Appl Microbiol Biotechnol DOI 10.1007/s00253-015-6604-3

APPLIED MICROBIAL AND CELL PHYSIOLOGY

A plasmid-born Rap-Phr system regulates surfactin production, sporulation and genetic competence in the heterologous host, Bacillus subtilis OKB105 Yang Yang 1,2 & Hui-Jun Wu 1,2 & Ling Lin 1,2 & Qing-qing Zhu 1,2 & Rainer Borriss 3 & Xue-Wen Gao 1,2

Received: 20 February 2015 / Revised: 8 April 2015 / Accepted: 10 April 2015 # Springer-Verlag Berlin Heidelberg 2015

Abstract According to the change of environment, soildwelling Bacillus species differentiate into distinct subpopulations, such as spores and competent cells. Rap-Phr systems have been found to be involved in this differentiation circuit by interacting with major regulatory proteins, such as Spo0A, ComA, and DegU. In this study, we report that the plasmidborn RapQ-PhrQ system found in Bacillus amyloliquefaciens B3 affects three regulatory pathways in the heterologous host Bacillus subtilis. Expression of rapQ in B. subtilis OKB105 strongly suppressed its sporulation efficiency, transformation efficiency, and surfactin production. Co-expression of phrQ or addition of synthesized PhrQ pentapeptide in vitro could compensate for the suppressive effects caused by rapQ. We also found that expression of rapQ decreased the transcriptional level of the sporulation-related gene spoIIE and surfactin synthesis-related gene srfA; meanwhile, the transcriptional levels of these genes could be rescued by co-expression of phrQ and in vitro addition of PhrQ pentapeptide. Electrophoretic mobility shift (EMSA) result also showed that RapQ could bind to ComA without interacting with ComA binding to DNA, and PhrQ pentapeptide antagonized RapQ activity in vitro. These results indicate that this new plasmidYang Yang and Hui-Jun Wu contributed equally to this work and share the first authorship. * Xue-Wen Gao [email protected] 1

Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China

2

Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, Nanjing 210095, People’s Republic of China

3

ABiTEP GmbH, Berlin, Germany

born RapQ-PhrQ system controls sporulation, competent cell formation, and surfactin production in B. subtilis OKB105. Keywords Rap-Phr system . Bacillus subtilis . Sporulation . Surfactin . Genetic competence

Introduction Some species of the Bacillus genus, such as Bacillus subtilis and Bacillus amyloliquefaciens, are soil-dwelling Gram-positive eubacteria. To survive in complex environments, they usually differentiate into many genetically identical but phenotypically distinct subpopulations, such as cells which secrete proteolytic enzymes, harbor competence ability, form spores, or produce antimicrobial compounds (López and Kolter 2010). To sense the change of extracellular stimuli and regulate the population differentiation, three master response regulator proteins, Spo0A, ComA, and DegU, are used to form the backbone of the complex regulatory network (Lopez et al. 2009; Veening et al. 2008). Maybe, these regulators are not able to totally regulate cell differentiation separately or alone, but these regulators affect the processes accurately, while also affected by other inputs. Using accurate and efficient ways to regulate the population differentiation of bacteria in the harsh and changing environment is necessary. Therefore, Bacillus strains utilize many two-component systems and other systems to regulate the population differentiation, and the Rap-Phr system, composed of response regulator aspartate phosphatase (Rap) and its inhibitory oligopeptide (Phr), is an important part of this complex network (Auchtung et al. 2006). Until now, 11 different rap (rapA-K) genes have been found in the B. subtilis genome, and eight of them have the cognate phr gene in the same operon (Auchtung et al. 2006;

Appl Microbiol Biotechnol

Stephenson et al. 2003). Some Rap proteins can modulate a variety of population separation processes by decreasing the phosphorylation of response regulator proteins or binding to them to block DNA binding (Bongiorni et al. 2006; Smits et al. 2007). The target response regulators of seven Rap proteins (RapA, B, C, E, F, G, and H) have been found. RapA, RapB, RapE, and RapH are phosphatases which induce the dephosphorylation of phosphorylated Spo0F (Spo0F-P) (Fawcett et al. 2000; Jiang et al. 2000; Mirouze et al. 2011). Spo0F-P phosphorylates Spo0B which is the phosphate donor of Spo0A, and phosphorylated Spo0A (Spo0A-P) induces sporulation-related genes (Piggot and Hilbert 2004). Therefore, RapA, RapB, RapE, and RapH indirectly reduce the phosphorylation of Spo0A to delay the initiation of sporulation. RapC and RapF can interact with ComA, which is the response regulator of the ComA-ComP two-component system (Bongiorni et al. 2005; Core and Perego 2003). According to changes in the environment, they can inhibit DNA-binding activity of ComA and phosphorylated ComA (ComA-P), which binds to target DNA and promotes the expression of genes related to the production of surfactin and formation of competent cells (López et al. 2009; Nakano et al. 1991a, b). RapC and RapF have the ability to hinder differentiation into competent cells and surfactin production. RapG obstructs production and secretion of proteases by binding to phosphorylated DegU (DegU-P) and inhibiting its DNA binding activity (Ogura et al. 2003). Moreover, RapG, RapH, and RapK are reported to decrease the expression level of ComAmodulated genes, and RapH is also reported to downregulate the expression of DegU-modulated genes (Auchtung et al. 2006; Mäder et al. 2002; Ogura et al. 2001); however, no direct evidence is available to show ComA or DegU as their target protein. The activity of Rap proteins is inhibited by Phr peptides, and B. subtillis encodes eight Phr peptides (PhrA, PhrC, PhrE, PhrF, PhrG, PhrH, PhrI, and PhrK) (Hayashi et al. 2006; Kunst et al. 1997). At the transition phase between the exponential growth phase and stationary phase, phr gene expression is induced by RNA polymerase containing the alternative factor, σH (McQuade et al. 2001). The phr gene product is prePhr, which is a small protein with a putative signal peptide. After exporting from the cell via the SecA-dependent system, the signal peptide is cleaved and generates an active Phr pentapeptide (Stephenson et al. 2003). As a quorum-sensing signal, Phr peptides are reimported into the cell via the oligopeptide permease (Opp) system when the population density reaches a high level, once inside the cell, they inhibit the activities of Rap proteins (Perego 1997; Tjalsma et al. 2000). Generally, each Phr peptide inhibits its cognate Rap protein. However, Rap proteins possibly can be inhibited by unpaired Phr peptides, such as RapB which is inhibited by the unpaired Phr peptide, PhrC (Perego 1997).

