore, low molecular weight polypeptides
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
A novel self-cleavage system for production of soluble recombinant protein in Escherichia coli Yufei Feng a,b, Qingyuan Xu b, Tao Yang b, Encheng Sun b, Junping Li b, Dongfang Shi a, Donglai Wu a,b,⇑ a Department of Basic Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Xiangfang District, Harbin 150030, Heilongjiang Province, PR China b The Key Laboratory of Veterinary Public Health, Ministry of Agriculture, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Maduan Street, Nangang District, Harbin 150001, Heilongjiang Province, PR China
a r t i c l e
i n f o
Article history: Received 21 January 2014 and in revised form 17 March 2014 Available online 13 April 2014 Keywords: Self-cleavage Protein expression Human rhinovirus 3C protease (HRV3C) Escherichia coli (E. coli)
a b s t r a c t Many approaches for generating large quantities of recombinant protein in Escherichia coli fuse the protein of interest to a protein tag to enhance solubility and improve recovery. However, the fusion tags can confound downstream applications, as the fusion partner can alter the structure and biological activity of the recombinant protein and proteolytic removal of the fusion tags can be expensive. Here we describe a new system for production of native proteins in E. coli that allows for removal of the fusion tag via intracellular self-cleavage by the human rhinovirus 3C (HRV3C) protease. This system allows for parallel cloning of target protein coding sequences into six different expression vectors, each with a different fusion partner tag to enhance solubility during induction. Temperature-regulated expression of the HRV3C protease allows for intracellular removal of the fusion tag following induction, and the liberated recombinant protein can be purified by affinity chromatography by virtue of a short six-histidine tag. This system will be an attractive approach for the expression and purification of recombinant proteins free of solubilityenhancing fusion tags, and should be amenable to high-throughput applications. Ó 2014 Elsevier Inc. All rights reserved.
Introduction Escherichia coli (E. coli)1 is frequently used as a host for heterologous gene expression, as relatively simple and inexpensive approaches are available to produce large quantities of recombinant proteins [1]. Several methods have been developed to co-express the target proteins with solubility-enhancing tags, such as glutathione Stransferase (GST), maltose-binding protein (MBP), thioredoxin (Trx), N-Utilization substance (Nus), trigger factor (TF) and Disulfide bond formation protein A (DsbA) [2,3]. There are numerous commercial and non-commercial E. coli expression vectors available that rely upon fusion tags, protease cleavage sequences, and regulated expression levels to produce soluble recombinant protein. However, the use of fusion tags may interfere with protein structure and biological activity, which can ultimately affect the results of down⇑ Corresponding author. E-mail address: [email protected] (D. Wu). Abbreviations used: E. coli, Escherichia coli; GST, S-transferase; MBP, maltosebinding protein; Trx, thioredoxin; Nus, N-Utilization substance; TF, trigger factor; DsbA, Disulfide bond formation protein A; EK, enterokinase; pHsh, Hsh promoter; tHsh, Hsh terminator; MCS, multiple cloning site; EGFP, Enhanced Green Fluorescent Protein; LB, Luria–Bertani; PBS, phosphate buffered saline; DAB, 3,30 -diaminobenzidine tetrahydrochloride; BTV, Bluetongue virus; GFP, green fluorescent protein. 1
http://dx.doi.org/10.1016/j.pep.2014.04.001 1046-5928/Ó 2014 Elsevier Inc. All rights reserved.
