World J Microbiol Biotechnol DOI 10.1007/s11274-015-1839-9
SHORT COMMUNICATION
A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei Dina B. Saroj1 • Shrinivas N. Dengeti1 • Supriya Aher1 • Anil K. Gupta1
Received: 8 January 2015 / Accepted: 4 March 2015 Ó Springer Science+Business Media Dordrecht 2015
Abstract Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species. Keywords Rapid identification Trichoderma citrinoviride Trichoderma reesei Longibrachiatum Tef Primer specificity
Electronic supplementary material The online version of this article (doi:10.1007/s11274-015-1839-9) contains supplementary material, which is available to authorized users. & Dina B. Saroj [email protected] 1
Advanced Enzyme Technologies Ltd., 5th Floor, A WING, Sun Magnetica, LIC Service Road, Louiswadi, Thane (W) 400 604, Maharashtra, India
Introduction Trichoderma and other fungal species are used widely for industrial production of enzymes (Jun et al. 2011). Among Trichoderma species, T. reesei have been widely exploited for production of cellulase at large scale by different enzyme industries (Singhania et al. 2010) and T. citrinoviride, is known as most efficient producer of high amount of bglucosidase (Tiwari et al. 2013). One of the important aspects of safety assessment is the unequivocal identification of fungi. The earlier approach of identification of fungi using morphological characteristics is now slowly replaced with more rational molecular biology based identification. The comprehensive characterization of the Trichoderma sp. based on the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) concept includes the selection of the bar code genes, PCR amplification and sequencing of these gene followed by bioinformatics (Taylor et al. 2000). Industrial laboratories are required to run identification tests during the cell banking procedures. When a culture is to be used over many manufacturing cycles, a two-tiered cell banking system consisting of a master cell bank (MCB) and a working cell bank (WCB) is recommended. In industries, whenever the new clone is established, it is used to make the MCB which is characterized by elaborate procedures like GCPSR. The cells from the MCB are expanded to form the WCB for routine production procedure. Also, it is critical to prove the absence of production strain in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. GCPSR procedure is too laborious and time consuming for confirmation of identification of the strain during the above mentioned procedures. Food and Drug Administration (1991) and International Conference on Harmonisation (1997) has specified that the WCBs (subcultures) may be
123
World J Microbiol Biotechnol
tested in a more limited manner with the use of molecular techniques. Trichoderma species are used as host for production of enzymes. Considering the same, one of the requirements is that such enzyme preparations, produced using recombinant host, must be free from the production host microorganisms. Industrial enzymes prepared using crude substrates may contain molds other than the production microorganism. As the differentiation based on morphology cannot be carried out between closely related species, a rapid molecular biology based approach should be implemented to differentiate them. To cope with the industry prerequisite, it becomes necessary to design a rapid, unique and less cumbersome method for limited characterization of the fungus during cell banking and multiple batches of production. Multiplex PCR has been attempted as one of the PCR techniques for rapid identification of Trichoderma but this was restricted only to T. pleurotum and T. pleuroticola (Kredics et al. 2009). The first molecular phylogenetic analysis of the Longibrachiatum clade was based on the internal transcribed spacer region (ITS) of the rRNA gene cluster. Although this region is currently considered to be a universal barcode locus for fungi (Bellemain et al. 2010), it is unable to distinguish all closely related species in many genera of hyphomycetes including Trichoderma (Gazis et al. 2011). Hence, the challenge is to select the right barcode locus which can distinctly differentiate and identify closely related species such as T. citrinoviride and T. reesei of Longibrachiatum clade. In order to overcome the time constraint factor for identification of Trichoderma species, we developed a rapid and simple PCR based method for limited molecular characterization of strains T.citrinoviride and T.reesei. DNA sequence alignments were carried out for ITS (ITS15.8S-ITS2), endochitinase and translation elongation factor alpha 1 gene (Tef1) for strains belonging to Longibrachiatum clade (Druzhinina et al. 2012) to identify polymorphic sequences appropriate for development of primers specific for T. citrinoviride and T. reesei. The polymorphic sequences were observed in Tef1 gene. Hence, in this study, Tef1 gene was used as barcode. We propose easy and reproducible single step PCR with species-specific primers for rapid identification. Moreover, this method is unique as it utilizes directly the fungal mycelium as template against the genomic DNA or thermal lysis utilized by other rapid identification methods.