Several plasmid-born Rap-Phr systems have been reported to be involved in the subpopulation differentiation in Bacillus species. Rap60-Phr60, found in the plasmid pTA1060, was the first reported functional endogenous plasmid Rap-Phr system (Koetje et al. 2003) and can mediate production of secreted protease in B. subtilis 168. Another Rap-Phr was found in the virulence plasmid pOX1, and it was shown to regulate sporulation of Bacillus anthracis by mediating the phosphorylation level of Spo0F (Bongiorni et al. 2006). Recently, an endogenous plasmid system, RapP-PhrP, was found in B. subtilis NCIB 3610, and it was reported to mediate the differentiation of several subpopulations with characteristic functions, such as those of biofilm architecture, sporulation, and genetic competence, by controlling the phosphorylation level of Spo0F in B. subtilis (Parashar et al. 2013). B. amyloliquefaciens B3 is a powerful biocontrol strain for suppression microbial plant pathogens, and our former paper reported its cryptic plasmid pBSG3 sequence and genome sequence (Wu et al. 2013; Qiao et al. 2011). Due to the low transformation efficiency of B3 strain and the fact that B. amyloliquefaciens is a close relative and shares many characteristics with B. subtilis (Priest et al. 1987), we chose B. subtilis OKB105 strain to carry out related experiments. In this report, we present several lines of evidence showing that the pBSG3-encoded RapQ-PhrQ can regulate production of spores, surfactin, and competent cells in Bacillus sp.

Materials and methods Bacterial strains, plasmid, and growth conditions All bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli Top10 was used as the host for amplification of all plasmids, and the rapQ (GenBank: ADF30852.1) and phrQ (GenBank: ADF30853.1) genes were cloned from B. amyloliquifaciens B3. Luria Bertani (LB) broth was used for routine growth of B. subtilis and E. coli. Schaeffer’s nutrient broth sporulation medium (SM) was used for the determination of sporulation efficiency (Schaeffer et al. 1965), and Landy medium was used for surfactin extraction (Landy et al. 1948; Kowall et al. 1998). And, SP medium was used for the competent cell preparation (Spizizen 1958). Antibiotics, when appropriate, were used at the following concentrations: ampicillin (Amp), 100 μg/ml, and kanamycin (Km), 5 μg/ml. Construction of plasmids and strains The isolation and manipulation of recombinant DNA were performed using standard techniques. All enzymes used in this study were purchased from Takara (Kyoto, Japan). The specific primers used for the PCR are described in Table 2. In

Appl Microbiol Biotechnol Table 1

Bacterial strains and plasmids used in this study

Strain or plasmid

Relevant genotype or characteristicsa

Source or reference

Strains Escherichia coli DH5α F− Φ80dlacZ ΔM12 minirecA Bl21(DE3) F− ompT hsdSB(rB− mB−) gal dcm(DE3) PrapQ Dervied from Bl21(DE3); containing pETRap; Kmr PcomA Dervied from Bl21(DE3); containing pETRComA; Kmr Bacillus amyloliquifaciens B3 Wild-type; bacillomycin D and fengycin producer; CGMCC 10244 Bacillus subtilis OKB105 Surfactin producer, B. subtilis 168 transformed with sfp gene of B. subtilis ATCC 21332; BGSC 1A698 OKP3 Dervied from OKB105, containing pMK3s; Kmr OKP3R Dervied from OKB105; containing pMK3R; Kmr OKP3RP Dervied from OKB105; containing pMK3RP; Kmr Plasmids pBSG3 Rolling circle plasmid of Bacillus amyloliquefaciens B3

TaKaRa Bio Inc. Stored in this lab This study This study This study Nakano et al. 1988 This study This study This study Qiao et al. 2011

pAD43-25 pMD18-T pMK3

Shuttle vetor; gfpmut3a; bla; ‘glyA; Pupp; Cmr T/A-clone site vector; lacZ; Ampr Shuttle vector; Kmr

Dunn and Handelsman 1999 TaKaRa Bio Inc. Sullivan et al. 1984

pMK3R pMK3RP pET30 pETRap pETComA

The rapQ fragment was inserted into Sml I and Sal I sites of pMK3; Kmr The rapQ-phrQ fragment was inserted into Sml I and Sal I sites of pMK3; Kmr Shuttle vector; His-tag; S-tag; lacI; Kmr The rapQ fragment was inserted into BamH I and Sac I sites of pET30; Kmr The comA fragment was inserted into BamH I and Sac I sites of pET30; Kmr

This study This study Novagen Inc. This study This study

BGSC Bacillus Genetic Stock Center, CGMCC China General Microbiological Culture Collection Center a

Resistance markers were as follows: Ampr , ampicillin resistance; Kmr , kanamycin resistance; Cmr , chloramphenicol resistance

Table 2

Oligo DNA primers used in this study a

Primer name Sequence of primer (5′-3′) Rap-F Rap-R Phr-R SrfAA-F SrfAA-R SpoIIE-F SpoIIE-R PRap-F PRap-R PComA-F PComA-R EMSA-F EMSA-R a

CGGTCGACGATCGGGAAAAATAGTTGGTGAGAG (Sal I) TACCCGGGTTAAATTTCATAATGAGAATCACTCC (Sma I) TACCCGGGTTATGTTGCATTTCGAGAAGCAACTG (Sma I) TGTCAACGCTTCGCAAGATTA GTGCTTTCAGACGGTCCATA CTCCTATGCTTTCTGACATTCTG GACACCCTGTATGATTTTGTTGAT CGGGATCCATGAGTGCCATTCCGTCTG (BamH I) GCGAGCTCTTAAATTTCATAATGAG (Sac I) CGGGATCCATGAAAAAGATACTAGTG (BamH I) GCGAGCTCTTAAAGTACACCGTCTG (Sac I) CGCAAGCTTAAGATTGAACGCAGCAGTTTGGTTT (Hind III) GCGAATTCGCAGGCTGCCGTCAGTCAGCATTGC (EcoR I)

Restriction sites or mutation sites in primers are underlined

order to analyze the function of the rapQ-phrQ operon, the rapQ and rapQ-phrQ genes with their respective promoters were separately cloned into the shuttle plasmid pMK3 using primer pair Rap-F/Rap-R or Rap-F/Phr-R. The plasmid DNA of B. amyloliquifaciens B3 was used as the template. After digestion of these two fragments with Sal I and Sma I, they were ligated into the Sal I and Sma I sites of pMK3, resulting in the plasmids designated as pMK3R and pMK3RP, respectively. The entire cloned region was confirmed by sequencing (Invitrogen, Carlsbad, CA, USA). The pMK3, pMK3R, and pMKRP plasmids were separately transformed into B. subtilis OKB105 to obtain three new derivative strains OKP3, OKP3R, and OKP3RP. To express the ComA and RapQ proteins in E. coli, two corresponding expression vectors were constructed. The entire comA gene was amplified with primers PComA-F and PcomA-R (Table 2) using B. subtilis OKB105 genome DNA as template. The rapQ gene was amplified from the B. amyloliquifaciens B3 genome DNA with primers PRap-F and PRap-R (Table 2). Both forward primers and reverse primers respectively contained BamH I and Sac I restriction site. The PCR products were digested with BamH I and Sac I