stream functional studies or applications using the recombinant protein [4]. Therefore, it is often necessary to remove these tags. Protocols to remove tags commonly involve enzymatic cleavage of the recombinant protein with a site-specific protease. Proteases such as factor Xa, thrombin, enterokinase (EK), tobacco etch virus (TEV) protease and human HRV3C protease can be used to remove fusion tags from target proteins [2]. In previous studies, factor Xa, thrombin and EK did not exhibit stringent sequence specificity and cleavage occurred at unintended sites [5,6]. Similarly, TEV protease produced in E. coli has been problematic due to low solubility [2]. The HRV3C protease, which cleaves between the Gln and Gly residues of the sequence Leu-Glu-Val-Leu-Phe-Gln/Gly-Pro, has been frequently used to remove fusion tags due to its strict cleavage specificity [7]. In the present study, the HRV3C protease was used to develop a novel self-cleavage system for production of recombinant protein in E. coli. This expression system offers a number of advantages. Firstly, this system consists of a set of six expression vectors that differ with respect to the specific solubility-enhancing fusion tag used, but all use the same multiple cloning site to enable parallel cloning from a single PCR product. Thus, it is easy to initially construct multiple vectors for recombinant protein expression and pursue the construct that allows for optimal (or best) soluble
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
recombinant protein production. Secondly, this system uses two independent expression cassettes on a single plasmid to separately regulate expression HRV3C protease and the target protein. Expression of the HRV3C protease is induced by a temperature change to 42 °C whereas recombinant protein expression is induced by addition of IPTG at 25 °C. Finally, the solubility-enhancing fusion tags can be readily separated from the recombinant protein of interest by the induced expression of the HRV3C protease, and the liberated native target can then be purified by affinity chromatography. This novel expression system offers a streamlined approach to identify optimal solubility-enhancing fusion partners and a simple cost-effective intracellular mechanism to remove the fusion tag prior to purification.
Materials and methods Materials The pET-39b, pGEX-6p-1, pET43.1a, pCold-TF, Ptac and PP plasmids were provided by Professor Dongfang Shi (Northeast Agricultural University). The pEASY-Blunt Cloning Kit was purchased from Bejing TransGen Biotech Co. (China). E. coli Top 10 cells were obtained from Beijing Tiangen Biotech Company (China). The pUC19, pET-32a, pMal-c4x, Y2079 and Y1140 plasmids were stored in our laboratory. The Quick T4 DNA Ligation Kit, Afl III, alkaline phosphatase, and calf intestinal phosphatase (CIP) were purchased from New England Biolabs. Restriction endonucleases (Smal I, Pvu II, Pvu I, Sac I, Kpn I, Nde I, Sal I, Aat II, Afl III, Nhe I and Not I), T4 DNA polymerase and PrimeSTAR HS DNA Polymerase were purchased from TaKaRa Biotechnology (Dalian) Co. (China). The AxyPrep DNA Gel Extraction Kit and AxyPrep Plasmid Mini prep Kit were purchased from AxyGen. Ni–NTA agarose was purchased from Invitrogen.
Construction of the pDL-A plasmid To enable control of HRV3C protease expression via changes to culture temperatures, the Hsh promoter (pHsh) and terminator (tHsh) sequences were appended to the 50 -ATG start codon and 30 -TGA stop codon of the GST-HRV3C protease nucleotide coding sequence. The pHsh-GST-HRV3C-tHsh sequence included 50 -Sma I and Pvu II and 30 -Sma I restriction enzyme sites to facilitate shuttling of segments into different vectors in subsequent steps. The ColE1 origin replication and ampicillin resistance genes were obtained from plasmid pUC19 by digestion with Aat II and Afl III restriction endonucleases. The digested product was blunted with T4 DNA polymerase, dephosphorylated with CIP, and then purified by agarose gel electrophoresis. The gel-purified sequence containing the ColE1 origin and ampicillin resistance gene was then ligated to the Sma I-Pvu II-PHsh-GST-HRV3C-THsh-Sma I construct and named plasmid pDL-A (Fig. 1).
Construction of the pDL-B plasmid The Ptac plasmid, containing the lacIq gene, tac promoter, and rrnB terminator, was digested with Kpn I and Sac I and blunted with a T4 DNA polymerase. The cut segment was purified by agarose gel electrophoresis and ligated into the Pvu II-digested and dephosphorylated pDL-A plasmid. The resultant plasmid was named pDL-B (Fig. 1). The pDL-B plasmid was verified by PCR using the primers JDP1 (50 -TTATCTGTTGTTTGTCGGTGAACGC-30 ) and JDP2 (50 -AAGGAAGATTGGGAAACTCCAAACC-30 ).
