http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, 2015; 26(4): 655–657 ! 2013 Informa UK Ltd. DOI: 10.3109/19401736.2013.843077
MITOGENOME ANNOUNCEMENT
A surprising arrangement pattern and phylogenetic consideration: the complete mitochondrial genome of Belanger’s croaker Johnius belangerii (Percoidei: Sciaenidae)
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/11/15 For personal use only.
Tianjun Xu, Da Tang, and Xiaoxiao Jin Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan, Zhejiang Province, P.R. China Abstract
Keywords
The complete mitochondrial genome of Johnius belangerii has been determined for the first time in this article. It was 19,154 base pairs in length, and is composed of 37 genes (13 proteincoding genes, 22 tRNA genes and 2 ribosomal RNA genes). Totally, 5 notable non-coding regions were observed, and a non-coding of 1091 bp was identified as control region based on its location and AT richness. An 800 bp tandem repeat sequence was identified in the fifth noncoding region. We investigated the mitochondrial gene arrangement pattern and found that that the tRNAVal, 12SrRNA, 16SrRNA and tRNAPhe genes of J. belangerii mitogenome were orderly placed at the beginning of heavy strand. This order is different from other croakers. Combine with the phylogenetic reconstruction and genes arrangement pattern of J. belangerii mitochondrial genome, we consider J. belangerii is the most ancient genus within family Sciaenidae.
Johnius belangerii, mitochondrial genome, phylogenetic tree
Johnius belangerii was first described by Cuvier in 1830, which belongs to the Sciaenidae. This species occurs in Indo-West Pacific, through the East Indies, to China, and inhabits coastal waters and estuaries. In recent years, resources of J. belangerii become reduced due to overfishing and water pollution. Some studies have been related to biological characteristics, ecological aspects and community structure (Xie et al., 2013; Xu et al., 2009). To data, totally 12 mitogenomes have been determined within the family Sciaenidae (Cheng et al., 2010, 2011a,b, 2012a,b; Xu et al., 2011), and in this study, the complete mitogenome of J. belangerii was first determined (GenBank accession number: KF211426). The samples were collected from Zhoushan (Zhejiang Province, China). It is a 19,154-bp circular molecule and is the largest mitogenome found in croaker fishes. The overall base composition of J. belangerii is A 25.0%, C 17.6%, G 20.7% and T 36.8%, with a high A þ T bias of 61.8%. Nine mitochondrial genes (ND6, tRNA-Gln, Ala, Asn, Cys, Tyr, Ser, Glu and Pro) are transcribed from light strand and the remaining encoded on the heavy strand. Five long non-coding regions exist with 199, 205, 1322, 575 and 1091 nucleotides, respectively. Very few reports are available to the surprising rearrangement of mitogenome (Beagley et al., 1998; Davila et al., 2005; Jeyaprakash & Hoy, 2007; Helfenbein et al., 2004;
Correspondence: Dr. Tianjun Xu, Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan, Zhejiang Province 316000, P.R. China. Tel/Fax: +86 580 2550826. E-mail: [email protected]
History Received 18 August 2013 Revised 6 September 2013 Accepted 7 September 2013 Published online 23 October 2013
Papetti et al., 2007), while the gene rearrangement of J. belangerii mitogenome is different from other croakers that always contain 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs and 1 putative control region (Figure 1). For most croaker mitogenomes, the tRNAPhe, 12SrRNA, tRNAVal and 16SrRNA genes are orderly placed at the beginning of heavy strand, but in J. belangerii mitogenome, the first was tRNAVal, followed by 12SrRNA, 16SrRNA and tRNAPhe. In J. belangerii mitogenome, the control region was missing from the usual mitochondrial gene composition, but replaced by a non-coding nucleotide fragment (the non-coding-5, A þ T ¼ 81.0%) between tRNAPro and tRNAVal. Due to the location and AT-richness of this large non-coding region, we tend to consider it as the control region, which in the similar case of Cherax destructor and Shinkaia crosnieri (Miller et al., 2004; Yang & Yang, 2008). In the non-coding-5, a short nucleotide fragment (TAATAGCTTGTAATTATAAA) repeated for 40 times. However, the homology between the non-coding regions and other croaker control regions is low. To clear the phylogenetic position J. belangerii within family Sciaenidae, phylogenetic trees were produced by the Neighbor Joining (Tamura et al., 2011), Maximum likelihood (Stamatakis, 2006) and partitioned Bayesian (Ronquist & Huelsenbeck, 2003) using concatenated mitochondrial DNA data excepted control region genes. Phylogenetic reconstructions revealed that J. belangerii was the sister taxon to all remaining croakers, and placed at the basal of this family. Therefore, J. belangerii should be considered as the most ancient genus. Furthermore, the unexpectedly short branch length of J. belangerii and its novel genes arrangement indicated that the evolutionary retardation is potentially evident for this croaker species (reviewed in Yang & Yang, 2008).