Appl Microbiol Biotechnol

enzymes, and then cloned into the same site of pET30. The obtained expression vectors were then transformed into the E. coli BL21 for expressing the proteins. The recombinant proteins were all fused with his-tag in the N-terminal for facilitating purification. Protein expression and purification The strains carrying different expression vectors were cultivated at 37 °C overnight with shaking in LB medium containing 50 μg/ml kanamycin, and the overnight cultures were diluted 100-fold in LB and grown at the same condition. At an optical density of 0.5–0.7 at 600 nm, isopropyl-β-Dthiogalactoside (IPTG) was added to a final concentration of 1 mM. Cultures were induced overnight at 18 °C. Cells were collected by centrifugation at 8000 rpm at 4 °C for 20 min. Cell pellets were stored at −20 °C. The recombinant proteins fused with his-tag were purified by a single chromatographic step using HisTrapHP (GE Heath Care). Cells from 1 l culture were suspended with 20 ml binding buffer (20 mM K2PO4, pH 7.4, 200 mM NaCl, and 20 mM imidazole, pH7.4). Cells were lysed by sonication with a sonifier (20 kHz, 15 s on and 15 s off, 20 % power; Scientz, JY88-IIN). The lysed cells were centrifuged at 12,000 rpm at 4 °C for 1 h. The supernatant was collected and flowed throw 1 ml HisTrapHP column. The target proteins were bound to the column and then were eluted with a gradient of 10–200 mM imidazole. Protein was concentrated and changed buffer to stocking buffer (20 mM K2PO4, pH 7.4, 200 mM NaCl, 5 % Glycerol, pH 7.4) with 10 kd Millipore Amicon Ultra-15 column. Protein solution was separated into small aliquot and stored in −70 °C. Protein concentration was determined by Bradford assay and SDS-PAGE was used to analyze the purity. Determination of sporulation efficiency Determination of sporulation efficiency was carried out in Schaeffer’s nutrient broth sporulation medium (SM). An overnight culture of LB medium (1 %) was transferred into SM medium. B. subtilis cells were grown at 37 °C for 30 h, and then the culture was serially diluted and plated on LB agar to determine the number of viable cells. The number of heatresistant spores was determined by plating cells after being challenged at 80 °C for 20 min. Surfactin production analysis In order to detect the production of surfactin, a hemolysis test and MALDI-TOF-MS analysis were used. B. subtilis strains were grown in 50 ml of Landy medium for 38 h. Bacterial cells were removed from the surfactin-containing medium by centrifugation (8000 rpm for 25 min at 4 °C). The surfactin crude extract was precipitated from the supernatant by adding

6 N HCl to obtain a final pH of 2.0 (Cooper et al. 1981). The acid precipitates were recovered by centrifugation (8000 rpm for 15 min at 4 °C) and extracted with methanol. The extract was neutralized immediately to avoid formation of methyl esters and then evaporated to increase the surfactin concentration. Five microliters of the surfactin in methanol solution was placed on blood agar (Bianzhen Biotechnology Co., Ltd., Nanjing, China) to analyze the concentration by determining the area of the hemolysis ring, while 5 μl of methanol was used as a control. The crude extracts were analyzed by MALDITOF-MS as previously described (Leenders et al. 1999), and α-cyano-4-hydroxycinnamic acid was used as the matrix.

Determination of transformation efficiency To determine transformation frequency, cultures were grown in SP medium, transformed with pAD43-25 containing a chloramphenicol marker. The cultures were then plated on LB plates containing chloramphenicol to determine the number of transformants and on LB plates to determine total viability. The transformation frequency was calculated by dividing the number of transformants by the number of viable colonies per milliliter.

RNA extraction and cDNA synthesis Total RNA was extracted from B. subtilis using the RNAprep Pure Bacteria Kit (Tiangen, Beijing, China) according to the manufacturer’s protocol. In all samples, total RNA was treated with DNase I (Takara). Total RNA concentrations were measured with a NanoDrop 1000 Spectrophotometer (Thermo Fischer Scientific, Wilmington, DE, USA), and the RNA quality was evaluated by 0.8 % agarose gel electrophoresis in the presence of ethidium bromide. cDNA was reversetranscribed from 2 μg DNase I-treated total RNA using PrimeScript reverse transcriptase (Takara).

Quantitative real-time PCR ABI 7500 real-time PCR system (Applied Biosystems, Carlsbad, CA, USA) was used to collected data with 16 s rDNA from B. subtilis as a reference. The ΔΔCT method was used for the data normalization. The real-time PCR was carried out with SYBR Premix Ex Taq (Takara) following the manufacturer’s procedures. Thermal cycling conditions were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 34 s. After the cycling protocol, a melting curve was performed to analyze the specificity of amplification. Results were statistically analyzed utilizing the 7500 system SDS software (Applied Biosystems).

Appl Microbiol Biotechnol

Electrophoretic mobility shift assay

Table 3 Sporulation efficiency of B. subtilis OKB105 derivative strains expressing RapQ proteins in the pMK3 multicopy plasmid

A 320-bp DNA fragment containing 308 bp from srfA promoter region (from −185 to +123 bp) (Nakano et al. 1991a, b) and restriction site Hind III and EcoR I was amplified with primers electrophoretic mobility shift (EMSA)-F/EMSA-R (Table 2) from B. subtilis OKB105 genome DNA. PCR product was ligated to pMD18T vector and ligation was transformed into DH5α. Correct transformants were determined by DNA sequencing. The correct plasmid was digested with restriction enzymes Hind III and EcoR I and DNA fragment was extracted by Gel Extraction Kit (Omega Bio-Tec). The resulting DNA fragment was labeled with biotin with EMSA Probe Biotin Labeling Kit (Beyotime, China). EMSA reaction was carried out with Chemiluminescent EMSA Kit (Beyotime, China) and followed its protocol. Samples were analyzed with 6 % Native-PAGE gel and run at 60 V for 2 h at 4 °C in ×0.5 TBE buffer. Gel was tansbloted to Zeta-Probe Membrane (Bio-Rad) with Mini Trans-Blot™ Cell (Bio-Rad), 380 mA for 1 h. And, membrane was then treated with Chemiluminescent EMSA Kit (Beyotime, China) and then analyzed by ChemiDoc™ MP System (Bio-Rad).