65
Construction of the pDL-C plasmid A multiple cloning site (MCS) containing cut sites for Sal I, Xho I, Sac I, Nhe I, Tth111 I, EcoT22I, PmaC I, Not I, Hind III, and Kpn I was produced by directly annealing primers P3 (50 -CATATGGAATTCCCACGCGTCGACCTCGAGGAGCTCGCTAGCGACAAAGTCATGCATCACG TGGCGG-30 ) and P4 (50 -CCCGGGTTAATGATGATGATGATGGTG GGT ACCAAGCTTTGCGGCCGCCACGTGATGCATGACTTTGTC-30 ). The above primers were designed to flank the MCS with a 50 -Nde I restriction site and a 30 -6His tag followed by a TAA stop codon and a Sma I restriction site. The Nde I and Sma I sites were included to facilitate construction of the pDL-C plasmid in subsequent steps. This gene was named M fragment (Fig. 1). The M fragment was purified by agarose gel electrophoresis, ligated into the pEASY-Blunt vector, transformed into Trans1-T1 competent cells and sequence verified. The M fragment was removed from the pEASY-Blunt vector by digestion with Nde I and Sma I and ligated into the pDL-B vector following digestion with Nde I and Sma I to produce plasmid pDL-C (Fig. 1). Construction of the expression platform The Trx, DsbA, GST, Nus, TF and MBP fusion tag genes were amplified from the pET32a, pET-39b, pGEX-6p-1, pET43.1a, pCold-TF and pMal-c4x vectors, respectively. Primers used to amplify each fusion tag included a 50 -Nde I restriction site and a 30 -HRV3C protease cleavage site sequence followed by a Sal I restriction site (Fig. 1). Each PCR product was purified by agarose gel electrophoresis, ligated separately into the pEASY-Blunt vector, transformed into Trans1-T1 competent cells and sequence verified. The Trx, DsbA, GST, Nus, TF and MBP fusion tag genes were digested by Nde I and Sal I and ligated independently into the pDL-C vector following Nde I and Sal I digestion. The resultant set of expression vectors each use a different fusion tag to enhance solubility of the recombinant protein of interest. These expression vectors were named pDL-Trx, pDL-DsbA, pDL-GST, pDL-Nus, pDLTF and pDL-MBP, respectively (Fig. 1). EGFP protein expression and Western blot analysis Enhanced Green Fluorescent Protein (EGFP) was selected as a target protein to characterize the set of expression vectors using different fusion tags. The EGFP gene was amplified from the Y1140 vector by PCR with the primers EGFP-F (50 -GCTAGCGTGAGCAAGGGCGAGGA-30 ) and EGFP-R (50 -GCGGCCGCTCTAGATCCGGT GGATCCC-30 ). These primers incorporated 50 Nhe I and 30 Not I restriction sites into the amplified products which were used to ligate the EGFP coding sequence into the pDL-Trx, pDL-DsbA, pDL-GST, pDL-Nus, pDL-TF and pDL-MBP expression plasmids, placing the EGFP sequence in frame with the fusion partner. Each expression construct was transformed into Top10 competent cells. Individual clones were inoculated into 50 mL Luria–Bertani (LB) broth supplemented with 100 lg ampicillin per mL in a 250-milliliter Erlenmeyer flask. Cultures were grown at 30 °C until log phase growth as indicated by the culture achieving an optical density at 600 nm (OD600) of 0.5. Production of the HRV3C protease was then induced by incubating the culture at 42 °C for 1 h. Production of the recombinant target protein (‘‘Tag’’-EGFP) was then induced with 0.35 mM IPTG at 25 °C for an additional 5 h. E. coli were harvested by centrifugation for 20 min at 8000 rpm and 4 °C, and washed three times with phosphate buffered saline (PBS). The cells were resuspended in 5 mL Native Binding Buffer (50 mM NaH2PO4, 0.5 mM NaCl, pH 8.0), sonicated for 30 min, and centrifuged at 9000 rpm at 4 °C for 25 min. The suspension was passed through
66
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
Fig. 1. Overview of expression plasmid construction to generate a novel self-cleavage system for production of soluble recombinant protein in Escherichia coli.