Materials and methods Fungal strains and culture conditions The fungal isolates T. citrinoviride used in the current study was obtained from WCB of Advanced Enzymes
123
Fig. 1 Multiple sequence alignment of Tef 1gene showing the c polymorphic region in a T. citrinoviride, b T. reesei and c conserved region in T. citrinoviride and T. reesei
Technologies Limited, India and T. reesei (strain QM 6a) was procured from National Collection of Industrial Microorganisms (NCIM), India. The fungal strains were grown in 250 ml Erlenmeyer flask containing 50 ml of Potato Dextrose Broth (BD, Difco) at 30 °C for 48 h at 180 rpm. Preparation of template for PCR reaction Fungal mass was transferred into sterile 50 ml centrifuge tubes and centrifuged at 60009g for 10 min. The fungal pellet was washed with MilliQ water and squeeze dried using sterile Whatman filter paper (No. 4). The fungal pellet was ground to fine powder with liquid nitrogen and kept at 40 °C until constant weight was obtained. The dried pellet was used for preparation of PCR template. One mg of dried cell pellet was re-suspended in 400 ll of sterile MilliQ water followed by incubation at 70 °C for 30 min at 600 rpm on thermomixer. Also, intermittent vortex was carried out during incubation so that the fungal pellet is disrupted and suspension becomes turbid. The suspended fungal pellet was used as template for PCR reaction. Primer designing and PCR conditions for rapid identification of T. citrinoviride and T. reesei A group of approximately 100 partial coding sequence of translation elongation factor alpha 1 (Tef1) gene from 26 different species of clade Longibrachiatum as listed by Druzhinina et al. (2012) were retrieved from NCBI (http:// www.ncbi.nlm.nih.gov/). These sequences were aligned using ClustalW (www.genome.jp/tools/clustalw/) and the most polymorphic region and conserved regions on Tef1 gene was identified for T. citrinoviride and T. reesei. The polymorphic region was utilized to design a forward primers (Tc_RIF: 50 TACAACAGTCTCACTGCACTCGTC CGC 30 and Tr_RIF: 50 AGTCACCCAACGTCATCAAC GC 30 ) and the conserved region was utilized to design a reverse primer (T_RIR: 50 GCTCACGCTCGGCCTTGAGCTTGT 30 ). PCR was performed in a 100 ll final volume containing 8 ll of template, 50 ll of 2X KODFX buffer, 20 ll of 2 mmol l-1 dNTP’s, 2 ll of KFX Polymerase (1.0 U ll-1) and 2 ll of 10 pmol ll-1 each primer. The PCR amplification included an initial denaturation step at 94 °C for 5 min, followed by 30 cycles at 98 °C for 10 s, 65 °C for 30 s and 68 °C for 30 s followed by final extension at 68 °C for 7 min. The amplification products were resolved on 1 % agarose gel stained with ethidium bromide. The positive PCR products were extracted from the agarose gel using Qiagen Gel extraction Kit (Qiagen) and processed for
World J Microbiol Biotechnol
123
World J Microbiol Biotechnol
nucleotide sequencing at Eurofins Genomics India Pvt. Ltd., Bengaluru, India. Sequencing data was analyzed using Sequencher 5.1 from Gene Codes, USA. Specificity of primers Specificity of the primer sets for T. citrinoviride and T.reesei were analyzed by performing PCR on other representative strain from Longibrachiatum clade T. reesei and T. citrinoviride respectively. The cross reactivity of primer pairs was analyzed in silico by comparing target nucleotide database for major taxonomic group of fungi as template using web-based Primer-BLAST tool (http:// www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). To assess the specificity of the primer pairs, we allowed at least four mismatches between each primer and the template which includes at least two bases within the last five base pairs at 30 end of the primers (Ye et al. 2012).