Strain

No. of viable cells (cfu/ml)

No. of spores (cfu/ml)

Sporulation efficiency (%)

OKP3 OKP3RP OKP3R OKP3R +1 μM OKP3R +5 μM OKP3R +10 μM

1.5×108 1.23×108 0.49×108 0.37×108 0.6×108 0.5×108

0.67×108 0.67×108 0.07×107 0.02×108 0.23×108 0.17×108

44.4±7.6 54.1±2.1 1.4±0.2 6.4±4.3 38.9±12.1 33.3±5.7

Results RapQ-PhrQ system modulates sporulation in B. subtilis OKB105 Many genome-encoding Rap proteins of B. subtilis are able to inhibit the sporulation process, but plasmid-borne Rap proteins are seldom reported to have this ability (Koetje et al. 2003; Parashar et al. 2013). In our previous work, the single rapQ gene was found to cause a sporulation defect in B. subtilis OKB105 (Qiao et al. 2011). In order to confirm whether multiple copies of RapQ-PhrQ would affect sporulation in B. subtilis OKB105, the multicopy plasmid pMK3 carrying rapQ or rapQ-phrQ was separately transformed into B. subtilis OKB105. The rapQ and rapQ-phrQ genes were amplified by PCR each as a fragment, including a 360-bp promoter region at the 5′ end. For sporulation efficiency analysis, strains were grown for 30 h in SM medium. In comparison with B. subtilis OKP3 (see Table 3), B. subtilis OKP3R harboring the multicopy rapQ plasmid resulted in a sporulationdeficient phenotype (1.4 %). The presence of the multicopy rapQ-phrQ plasmid did not cause this phenotype, while sporulation of B. subtilis OKP3PR was as efficient as the control strain B. subtilis OKP3. These results showed the role of RapQ as a negative regulator

Growth was carried out in SM medium at 37 °C for 30 h. The number of heat-resistant spores was determined by plating cells after being challenged at 80 °C for 20 min. Synthesized PhrQ pentapeptide at 1, 5, or 10 μM was added into the OKP3R culture at T0

of sporulation in B. subtilis, and PhrQ could complement the sporulation deficiency caused by RapQ. RapQ-PhrQ system modulates synthesis of surfactin and development of competence Some Rap proteins such as RapH have been reported to be involved both in sporulation regulation and competence control (Mirouze et al. 2011). In this study, we also wanted to determine whether RapQ controls competence or other postexponential growth phase process. Therefore, the potential of RapQ or RapQ-PhrQ to regulate production of surfactin and development of competent cells was analyzed. The surfactin produced by the strains was first measured by testing its hemolytic activity in a blood plate. The results showed that the hemolysis ring of B. subtilis OKP3R harboring the multicopy rapQ plasmid was much smaller than that of B. subtilis OKP3, while the strain OKP3RP expressing RapQ-PhrQ produced a hemolysis ring as large as that of the control (Fig. 1). MALDITOF-MS was also used to identify the surfactin produced. As shown in Fig. 2, C13- and C14-surfactin could be found in the OKP3 and OKP3RP extracts, and the corresponding mass to charge ratios (m/z) were 1030.8 and 1044.8 [M+Na]+, respectively (Kowall et al. 1998); however, these two peaks were minimally detected in the OKP3R extract. As B. subtilis OKB105 is known to secrete an abundant amount of surfactin, multiple copies of rapQ obviously could depress surfactin production, and phrQ was able to complement surfactin deficiency caused by rapQ. The product of the small comS open reading frame (ORF) sequence embedded within the srfA operon is an intracellular peptide called ComS which could increase the amount of ComK indirectly (Hamoen et al. 1995). ComK is a master regulator of bacterial cell competence. For rapQ to decrease surfactin production, expression of srfA operon should be suppressed, while the expression level of comK also should be

Appl Microbiol Biotechnol

Fig. 1 RapQ-PhrQ system is involved in surfactin production. Five microliters of surfactin in methanol solution was placed on blood agar, and 5 μl of methanol was used for the blank control. The blood agar plates were placed in a 37 °C incubator for 24 h. (A) Surfactin extract of OKP3; (B) surfactin extraction of OKP3R; (C, D, and E) surfactin extraction of OKP3R with 1 μM, 5 μM and 10 μM PhrQ pentapeptide, respectively; (F) surfactin extract of OKP3RP. PhrQ pentapeptide was added into the OKP3R culture at T0

decreased. Therefore, in order to determine whether the multicopy rapQ plasmid may inhibit the formation of competent cells, the transformation efficiency was measured in SP medium. The results showed that the transformation efficiency of the strain OKP3R expressing RapQ was about 14 times lower than the negative control, and strain OKP3RP coproducing RapQ-PhrQ was only 3.8 times lower than the control (Table 4). This result suggested that the development of competence in B. subtilis could be decreased by multiple copies of rapQ, and phrQ could partially complement the reduction of transformation efficiency caused by rapQ.

Synthetic PhrQ pentapeptide compensates for inhibition caused by RapQ

time point we chose to add the pentapeptide was at the transient phase between the exponential phase and stationary phase of growth (T0). The results showed that the addition of the PhrQ pentapeptide in vitro could partially complement the decrease of sporulation efficiency and surfactin production caused by rapQ in B. subtilis (Table 3, Fig 1). While addition of 1 μM PhrQ caused little change of sporulation or surfactin production of B. subtilis OKP3R, these two phenotypes changed greatly when 5 or 10 μM PhrQ was added into the medium (Table 3 and Fig. 1). The results also showed little difference in effects between addition of 5 and 10 μM PhrQ, which both raised the sporulation efficiency of B. subtilis OKP3R to ~35 % and enlarged the hemolysis ring of B. subtilis OKP3R to a similar size (Table 3 and Fig. 1). These results indicated that 5 μM of the PhrQ pentapeptide was sufficient to compensate for the sporulation and surfactin synthesis defect caused by rapQ. RapQ-PhrQ regulates expression of the phosphorylated Spo0A (Spo0A-P)-dependent spoIIE genes Rap proteins inhibit phosphorylation of Spo0A by dephosphorylating Spo0F-P, and Spo0A-P is necessary for expression of sporulation-related genes (Errington 2003; Sonenshein 2000). The suppressed sporulation in strain OKP3R harboring rapQ may be attributed to the repressed expression of sporulation-related genes resulting from the low phosphorylation level of Spo0A. To test this hypothesis, relative expression of spoIIE, a Spo0A-P-dependent gene, was detected using realtime quantitative PCR. As shown in Fig. 3, the introduction of the multicopy rapQ plasmid caused an obvious suppression of spoIIE transcription in B. subtilis, and this inhibition by RapQ was rescued by the co-expression of PhrQ. Addition of the PhrQ pentapeptide also partially complemented the suppression of spoIIE transcription. Thus, we concluded that RapQPhrQ modulates active Spo0A level. RapQ-PhrQ regulates expression level of srfA