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/11/15 For personal use only.
656
T. Xu et al.
Mitochondrial DNA, 2015; 26(4): 655–657
Figure 1. The phylogenetic relationships and mitochondrial arrangement patterns. (a) As a representation of the tree topologies, the partition Bayesian tree is shown, numbers represent support values. (b) Mitochondrial genes are ordinal highlight with colors (filled boxes), whereas single capital letter represents corresponding tRNA gene, atp6, 8 (ATPase subunits 6, 8), cox1-3 (cytochrome c oxidase subunits 1, 2, 3), nd1-6 and nd4L (NADH dehydrogenase subunits 1-6 and 4L), 12S and 16S (small and large subunit rRNAs), CR (control region gene) and non-coding region (N-1,2,3,4,5).
Acknowledgements We thank Prof. Shenglong Zhao for sampling and morphologically identifying.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the article. This study was supported by National Natural Science Foundation of China (31272661) and Zhejiang Provincial Natural Science Foundation (LY13C040001).
References Beagley CT, Okimoto R, Wolstenholme DR. (1998). The mitochondrial genome of the sea anemone Metridium senile (Cnidaria): Introns, a paucity of tRNA genes, and a near-standard genetic code. Genetics 148:1091–8. Cheng YZ, Wang RX, Xu TJ. (2011a). The mitochondrial genome of the spinyhead croaker Collichthys lucida: Genome organization and phylogenetic consideration. Mar Genom 4:17–23. Cheng YZ, Xu TJ, Jin XX, Shi G, Wang RX. (2011b). Complete mitochondrial genome of the yellow drum Nibea albiflora (Perciformes, Sciaenidae). Mitochondrial DNA 22:80–2. Cheng YZ, Shi G, Xu TJ, Li H, Sun YN, Wang RX. (2012a). Complete mitochondrial genome of the red drum, Sciaenops ocellatus (Perciformes, Sciaenidae): Absence of the typical conserved motif in the origin of the light-strand replication. Mitochondrial DNA 23: 126–8.
Cheng YZ, Xu TJ, Jin XX, Shi G, Wang RX. (2012b). The complete mitochondrial genome of Silver croaker Argyrosomus argentatus (Perciformes, Sciaenidae): Genome characterization and phylogenetic considerations. Mol Biol 46:200–9. Cheng YZ, Xu TJ, Shi G, Wang RX. (2010). Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciforms, Scienidae) with phylogenetic consideration. Mar Genom 3:201–9. Davila S, Pinero D, Bustos P, Cevallos MA, Davila G. (2005). The mitochondrial genome sequence of the scorpion Centruroides limpidus (Karsch 1879) (Chelicerata; Arachnida). Gene 360:92–102. Helfenbein KG, Fourcade HM, Vanjani RG, Boore JL. (2004). The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister group to protostomes. Proc Natl Acad Sci USA 101:10639–43. Jeyaprakash A, Hoy MA. (2007). The mitochondrial genome of the predatory mite Metaseiulus occidentalis (Arthropoda: Chelicerata: Acari: Phytoseiidae) is unexpectedly large and contains several novel features. Gene 391:264–74. Miller AD, Nguyen TT, Burridge CP, Austin CM. (2004). Complete mitochondrial DNA sequence of the Australian freshwater crayfish, Cherax destructor (Crustacea: Decapoda: Parastacidae): A novel gene order revealed. Gene 331:65–72. Papetti C, Lio P, Ruber L, Patarnello T, Zardoya R. (2007). Antarctic fish mitochondrial genomes lack ND6 gene. J Mol Evol 65:519–28. Ronquist F, Huelsenbeck JP. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–4.