Results In this study, species-specific primers were designed for rapid identification of Trichoderma species. Based upon multiple sequence alignment of Tef1 gene, polymorphic areas (Fig. 1a, b) were identified for designing unique forward primer for T. citrinoviride (Tc_RIF) and T. reesei (Tr_RIF). Conserved region was identified (Fig. 1c) for designing the common reverse primer (T_RIR). PCR with the respective primers gave an amplicon of 153 and 139 bp for T. citrinoviride and T.reesei respectively (Figs. 2 and 3). No cross reactivity of primers was observed with the other representative strain from Longibrachiatum clade (Figs. 2 and 3). The specificity of these primers was further confirmed by sequencing the PCR products and analyzing them online using BLAST program (http://blast.ncbi.nlm. nih.gov/Blast.cgi). The nucleotide sequence of T. citrinoviride and T. reesei PCR products showed 100 % homology to nucleotide sequence in databank. Thus, the amplicon of expected size with the respective primers supported by sequencing data indicates that this strategy can be utilized successfully to characterize these two industrially important strains. Searching for cross reactivity of primers with major taxonomic group of fungi and bacteria using online tool Primer-BLAST offers in silico confirmation for primers specificity (Ye et al. 2012). The primer sets Tc_RIF/T_RIR and Tr_RIF/T_RIR showed homology for PCR amplicon with the expected size from T. citrinoviride and T. reesei respectively. The primer pairs did not show any homology for PCR amplicon from other members of Longibrachiatum clade or from any other fungal taxa (Figs. 4 and 5; Supplemental data 1). Additional in silico analysis indicates that
123
Fig. 2 PCR amplification for cross reactivity of T. citrinoviride primers (Tc_RIF and T_RIR) with 2 representative strains from Longibrachiatum clade. Lane M 100 bp DNA ladder, ThermoScientific; Lane 1 T. citrinoviride as template; Lane 2 T. reesei as template and Lane 3 Negative control—sterile type 1 water used as template
Fig. 3 PCR amplification for cross reactivity of T. reesei primers (Tr_RIF and T_RIR) with 2 representative strains from Longibrachiatum clade. Lane M 100 bp DNA ladder, Thermo Scientific; Lane 1 T. citrinoviride as template; Lane 2 T. reesei as template and Lane 3 Negative control—sterile type 1 water used as template
when the primer pairs were targeted against all fungal and bacterial taxonomic groups, it resulted in amplicon specifically from T. citrinoviride and T. reesei.
Discussion Various strategies have been employed for rapid identification of different fungal strains. Kredics et al. (2009) utilized two different gene sequences ITS and Tef1 for
World J Microbiol Biotechnol
rapid detection of T. pleurotum and T. pleuroticola. Serrano et al. (2011) developed a multiplex PCR based assay for rapid identification of Aspergillus fumigatus. All the above developed methods were designed with the diagnostic perspective and involved two genes for the identification. Species recognition in Trichoderma is usually based on the application of the GCPSR concept (Taylor et al. 2000) based on the partial sequences of the Tef1, endochitinase (chi18-5), calmodulin (cal1) and other loci (Lo´pez-Quintero et al. 2013). In our report, as described in Fig. 1a–c, we have developed a PCR based method using speciesspecific unique primer pair for industrially important strains of T.citrinoviride and T. reesei. The method utilizes whole fungal cells as template for the PCR reactions. Omission of the DNA extraction procedure significantly decreases the time required to make an accurate identification by PCR. The in silico analysis of primer pairs using bioinformatics tools offers added advantage for primer specificity check as described previously by Bellemain et al. (2010). This method can be adopted for limited characterization of the fungus in industry during cell banking and multiple batches of enzyme production. In conclusion, this PCR assay can meet the industry requirement of confirming briefly the strain identity during the production batches. Moreover, the direct use of fungal mycelia unlike genomic DNA utilized by other rapid identification methods put forth this method as rapid and single step identity confirmation. The technique can confirm the identification of the strain during cell banking or production process. This concept can be extended for the identification of other fungal strains by identifying their polymorphic nucleotide sequences. Acknowledgments The authors would like to thank Mr. C. L. Rathi, Mr. P. C. Rathi and Mr. M. M. Kabra, Advanced Enzymes Technologies Limited, Thane (India) for providing the laboratory facilities.