Products of phr genes cannot inhibit the activity of Rap proteins directly, and they need to be processed twice to be activated (Stephenson et al. 2003). Usually, a pentapeptide at the carboxy-terminal end of the phr gene product would be the inhibitor of the cognate Rap protein. We synthesized the carboxy-terminal pentapeptide of PhrQ, NH 2 -SRNATCOOH, which is the same as the Phr60 pentapeptide (Koetje et al. 2003). Phr pentapeptides are extracellular quorum signals which can be transferred intracellularly to inhibit Rap proteins when the population density is sufficiently high. In order to determine whether the synthetic PhrQ pentapeptide SRNAT could inhibit the RapQ protein, we analyzed sporulation efficiency and surfactin production of B. subtilis OKP3R (harboring the multicopy rapQ plasmid) with the addition of different amounts of PhrQ pentapeptide into the medium. The

As described before, rapQ-phrQ could regulate surfactin production in B. subtilis. Repression of the transcription of the gene encoding surfactin synthetase in cells harboring multiple copies of rapQ may explain the impaired surfactin production. As srfA encodes the subunits of surfactin synthetase (Nakano et al. 1991a, b), its transcription level was analyzed by realtime quantitative PCR. As shown in Fig. 3, srfA transcription was suppressed in rapQ-overexpressing cells. Both in vivo expression of phrQ and in vitro addition of the PhrQ pentapeptide could rescue the expression of srfA. An interesting phenomenon regarding the degradation of the PhrQ pentapeptide was also observed. When the synthesized, PhrQ pentapeptide was added to the B. subtilis OKP3R culture at T0, the transcriptional level of spo0F or srfA showed

Appl Microbiol Biotechnol

Fig. 2 MALDI-TOF-MS analysis of surfactin produced by strains OKP3 (a), OKP3R (b), and OKP3RP (c)

an apparent increase at T2. However, transcriptional levels of the target genes at T4 dropped back to the same level in B. subtilis OKP3R at T4 (Fig. 3). Meanwhile, transcriptional levels of target genes in B. subtilis OKP3 increased steadily. This result suggests that the PhrQ pentapeptide could be transferred into the cell and its function could last for 4 h (Fig. 3).

RapQ-PhrQ regulate ComA activity without interacting with its binding to DNA EMSA (electrophoretic mobility shift assay) was used for studying the mechanism of RapQ-PhrQ. The ComA from OKB105, which has the 86 % homology with that of B. amyloliquifaciens B3, was chosen as the target protein.

Appl Microbiol Biotechnol Table 4 Transformation efficiency of B. subtilis OKB105 derivative strains expressing RapQ proteins in multicopy plasmid pMK3 Strain

No. of viable cells (cfu/ml)

No. of transformants (cells/ml)

Transformation efficiency (10−7)

OKP3 OKP3RP OKP3R

14.05×107 7.15×107 6.9×107

101.4 13.8 3.6

7.22±0.54 1.93±0.19 0.52±0.24

SP medium was used for the transformation of B. subtilis OKB105. Transformation frequency was calculated by dividing the number of transformants by the number of viable colonies per milliliter

The EMSA result showed that when 5 μM ComA was incubated together with biotin-labeled DNA probe (10 nM), an obvious shifting band appeared and indicated that the ComA-DNA (promoter of srfA operon) binary complex formed (Fig. 4, line 2). But, the DNA probe treated with RapQ had no shifting band, this meant that the RapQ could not bind to the promoter of srfA operon. When RapQ was added into the reaction system containing both ComA and DNA probe, another smear band with higher molecular weight appeared upon the ComA-DNA binary band, and binary band was weakened. When increased the concentration of RapQ from 5 to 15 μM, ComA-DNA binary complex got weaker while the smear band got stronger (Fig. 4, line 4, 5). It was assumed that the RapQ could bind to the ComA and had no effect on the activity of ComA binding to the promoter of srfA operon. These resulted that RapQ, ComA, and promoter of srfA operon could form ternary complex, and therefore

Fig. 3 Real-time PCR analysis of expression of spoIIE (a) and srfAA (b) controlled by the RapQPhrQ system. a Strains were cultured in SM medium, and PhrQ pentapeptide was added into the OKP3R culture at T0. b Strains were cultured in Landy medium, and PhrQ pentapeptide was added into the OKP3R culture at T0. Cells were collected at T-2, T0, T2, T4, and T6. The transcriptional level of 16 s rDNA from was used as the reference. Black diamond: OKP3. Black square: OKP3R. Black triangle: OKP3RP. White triangle: OKP3R +1 μM PhrQ. White square: OKP3R +5 μM PhrQ. White circle: OKP3R +10 μM PhrQ

Fig. 4 EMSA assays were conducted with purified ComA, RapQ protein using biotin-labeled srfA promoter DNA fragment as probe. Line 1: Blank containing 10 nM DNA probe; line 2: positive control containing 5 μM ComA and 10 nM DNA probe; line 3: negative control containing 15 μM RapQ and 10 nM DNA probe; line 4: assay containing 5 μM RapQ, 5 μM ComA, and 10 nM DNA probe; line 5: assay containing 15 μM RapQ, 5 μM ComA, and 10 nM DNA probe; line 6: assay containing 10 μM PhrQ pentapeptide, 15 μM RapQ, 5 μM ComA, and 10 nM DNA probe; line 7: assay containing 20 μM PhrQ pentapeptide, 15 μM RapQ, 5 μM ComA, and 10 nM DNA probe. Followed the protocol of Chemiluminescent EMSA Kit (Beyotime, China)

decreased the amount of ComA-DNA binary complex. If 10 or 20 μM PhrQ pentapeptide was added into the assay containing 15 μM RapQ, ComA, and DNA probe, the smear band disappeared and binary complex band was restored as strong as before (Fig. 4, line 6, 7). Take all results together, RapQ could bind to ComA without interacting with ComA binding to DNA, and PhrQ pentapeptide could antagonize RapQ activity in vitro.