a 0.22 lm filter, purified using NI–NTA agarose according to manufacturer’s instructions and separated by SDS–PAGE. Briefly, the purified EGFP was subjected to electrophoresis on 12% SDS–PAGE and transferred onto a nitrocellulose membrane. Non-specific binding was blocked by incubating the membrane with 5% skim milk overnight at 4 °C. The membrane was incubated with a murine anti-His antibody followed by a peroxidaseconjugated goat anti-mouse IgG (H + L) antibody (ZSGB-BIO). Color was developed using 3,30 -diaminobenzidine tetrahydrochloride (DAB) and the reaction was stopped by rinsing the membrane with distilled water and drying the membrane [8].
Bluetongue viruses protein expression Bluetongue virus (BTV) protein was selected as a target protein to clone into the pDL-Trx, pDL-DsbA, pDL-GST, pDL-Nus, pDL-TF, pDL-MBP and pET-30a vectors. The BTV gene was amplified from the Y2079 vector by PCR with the primers BT-PF: (50 -CTCGAGTCAGCGGCGATCGATGGATTAGTA-30 ) and BT-PR: (50 -AAGCTTATGCG TTAAATCGATCCCGCTT-30 ). These primers incorporated 50 Xho I and 30 Hind III restriction sites which were used to clone sequence into the set of pDL expression plasmids. The primers BT-30F: (50 -CAT ATGTCAGCGGCGATCGATGGATTAGTA-30 ) and BT-PR incorporated
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
50 Nde I and 30 Hind III restriction sites were used to amplify the BTV gene. The amplified product was cloned into pET-30a and transformed into BL21 (DE3) competent cells. The procedure of protein expression was performed as described above. Results Production of the EGFP protein Six expression plasmids were constructed to produce EGFP in the soluble fraction of E .coli. The soluble fraction was harvested after IPTG induction and bacterial cell processing for analysis by SDS–PAGE. For each of the six expression constructs, a prominent protein band corresponding to the predicted size of recombinant EGFP was clearly visible (Fig. 2A). In some cases, the cleaved tag used to enhance EGFP solubility was also identifiable (for example, note the presence of a band corresponding to the GST fusion tag in lane 2 of Fig. 2A). And according to the gel in Fig. 2A, we tried to analysis the amount of the target protein (EGFP) with the 6 tags using the Image J software. The analysis of gray scale results showed that: Trx-EGFP (41577) > MBP-EGFP (32365) > Nus-EGFP (28584) > GST-EGFP (27641) > TF-EGFP (23005) > DsbA-EGFP (15757). Further, the soluble material harvested from E. coli
67
following induction displayed a green appearance suggesting significant production of soluble EGFP (Fig. 2B). The EGFP protein was further purified from E. coli transformed with pDL-Trx-EGFPTop10 using Ni–NTA affinity chromatography. EGFP was greatly enriched following purification on a nickel column as indicated by a protein stain of material separated by SDS–PAGE (Fig. 2C) and was recognized as expected by an anti-His antibody by Western Blot (Fig. 2D). The purified recombinant EGFP migrated with the expected molecular weight, indicating efficient removal of the solubility-enhancing Trx tag (Fig. 2C and D). HRV3C protease was induced by incubating the culture at 42 °C for 1 h and the bacterial cells were harvested for analysis by SDS– PAGE (Fig. 2E). Besides, there were no significant differences of the pDL-MBP-EGFP-Top10 incubated at 42 °C for 0 h, 1 h, 2 h, 3 h and 4 h on SDS–PAGE (Fig. 2F). The expression of HRV3C was leaky which made the fusion tag protein cleave and liberate the EGFP protein. Production of the BTV protein BTV protein was expressed using pET30a and the set of pDL expression vectors. The result showed that the protein formed the inclusion bodies with a negligible solubility when directly expressed in pET30a without a fusion tag. However, the solubility