References Bellemain E, Carlsen T, Brochmann C, Coissac E, Taberlet P, Kauserud H (2010) ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases. BMC Microbiol 10:189. doi:10.1186/1471-2180-10-189
Druzhinina IS, Komon´-Zelazowska M, Adnan I, klitsch W, Mullaw T, Gary JS, Christian PK (2012) Molecular phylogeny and species delimitation in the section Longibrachiatum of Trichoderma. Fungal Genet Biol 49:358–368. doi:10.1016/j.fgb.2012.02.004 FDA, Biotechnology Inspection Guide (1991) Biotechnology inspection guide reference materials and training Aids. Division of Field Investigations (HFC-130). http://www.fda.gov/iceci/inspec tions/inspectionguides/ucm074181.htm Gazis R, Rehner S, Chaverri P (2011) Species delimitation in fungal endophyte diversity studies and its implications in ecological and biogeographic inferences. Mol Ecol 20:3001–3013. doi:10.1111/ j.1365-294X.2011.05110.x ICH Harmonised Tripartite Guideline (1997) Derivation and characterization of cell substrates used for production of biotechnological/biological products Q5D. International Conference on Harmonisation, 1–13 Jun H, Kieselbach T, Jonsson LJ (2011) Enzyme production by filamentous fungi: analysis of the secretome of Trichoderma reesei grown on unconventional carbon source. Microb Cell Fact 10:68–77. doi:10.1186/1475-2859-10-68 Kredics L, Kocsube´ S, Nagy L, Komon-Zelazowska L, Manczinger L, Sajben E, Nagy A, Vagyolgyi C, Kubicek C, Druzinina R, Hatwani L (2009) Molecular identification of Trichoderma species associated with Pleurotus ostreatus and natural substrates of the oyster mushroom. FEMS Microbiol Lett 300:58–67. doi:10.1111/j.1574-6968.2009.01765.x Lo´pez-Quintero CA, Atanasova L, Esperanza Franco-Molano A, Gams W, Komon-Zelazowska M, Theelen B, Muller HW, Boekhout T, Druzinina I (2013) DNA barcoding survey of Trichoderma diversity in soil and litter of the Colombian lowland Amazonian rainforest reveals T. strigosellum sp. nov. and other species. Antonie Van Leeuwenhoek 104:657–674. doi:10.1007/s10482-013-9975-4 Serrano R, Gusmao L, Amorim A, Araujo R (2011) Rapid identification of Aspergillus fumigatus within the section Fumigati. BMC Microbiol 11:82. doi:10.1186/1471-2180-11-82 Singhania RR, Sukumaran RK, Patel AK, Larroche C, Pandey A (2010) Advancement and comparative profiles in the production technologies using solid-state and submerged fermentation for microbial cellulases. Enzyme Microb Technol 46:541–549. doi:10.1016/j.enzmictec.2010.03.010 Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 31:21–32. doi:10. 1006/fgbi.2000.1228 Tiwari P, Misra BN, Sangwan NS (2013) b-Glucosidases from the Fungus Trichoderma: an efficient cellulase machinery in Biotechnological applications. BioMed Res Int. doi:10.1155/ 2013/203735 Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform 13:134. doi:10. 1186/1471-2105-13-134
123
SHORT COMMUNICATION
A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei Dina B. Saroj1 • Shrinivas N. Dengeti1 • Supriya Aher1 • Anil K. Gupta1
Received: 8 January 2015 / Accepted: 4 March 2015 Ó Springer Science+Business Media Dordrecht 2015
Abstract Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species. Keywords Rapid identification Trichoderma citrinoviride Trichoderma reesei Longibrachiatum Tef Primer specificity
Electronic supplementary material The online version of this article (doi:10.1007/s11274-015-1839-9) contains supplementary material, which is available to authorized users. & Dina B. Saroj [email protected] 1
Advanced Enzyme Technologies Ltd., 5th Floor, A WING, Sun Magnetica, LIC Service Road, Louiswadi, Thane (W) 400 604, Maharashtra, India