Appl Microbiol Biotechnol

Discussion In order to survive in a hostile environment, Bacillus species have complex signaling systems to control the differentiation of their populations. For example, ATP and GTP are used to sense starvation, and sporulation and intracellular protease synthesis could be triggered when their levels are low (Lopez et al. 2009). Some secondary metabolites can also function as signals, such as surfactin which is an important small molecule that triggers matrix production via KinC (López et al. 2009). Oligopeptides, such as Phr, ComX, and ComS, serve as another type of signal in Bacillus (D’Souza et al. 1994; Maamar et al. 2007). Our study suggests that the Rap-Phr system found in B. amyloliquifaciens B3 has the ability to control sporulation, surfactin production, and competent cell formation. Sporulation of Bacillus is triggered by starvation for carbon, nitrogen, or harsh environments. Initiation of population differentiation in these bacteria is controlled by the phosphorylation levels of Spo0A, which is a master transcriptional regulator. When the phosphorylation level of Spo0A is sufficiently high, transcription of downstream genes, such as spoIIA, spoIIE, and spoIIG, are activated (Fujita et al. 2005) and results in spore formation. The phosphorylation level of Spo0A is controlled by many different signals. One important source of phosphate is KinA, which has three PAS domains to monitor the energy and nitrogen status of the cell (Taylor and Zhulin 1999). Under starvation conditions, Spo0F is phosphorylated by KinA, and then the phosphate on Spo0F-P is transferred to Spo0A by Spo0B. Many Rap proteins, such as RapA and RapB, can suppress sporulation by dephosphorylation of Spo0F-P (Errington 2003). In this study, we also found that RapQ had the ability to suppress the sporulation of B. subtilis OKB105 (Table 3). Gene expression related to sporulation was also tested by real-time PCR, which showed that overexpression of RapQ suppressed the transcriptional level of spoIIE, a late-sporulation gene controlled by Spo0A-P. Sporulation efficiency and expression level of spoIIE were partially rescued when rapQ and phrQ were expressed together or pentapeptide was added in vitro. All these observations suggested that the RapQ-PhrQ system has the ability to control sporulation. The use of online secondary structure prediction tools (ITasser Online) suggested the presence of a four tetratricopeptide repeat (TPR) region in RapQ protein. The alignment of RapQ, RapH, RapF, and Rap60 showed high homologies in the N-terminal ends of these four proteins (Fig. 5). All of these proteins contain a 3-helix bundle connected to the C-terminus. The N-terminal end of RapH was also reported to be responsible for the dephosphorylation of Spo0F-P. Furthermore, analysis of the structure of RapH-Spo0F showed a conserved Q47 residue that is vital for the dephosphorylation activity, with its side inserted into Spo0F active site pocket (Parashar

et al. 2011). While the Q47 residue is also present in RapQ (Fig. 5), we speculate that it exerts the same activity in dephosphorylating Spo0F. Bacillus species use lipopeptides as antibiotics against other microorganisms to gain living space and nourishment, while some types of lipopeptides can be also used as extracellular signals (López et al. 2009; Stein 2005). Lipopeptides appear to be particularly important as a biocontrol agent for B. amyloliquifaciens B3. Our results showed that the RapQPhrQ system could control surfactin production in B. subtilis OKB105. Although this study was carried using B. subtilis, we believe that this system plays the same role in B. amyloliquifaciens B3, which has many similarities to B. subtilis. The surfactin synthesis begins with the production of ComX, an extracellular peptide which can be sensed by ComP when its concentration is sufficiently high. Subsequently, the response regulator ComA is phosphorylated by ComP. ComA-P then triggers the expression of the srfA operon, which is responsible for surfactin synthesis, by binding with the promoter (Nakano et al. 1991a, b). We also found that RapQ-PhrQ could control the transcription level of srfA (Fig. 3) and further used the EMSA to obtain in vitro evidence of interaction mechanism. The result of EMSA showed that RapQ could bind with ComA but did not inhibit ComA binding to target DNA and PhrQ pentapeptide had inhibitory effects on the activity of RapQ (Fig. 4). These results were similar with the Rap60 but the Phr60 had no corresponding inhibitory activity in vitro (Boguslawski et al. 2015). The common model for the interaction between Rap and ComA, just like RapC, RapF, and RapH, is to inhibit ComA-P binding with the target gene by binding with ComA (Auchtung et al. 2006; Core and Perego 2003; Smits et al. 2007), but Rap60 was reported to show different interaction way which could inhibit ComA activity without inhibiting ComA binding to target DNA (Boguslawski et al. 2015). It has been reported that six amino acids (F23, P27, D28, L67, E71, and Q78) in the N-terminal 3helix bundle of RapF directly interacted with ComA (Baker and Neiditch 2011). Among these activate sites, F23 and L67 are conserved in Rap60 and RapQ (Fig. 5), and these two conserved sites in Rap60 play important role during interaction with ComA (Boguslawski et al. 2015). As for the target of Rap, the ComA from OKB105 has 86 % homology with that of B. amyloliquifaciens B3, and R183, Y187, T190, and N194 in the α-9 helix at C-terminal are conserved. C-terminal, especially these four conserved amino acids of ComA, is responsible for interacting with Rap proteins. So, based on our results and analysis, RapQ might interact with ComA in the same way of Rap60. The difference between RapQ-PhrQ and Rap60-Phr60 system is PhrQ pentapeptide could inhibit RapQ binding to ComA in vitro while Phr60 has no such activity. Alignment of the amino sequences shows that there is a big difference in the region from 200th to 240th amino acid

Appl Microbiol Biotechnol Fig. 5 Alignment of RapQ, H, F, and 60 sequences using Clustal Omega

residues between RapQ and Rap60 and this region is one part of the TPR domain (the second and the third TPR motif). Six of seven TPR motifs of RapF, including the TPR mentioned above, were proved to be recognized and bound by PhrF (del Sol and Marina 2013). So, the difference of the TPR domain between RapQ and Rap60 also has the possibility to contribute to the different phenotype of Phr. In this study, we also found that the RapQ-PhrQ system is involved in the development of B. subtilis OKB105 competent cells. Overexpression of rapQ caused an evident decline of transformation efficiency, and the co-expression of phrQ could decrease this effect induced by rapQ. As our results also suggested, rapQ could decrease the expression of srfA, and the decline of transformation efficiency was most likely due to the low expression level of comS, which is a small ORF embedded in the srfA operon (D’Souza et al. 1994). The product of comS is a small extracellular peptide ComS, which releases ComK from the MecA-ClpC-ClpP complex (Prepiak and Dubnau 2007). When the concentration of ComK is at a sufficiently high level, it can bind to its own promoter and activate a positive autoregulatory loop to dramatically increase the level of ComK. The development of competent cells is triggered when the level of ComK exceeds a critical threshold (Maamar et al. 2007). Another interesting phenomenon was observed that the PhrQ peptide lost its function within 2–4 h after being added into the culture. Our results showed that the transcriptional levels of relative genes raised 2 h after the PhrQ pentapeptide was added into the medium and then declined again 2 h later. However, at the same time, relative gene expression levels in the strain which contained both rapQ and phrQ increased steadily. These results suggested that the PhrQ pentapeptide would not remain functional longer than 4 h in the cell. The regulation of proteolysis in bacteria has been well studied, and many proteases have been found, such as the AAA+ ATPase