Fig. 2. Production and characterization of EGFP produced using a novel self-cleavage system for production of soluble recombinant protein in Escherichia coli. (A) SDS–PAGE analysis of soluble material recovered from E. coli following induction of recombinant EGFP production and HRV3C-mediated removal of the fusion tag. Lane M: Protein marker. Lanes 1–6: Soluble material recovered from transformed E. coli following IPTG and HRV3C protease induction. Lane 1: pDL-DsbA-EGFP-Top10. Lane 2: pDL-GST-EGFPTop10. Lane 3: pDL-Trx-EGFP-Top10. Lane 4: pDL-MBP-EGFP-Top10. Lane 5: pDL-Nus-EGFP-Top10. Lane 6: pDL-TF-EGFP-Top10. (B) Soluble supernatants of pDL-DsbA-EGFPTop10, pDL-GST-EGFP-Top10, pDL-Trx-EGFP-Top10, pDL-MBP-EGFP-Top10, pDL-Nus-EGFP-Top10, pDL-TF-EGFP-Top10 after IPTG induction. (C) EGFP purified by Ni-affinity chromatography following IPTG induction and HRV3C-mediated removal of the Trx fusion tag was analyzed by PAGE. Lane M: Protein marker. Lane 1: Purified EGFP. (D) EGFP purified by Ni-affinity chromatography following IPTG induction and HRV3C-mediated removal of the Trx fusion tag was analyzed by Western blot. Lane M: Protein marker. Lane 1: Purified EGFP. (E) SDS–PAGE analysis of HRV3C protease. Lane M: Protein marker. Lane 1: HRV3C without induction. Lane 2: GST-HRV3C. (F) Lane M: Protein marker. Lane 1: pDL-MBP-EGFP-Top10 without induction. Lane 2–6: pDL-MBP-EGFP-Top10 was inducted with IPTG and incubating at 42 °C for 0 h, 1 h, 2 h, 3 h and 4 h. Lane 7–8: Supernatants and pellet of pDL-MBP-EGFP-Top10 without induction. Lane 9–10:Supernatants and pellet of pDL-MBP-EGFP-Top10 incubating at 42 °C for 1 h. Lane 11–12: Supernatants and pellet of pDL-MBP-EGFP-Top10 incubating with IPTG after incubating at 42 °C for 1 h.
68
Y. Feng et al. / Protein Expression and Purification 99 (2014) 64–69
Fig. 3. Results of SDS–PAGE of BTV protein. Red arrow is target protein; black arrow is fusion tag. Lane M: Protein marker. Lane 1–2: Pellet and supernatants of pDL-DsbA-BT incubating with IPTG. Lane 3–4: Pellet and supernatants of pDL-GST-BT incubating with IPTG. Lane 5–6: Pellet and supernatants of pDL-TF-BT incubating with IPTG. Lane 7–8: Pellet and supernatants of pDL-Trx-BT incubating with IPTG. Lane 9–10: Pellet and supernatants of pDL-MBP-BT incubating with IPTG. Lane 11–12: Pellet and supernatants of pDL-Nus-BT incubating with IPTG. Lane 13–14: Pellet and supernatants of pET30a-BT incubating with IPTG. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
of the protein was significantly enhanced when the fusion tags were used (Fig. 3). Discussion The efficient production and recovery of recombinant proteins is an important technological platform for many academic, industrial and pharmaceutical laboratories. In many cases, large quantities of purified, natively folded, and biologically active recombinant protein products are needed, as is the case for crystallographic studies and the production of protein-based therapeutic agents [9]. This is often difficult to achieve due to the limitations associated with the expression of heterologous gene products in E. coli and other expression systems. Several expression systems are available to produce recombinant proteins, including both prokaryotic and eukaryotic expression systems in E. coli, yeast, and insect and mammalian cells. E. coli is an attractive system in which to produce recombinant proteins, as bacterial cells can be grown in large quantities using straight forward culture techniques and are associated with relatively low manufacturing costs [3]. Despite these advantages, however, E. coli expression systems have critical limitations that hamper synthesis of some recombinant proteins. Some recombinant proteins are toxic to E. coli and transmembrane and hydrophobic proteins can often accumulate as insoluble aggregates in inclusion bodies. Furthermore, low molecular weight polypeptides