Introduction Trichoderma and other fungal species are used widely for industrial production of enzymes (Jun et al. 2011). Among Trichoderma species, T. reesei have been widely exploited for production of cellulase at large scale by different enzyme industries (Singhania et al. 2010) and T. citrinoviride, is known as most efficient producer of high amount of bglucosidase (Tiwari et al. 2013). One of the important aspects of safety assessment is the unequivocal identification of fungi. The earlier approach of identification of fungi using morphological characteristics is now slowly replaced with more rational molecular biology based identification. The comprehensive characterization of the Trichoderma sp. based on the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) concept includes the selection of the bar code genes, PCR amplification and sequencing of these gene followed by bioinformatics (Taylor et al. 2000). Industrial laboratories are required to run identification tests during the cell banking procedures. When a culture is to be used over many manufacturing cycles, a two-tiered cell banking system consisting of a master cell bank (MCB) and a working cell bank (WCB) is recommended. In industries, whenever the new clone is established, it is used to make the MCB which is characterized by elaborate procedures like GCPSR. The cells from the MCB are expanded to form the WCB for routine production procedure. Also, it is critical to prove the absence of production strain in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. GCPSR procedure is too laborious and time consuming for confirmation of identification of the strain during the above mentioned procedures. Food and Drug Administration (1991) and International Conference on Harmonisation (1997) has specified that the WCBs (subcultures) may be
123
World J Microbiol Biotechnol
tested in a more limited manner with the use of molecular techniques. Trichoderma species are used as host for production of enzymes. Considering the same, one of the requirements is that such enzyme preparations, produced using recombinant host, must be free from the production host microorganisms. Industrial enzymes prepared using crude substrates may contain molds other than the production microorganism. As the differentiation based on morphology cannot be carried out between closely related species, a rapid molecular biology based approach should be implemented to differentiate them. To cope with the industry prerequisite, it becomes necessary to design a rapid, unique and less cumbersome method for limited characterization of the fungus during cell banking and multiple batches of production. Multiplex PCR has been attempted as one of the PCR techniques for rapid identification of Trichoderma but this was restricted only to T. pleurotum and T. pleuroticola (Kredics et al. 2009). The first molecular phylogenetic analysis of the Longibrachiatum clade was based on the internal transcribed spacer region (ITS) of the rRNA gene cluster. Although this region is currently considered to be a universal barcode locus for fungi (Bellemain et al. 2010), it is unable to distinguish all closely related species in many genera of hyphomycetes including Trichoderma (Gazis et al. 2011). Hence, the challenge is to select the right barcode locus which can distinctly differentiate and identify closely related species such as T. citrinoviride and T. reesei of Longibrachiatum clade. In order to overcome the time constraint factor for identification of Trichoderma species, we developed a rapid and simple PCR based method for limited molecular characterization of strains T.citrinoviride and T.reesei. DNA sequence alignments were carried out for ITS (ITS15.8S-ITS2), endochitinase and translation elongation factor alpha 1 gene (Tef1) for strains belonging to Longibrachiatum clade (Druzhinina et al. 2012) to identify polymorphic sequences appropriate for development of primers specific for T. citrinoviride and T. reesei. The polymorphic sequences were observed in Tef1 gene. Hence, in this study, Tef1 gene was used as barcode. We propose easy and reproducible single step PCR with species-specific primers for rapid identification. Moreover, this method is unique as it utilizes directly the fungal mycelium as template against the genomic DNA or thermal lysis utilized by other rapid identification methods.