family, ClpAP/XP family and Lon family of enzymes. These proteases are responsible for protein quality control, cell differentiation and regulation of cellular progress (Gur et al. 2011; Krishnappa et al. 2012). Thus, we speculate that these systems are involved in the degradation of the PhrQ pentapeptide and RapQ-PhrQ combination. In this research, the copy number of pBSG3, which carries RapQ-PhrQ system, is 5 inside B. amyloliquefaciens B3 (Wu et al. 2013). Considering this condition, multicopy plasmid pMK3 was used to carry this Rap-Phr system. Using the method raised by Projan et al. (Projan et al. 1983), we determined copy number of this E. coli-B. subitlis shuttle plasmid was around 15–20 in B. subtilis OKB105. Higher copy number of pMK3 might cause increased production of RapQ. So, the relatively higher concentration of PhrQ pentapeptide (1 μM) was needed to suppress activity of Rap protein in vivo. The similar phenomenon was also found in the study of another plasmid-born RapP-PhrP system from B. subtilis NCIB3610 (Parashar et al. 2013). But Phr60, another plasmid-borne Phr, was reported to act at low concentration (10 nM) (Boguslawski et al. 2015). Such a difference might be due to the fact that the Rap60 encoding gene was inserted into the genome of the host strain. Usually, genome-encoded Phr peptides have relative higher activity at low concentration (10 nM) such as PhrC (Core and Perego 2003). In summary, a new plasmid-borne Rap-Phr system which controls sporulation, surfactin production, and competent cell development was identified in B. amyloliquifaciens B3 and it could interact with ComA in vitro. As a biocontrol agent, B. amyloliquifaciens B3 can survive in a hostile environment and destroy its competitors, such as bacteria and fungi. Therefore, it requires a more accurate and efficient signaling system to control the cell differentiation compared with other Bacillus species, which may explain the existence of the RapQ-PhrQ system. We also discovered many rap genes in

Appl Microbiol Biotechnol

the genome of B. amyloliquifaciens B3. Our further study will focus on the structure and function relationship of RapQ and PhrQ and cooperation network of all Rap-Phr. Acknowledgments This work was supported by grants from the Agroscientific Research in the Public Interest (20130315), the Special Fund for the Fundamental Research Funds for the Central Universities (KYZ201404), the National Natural Science Foundation of China (31100056, 31471811), the Doctoral Fund of Ministry of Education of China (20100097120011), and the National High-tech R&D Program of China (2012AA101504). Ethical statement/conflict of interest I hereby certify that this paper consists of original, unpublished work which is not under consideration for publication elsewhere and all the authors listed have approved the manuscript that is enclosed.

References Auchtung JM, Lee CA, Grossman AD (2006) Modulation of the ComAdependent quorum response in Bacillus subtilis by multiple Rap proteins and Phr peptides. J Bacteriol 188(14):5273–5285 Baker MD, Neiditch MB (2011) Structural basis of response regulator inhibition by a bacterial anti-activator protein. PLoS Biol 9(12), e1001226 Boguslawski KM, Hill PA, Griffith KL (2015) Novel mechanisms of controlling the activities of the transcription factors Spo0A and ComA by the plasmid-encoded quorum sensing regulators Rap6Phr60 in Bacillus subtilis. Mol Microbiol (Accepted, unedited articles published online and citable) Bongiorni C, Ishikawa S, Stephenson S, Ogasawara N, Perego M (2005) Synergistic regulation of competence development in Bacillus subtilis by two Rap-Phr systems. J Bacteriol 187(13):4353–4361 Bongiorni C, Stoessel R, Shoemaker D, Perego M (2006) Rap phosphatase of virulence plasmid pXO1 inhibits Bacillus anthracis sporulation. J Bacteriol 188(2):487–498 Cooper D, Macdonald C, Duff S, Kosaric N (1981) Enhanced production of surfactin from Bacillus subtilis by continuous product removal and metal cation additions. Appl Environ Microbiol 42(3):408–412 Core L, Perego M (2003) TPR-mediated interaction of RapC with ComA inhibits response regulator-DNA binding for competence development in Bacillus subtilis. Mol Microbiol 49(6):1509–1522 del Sol FG, Marina A (2013) Structural basis of Rap phosphatase inhibition by Phr peptides. PLoS Biol 11(3), e1001511 D’Souza C, Nakano MM, Zuber P (1994) Identification of comS, a gene of the srfA operon that regulates the establishment of genetic competence in Bacillus subtilis. Proc Natl Acad Sci U S A 91(20):9397– 9401 Dunn AK, Handelsman J (1999) A vector for promoter trapping in Bacillus cereus. Gene 226(2):297–305 Errington J (2003) Regulation of endospore formation in Bacillus subtilis. Nat Rev Microbiol 1(2):117–126 Fawcett P, Eichenberger P, Losick R, Youngman P (2000) The transcriptional profile of early to middle sporulation in Bacillus subtilis. Proc Natl Acad Sci U S A 97(14):8063–8068 Fujita M, González-Pastor JE, Losick R (2005) High-and low-threshold genes in the Spo0A regulon of Bacillus subtilis. J Bacteriol 187(4): 1357–1368 Gur E, Biran D, Ron EZ (2011) Regulated proteolysis in Gram-negative bacteria—how and when? Nat Rev Microbiol 9(12):839–848 Hamoen LW, Eshuis H, Jongbloed J, Venema G, Sinderen D (1995) A small gene, designated comS, located within the coding region of the