Materials and methods Fungal strains and culture conditions The fungal isolates T. citrinoviride used in the current study was obtained from WCB of Advanced Enzymes
123
Fig. 1 Multiple sequence alignment of Tef 1gene showing the c polymorphic region in a T. citrinoviride, b T. reesei and c conserved region in T. citrinoviride and T. reesei
Technologies Limited, India and T. reesei (strain QM 6a) was procured from National Collection of Industrial Microorganisms (NCIM), India. The fungal strains were grown in 250 ml Erlenmeyer flask containing 50 ml of Potato Dextrose Broth (BD, Difco) at 30 °C for 48 h at 180 rpm. Preparation of template for PCR reaction Fungal mass was transferred into sterile 50 ml centrifuge tubes and centrifuged at 60009g for 10 min. The fungal pellet was washed with MilliQ water and squeeze dried using sterile Whatman filter paper (No. 4). The fungal pellet was ground to fine powder with liquid nitrogen and kept at 40 °C until constant weight was obtained. The dried pellet was used for preparation of PCR template. One mg of dried cell pellet was re-suspended in 400 ll of sterile MilliQ water followed by incubation at 70 °C for 30 min at 600 rpm on thermomixer. Also, intermittent vortex was carried out during incubation so that the fungal pellet is disrupted and suspension becomes turbid. The suspended fungal pellet was used as template for PCR reaction. Primer designing and PCR conditions for rapid identification of T. citrinoviride and T. reesei A group of approximately 100 partial coding sequence of translation elongation factor alpha 1 (Tef1) gene from 26 different species of clade Longibrachiatum as listed by Druzhinina et al. (2012) were retrieved from NCBI (http:// www.ncbi.nlm.nih.gov/). These sequences were aligned using ClustalW (www.genome.jp/tools/clustalw/) and the most polymorphic region and conserved regions on Tef1 gene was identified for T. citrinoviride and T. reesei. The polymorphic region was utilized to design a forward primers (Tc_RIF: 50 TACAACAGTCTCACTGCACTCGTC CGC 30 and Tr_RIF: 50 AGTCACCCAACGTCATCAAC GC 30 ) and the conserved region was utilized to design a reverse primer (T_RIR: 50 GCTCACGCTCGGCCTTGAGCTTGT 30 ). PCR was performed in a 100 ll final volume containing 8 ll of template, 50 ll of 2X KODFX buffer, 20 ll of 2 mmol l-1 dNTP’s, 2 ll of KFX Polymerase (1.0 U ll-1) and 2 ll of 10 pmol ll-1 each primer. The PCR amplification included an initial denaturation step at 94 °C for 5 min, followed by 30 cycles at 98 °C for 10 s, 65 °C for 30 s and 68 °C for 30 s followed by final extension at 68 °C for 7 min. The amplification products were resolved on 1 % agarose gel stained with ethidium bromide. The positive PCR products were extracted from the agarose gel using Qiagen Gel extraction Kit (Qiagen) and processed for
World J Microbiol Biotechnol
123
World J Microbiol Biotechnol
nucleotide sequencing at Eurofins Genomics India Pvt. Ltd., Bengaluru, India. Sequencing data was analyzed using Sequencher 5.1 from Gene Codes, USA. Specificity of primers Specificity of the primer sets for T. citrinoviride and T.reesei were analyzed by performing PCR on other representative strain from Longibrachiatum clade T. reesei and T. citrinoviride respectively. The cross reactivity of primer pairs was analyzed in silico by comparing target nucleotide database for major taxonomic group of fungi as template using web-based Primer-BLAST tool (http:// www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). To assess the specificity of the primer pairs, we allowed at least four mismatches between each primer and the template which includes at least two bases within the last five base pairs at 30 end of the primers (Ye et al. 2012).
Results In this study, species-specific primers were designed for rapid identification of Trichoderma species. Based upon multiple sequence alignment of Tef1 gene, polymorphic areas (Fig. 1a, b) were identified for designing unique forward primer for T. citrinoviride (Tc_RIF) and T. reesei (Tr_RIF). Conserved region was identified (Fig. 1c) for designing the common reverse primer (T_RIR). PCR with the respective primers gave an amplicon of 153 and 139 bp for T. citrinoviride and T.reesei respectively (Figs. 2 and 3). No cross reactivity of primers was observed with the other representative strain from Longibrachiatum clade (Figs. 2 and 3). The specificity of these primers was further confirmed by sequencing the PCR products and analyzing them online using BLAST program (http://blast.ncbi.nlm. nih.gov/Blast.cgi). The nucleotide sequence of T. citrinoviride and T. reesei PCR products showed 100 % homology to nucleotide sequence in databank. Thus, the amplicon of expected size with the respective primers supported by sequencing data indicates that this strategy can be utilized successfully to characterize these two industrially important strains. Searching for cross reactivity of primers with major taxonomic group of fungi and bacteria using online tool Primer-BLAST offers in silico confirmation for primers specificity (Ye et al. 2012). The primer sets Tc_RIF/T_RIR and Tr_RIF/T_RIR showed homology for PCR amplicon with the expected size from T. citrinoviride and T. reesei respectively. The primer pairs did not show any homology for PCR amplicon from other members of Longibrachiatum clade or from any other fungal taxa (Figs. 4 and 5; Supplemental data 1). Additional in silico analysis indicates that
123
Fig. 2 PCR amplification for cross reactivity of T. citrinoviride primers (Tc_RIF and T_RIR) with 2 representative strains from Longibrachiatum clade. Lane M 100 bp DNA ladder, ThermoScientific; Lane 1 T. citrinoviride as template; Lane 2 T. reesei as template and Lane 3 Negative control—sterile type 1 water used as template
Fig. 3 PCR amplification for cross reactivity of T. reesei primers (Tr_RIF and T_RIR) with 2 representative strains from Longibrachiatum clade. Lane M 100 bp DNA ladder, Thermo Scientific; Lane 1 T. citrinoviride as template; Lane 2 T. reesei as template and Lane 3 Negative control—sterile type 1 water used as template
when the primer pairs were targeted against all fungal and bacterial taxonomic groups, it resulted in amplicon specifically from T. citrinoviride and T. reesei.
Discussion Various strategies have been employed for rapid identification of different fungal strains. Kredics et al. (2009) utilized two different gene sequences ITS and Tef1 for
World J Microbiol Biotechnol
rapid detection of T. pleurotum and T. pleuroticola. Serrano et al. (2011) developed a multiplex PCR based assay for rapid identification of Aspergillus fumigatus. All the above developed methods were designed with the diagnostic perspective and involved two genes for the identification. Species recognition in Trichoderma is usually based on the application of the GCPSR concept (Taylor et al. 2000) based on the partial sequences of the Tef1, endochitinase (chi18-5), calmodulin (cal1) and other loci (Lo´pez-Quintero et al. 2013). In our report, as described in Fig. 1a–c, we have developed a PCR based method using speciesspecific unique primer pair for industrially important strains of T.citrinoviride and T. reesei. The method utilizes whole fungal cells as template for the PCR reactions. Omission of the DNA extraction procedure significantly decreases the time required to make an accurate identification by PCR. The in silico analysis of primer pairs using bioinformatics tools offers added advantage for primer specificity check as described previously by Bellemain et al. (2010). This method can be adopted for limited characterization of the fungus in industry during cell banking and multiple batches of enzyme production. In conclusion, this PCR assay can meet the industry requirement of confirming briefly the strain identity during the production batches. Moreover, the direct use of fungal mycelia unlike genomic DNA utilized by other rapid identification methods put forth this method as rapid and single step identity confirmation. The technique can confirm the identification of the strain during cell banking or production process. This concept can be extended for the identification of other fungal strains by identifying their polymorphic nucleotide sequences. Acknowledgments The authors would like to thank Mr. C. L. Rathi, Mr. P. C. Rathi and Mr. M. M. Kabra, Advanced Enzymes Technologies Limited, Thane (India) for providing the laboratory facilities.