fourth amino acid-activation domain of srfA, is required for competence development in Bacillus subtilis. Mol Microbiol 15(1):55–63 Hayashi K, Kensuke T, Kobayashi K, Ogasawara N, Ogura M (2006) Bacillus subtilis RghR (YvaN) represses rapG and rapH, which encode inhibitors of expression of the srfA operon. Mol Microbiol 59(6):1714–1729 Jiang M, Grau R, Perego M (2000) Differential processing of propeptide inhibitors of Rap phosphatases in Bacillus subtilis. J Bacteriol 182(2):303–310 Koetje EJ, Hajdo-Milasinovic A, Kiewiet R, Bron S, Tjalsma H (2003) A plasmid-borne Rap-Phr system of Bacillus subtilis can mediate celldensity controlled production of extracellular proteases. Microbiology 149(1):19–28 Kowall M, Vater J, Kluge B, Stein T, Franke P, Ziessow D (1998) Separation and characterization of surfactin isoforms produced by Bacillus subtilis OKB 105. J Colloid Interface Sci 204(1):1–8 Krishnappa L, Monteferrante CG, van Dijl JM (2012) Degradation of the twin-arginine translocation substrate YwbN by extracytoplasmic proteases of Bacillus subtilis. Appl Environ Microbiol 78(21): 7801–7804 Kunst F, Ogasawara N, Moszer I, Albertini A, Go A, Azevedo V, Bertero M, Bessieres P, Bolotin A, Borchert S (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390(6657):249–256 Landy M, Warren GH, RosenmanM SB, Colio LG (1948) Bacillomycin an antibiotic from Bacillus subtilis active against pathogenic fungi. Exp Biol Med (Maywood) 67(4):539–541 Leenders F, Stein TH, Kablitz B, Franke P, Vater J (1999) Rapid typing of Bacillus subtilis strains by their secondary metabolites using matrixassisted laser desorption/ionization mass spectrometry of intact cells. Rapid Commun Mass Spectrom 13(10):943–949 López D, Kolter R (2010) Extracellular signals that define distinct and coexisting cell fates in Bacillus subtilis. FEMS Microbiol Rev 34(2): 134–149 López D, Fischbach MA, Chu F, Losick R, Kolter R (2009) Structurally diverse natural products that cause potassium leakage trigger multicellularity in Bacillus subtilis. Proc Natl Acad Sci U S A 106(1): 280–285 Lopez D, Vlamakis H, Kolter R (2009) Generation of multiple cell types in Bacillus subtilis. FEMS Microbiol Rev 33(1):152–163 Maamar H, Raj A, Dubnau D (2007) Noise in gene expression determines cell fate in Bacillus subtilis. Science 317(5837):526–529 Mäder U, Antelmann H, Buder T, Dahl M, Hecker M, Homuth G (2002) Bacillus subtilis functional genomics: genome-wide analysis of the DegS-DegU regulon by transcriptomics and proteomics. Mol Genet Genomics 268(4):455–467 McQuade RS, Comella N, Grossman AD (2001) Control of a family of phosphatase regulatory genes (phr) by the alternate sigma factor Sigma-H of Bacillus subtilis. J Bacteriol 183(16):4905–4909 Mirouze N, Parashar V, Baker MD, Dubnau DA, Neiditch MB (2011) An atypical Phr peptide regulates the developmental switch protein RapH. J Bacteriol 193(22):6197–6206 Nakano MM, Marahiel M, Zuber P (1988) Identification of a genetic locus required for biosynthesis of the lipopeptide antibiotic surfactin in Bacillus subtilis. J Bacteriol 170(12):5662–5668 Nakano M, Magnuson R, Myers A, Curry J, Grossman A, Zuber P (1991a) srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol 173(5):1770–1778 Nakano MM, Xia LA, Zuber P (1991b) Transcription initiation region of the srfA operon, which is controlled by the comP-comA signal transduction system in Bacillus subtilis. J Bacteriol 173(17):5487–5493 Ogura M, Yamaguchi H, K-i Y, Fujita Y, Tanaka T (2001) DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an approach to comprehensive analysis of B subtilis two-component regulatory systems. Nucleic Acids Res 29(18):3804–3813

Appl Microbiol Biotechnol Ogura M, Shimane K, Asai K, Ogasawara N, Tanaka T (2003) Binding of response regulator DegU to the aprE promoter is inhibited by RapG, which is counteracted by extracellular PhrG in Bacillus subtilis. Mol Microbiol 49(6):1685–1697 Parashar V, Mirouze N, Dubnau DA, Neiditch MB (2011) Structural basis of response regulator dephosphorylation by Rap phosphatases. PLoS Biol 9(2), e1000589 Parashar V, Konkol MA, Kearns DB, Neiditch MB (2013) A plasmidencoded phosphatase regulates Bacillus subtilis biofilm architecture, sporulation, and genetic competence. J Bacteriol 195(10):2437– 2448 Perego M (1997) A peptide export–import control circuit modulating bacterial development regulates protein phosphatases of the phosphorelay. Proc Natl Acad Sci U S A 94(16):8612–8617 Piggot PJ, Hilbert DW (2004) Sporulation of Bacillus subtilis. Curr Opin Microbiol 7(6):579–586 Prepiak P, Dubnau D (2007) A peptide signal for adapter proteinmediated degradation by the AAA+ protease ClpCP. Mol Cell 26(5):639–647 Priest FG, Goodfellow M, Shute LA, Berkeley RCW (1987) Bacillus amyloliquefaciens sp. nov., nom. rev. Int J Syst Bacteriol 37(1): 69–71 Projan SJ, Carleton S, Novick RP (1983) Determination of plasmid copy number by fluorescence densitometry. Plasmid 9(2):182–190 Qiao JQ, Tian DW, Huo R, Wu HJ, Gao XW (2011) Functional analysis and application of the cryptic plasmid pBSG3 harboring the RapQ– PhrQ system in Bacillus amyloliquefaciens B3. Plasmid 65(2):141– 149 Schaeffer P, Millet J, Aubert J-P (1965) Catabolic repression of bacterial sporulation. Proc Natl Acad Sci U S A 54(3):704

Smits WK, Bongiorni C, Veening JW, Hamoen LW, Kuipers OP, Perego M (2007) Temporal separation of distinct differentiation pathways by a dual specificity Rap-Phr system in Bacillus subtilis. Mol Microbiol 65(1):103–120 Sonenshein AL (2000) Control of sporulation initiation in Bacillus subtilis. Curr Opin Microbiol 3(6):561–566 Spizizen J (1958) Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc Natl Acad Sci U S A 44(10):1072 Stein T (2005) Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol 56(4):845–857 Stephenson S, Mueller C, Jiang M, Perego M (2003) Molecular analysis of Phr peptide processing in Bacillus subtilis. J Bacteriol 185(16): 4861–4871 Sullivan MA, Yasbin RE, Young FE (1984) New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments. Gene 29(1):21–26 Taylor BL, Zhulin IB (1999) PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol Mol Biol Rev 63(2):479–506 Tjalsma H, Bolhuis A, Jongbloed JD, Bron S, van Dijl JM (2000) Signal peptide-dependent protein transport in Bacillus subtilis: a genomebased survey of the secretome. Microbiol Mol Biol Rev 64(3):515– 547 Veening J-W, Igoshin OA, Eijlander RT, Nijland R, Hamoen LW, Kuipers OP (2008) Transient heterogeneity in extracellular protease production by Bacillus subtilis. Mol Syst Biol 4(1) Wu H, Qiao J, Blom J, Rueckert C, Reva O, Gao X, Borriss R (2013) The rhizobacterium Bacillus amyloliquefaciens subsp. plantarum NAUB3 contains a large inversion within the central portion of the genome. Genome Announc 1(6)