References Bellemain E, Carlsen T, Brochmann C, Coissac E, Taberlet P, Kauserud H (2010) ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases. BMC Microbiol 10:189. doi:10.1186/1471-2180-10-189
Druzhinina IS, Komon´-Zelazowska M, Adnan I, klitsch W, Mullaw T, Gary JS, Christian PK (2012) Molecular phylogeny and species delimitation in the section Longibrachiatum of Trichoderma. Fungal Genet Biol 49:358–368. doi:10.1016/j.fgb.2012.02.004 FDA, Biotechnology Inspection Guide (1991) Biotechnology inspection guide reference materials and training Aids. Division of Field Investigations (HFC-130). http://www.fda.gov/iceci/inspec tions/inspectionguides/ucm074181.htm Gazis R, Rehner S, Chaverri P (2011) Species delimitation in fungal endophyte diversity studies and its implications in ecological and biogeographic inferences. Mol Ecol 20:3001–3013. doi:10.1111/ j.1365-294X.2011.05110.x ICH Harmonised Tripartite Guideline (1997) Derivation and characterization of cell substrates used for production of biotechnological/biological products Q5D. International Conference on Harmonisation, 1–13 Jun H, Kieselbach T, Jonsson LJ (2011) Enzyme production by filamentous fungi: analysis of the secretome of Trichoderma reesei grown on unconventional carbon source. Microb Cell Fact 10:68–77. doi:10.1186/1475-2859-10-68 Kredics L, Kocsube´ S, Nagy L, Komon-Zelazowska L, Manczinger L, Sajben E, Nagy A, Vagyolgyi C, Kubicek C, Druzinina R, Hatwani L (2009) Molecular identification of Trichoderma species associated with Pleurotus ostreatus and natural substrates of the oyster mushroom. FEMS Microbiol Lett 300:58–67. doi:10.1111/j.1574-6968.2009.01765.x Lo´pez-Quintero CA, Atanasova L, Esperanza Franco-Molano A, Gams W, Komon-Zelazowska M, Theelen B, Muller HW, Boekhout T, Druzinina I (2013) DNA barcoding survey of Trichoderma diversity in soil and litter of the Colombian lowland Amazonian rainforest reveals T. strigosellum sp. nov. and other species. Antonie Van Leeuwenhoek 104:657–674. doi:10.1007/s10482-013-9975-4 Serrano R, Gusmao L, Amorim A, Araujo R (2011) Rapid identification of Aspergillus fumigatus within the section Fumigati. BMC Microbiol 11:82. doi:10.1186/1471-2180-11-82 Singhania RR, Sukumaran RK, Patel AK, Larroche C, Pandey A (2010) Advancement and comparative profiles in the production technologies using solid-state and submerged fermentation for microbial cellulases. Enzyme Microb Technol 46:541–549. doi:10.1016/j.enzmictec.2010.03.010 Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 31:21–32. doi:10. 1006/fgbi.2000.1228 Tiwari P, Misra BN, Sangwan NS (2013) b-Glucosidases from the Fungus Trichoderma: an efficient cellulase machinery in Biotechnological applications. BioMed Res Int. doi:10.1155/ 2013/203735 Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform 13:134. doi:10. 1186/1471-2105-13-134
123