DOI: 10.3109/19401736.2013.843077
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/11/15 For personal use only.
Stamatakis A. (2006). RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688–90. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using likelihood, distance, and parsimony methods. Mol Biol Evol 28:2731–9. Xie Zi, Liu X, Guo Y, Liu C. (2013). Genetic diversity analysis of Beibu Gulf Johnius belengerii. J Southern Agricul 44:140–4. Xu GB, Shao CW, Liao XL, Tian YS, Chen SL. (2009). Isolation and characterization of 12 dinucleotide microsatelliteloci from
Mitochondrial genome of J. belangerii
657
Belenger’s jewfish (Johnius belengerii Cuvier 1830). Conserv Genet 10:1009–11. Xu TJ, Cheng YZ, Sun YN, Shi G, Wang RX. (2011). The complete mitochondrial genome of bighead croaker, Collichthys niveatus (Perciformes, Sciaenidae): Structure of control region and phylogenetic considerations. Mol Biol Rep 38:4673–85. Yang JS, Yang WJ. (2008). The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura): A novel arrangement and incomplete tRNA suite. BMC Genomics 9:257.
MITOGENOME ANNOUNCEMENT
A surprising arrangement pattern and phylogenetic consideration: the complete mitochondrial genome of Belanger’s croaker Johnius belangerii (Percoidei: Sciaenidae)
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/11/15 For personal use only.
Tianjun Xu, Da Tang, and Xiaoxiao Jin Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan, Zhejiang Province, P.R. China Abstract
Keywords
The complete mitochondrial genome of Johnius belangerii has been determined for the first time in this article. It was 19,154 base pairs in length, and is composed of 37 genes (13 proteincoding genes, 22 tRNA genes and 2 ribosomal RNA genes). Totally, 5 notable non-coding regions were observed, and a non-coding of 1091 bp was identified as control region based on its location and AT richness. An 800 bp tandem repeat sequence was identified in the fifth noncoding region. We investigated the mitochondrial gene arrangement pattern and found that that the tRNAVal, 12SrRNA, 16SrRNA and tRNAPhe genes of J. belangerii mitogenome were orderly placed at the beginning of heavy strand. This order is different from other croakers. Combine with the phylogenetic reconstruction and genes arrangement pattern of J. belangerii mitochondrial genome, we consider J. belangerii is the most ancient genus within family Sciaenidae.
Johnius belangerii, mitochondrial genome, phylogenetic tree
Johnius belangerii was first described by Cuvier in 1830, which belongs to the Sciaenidae. This species occurs in Indo-West Pacific, through the East Indies, to China, and inhabits coastal waters and estuaries. In recent years, resources of J. belangerii become reduced due to overfishing and water pollution. Some studies have been related to biological characteristics, ecological aspects and community structure (Xie et al., 2013; Xu et al., 2009). To data, totally 12 mitogenomes have been determined within the family Sciaenidae (Cheng et al., 2010, 2011a,b, 2012a,b; Xu et al., 2011), and in this study, the complete mitogenome of J. belangerii was first determined (GenBank accession number: KF211426). The samples were collected from Zhoushan (Zhejiang Province, China). It is a 19,154-bp circular molecule and is the largest mitogenome found in croaker fishes. The overall base composition of J. belangerii is A 25.0%, C 17.6%, G 20.7% and T 36.8%, with a high A þ T bias of 61.8%. Nine mitochondrial genes (ND6, tRNA-Gln, Ala, Asn, Cys, Tyr, Ser, Glu and Pro) are transcribed from light strand and the remaining encoded on the heavy strand. Five long non-coding regions exist with 199, 205, 1322, 575 and 1091 nucleotides, respectively. Very few reports are available to the surprising rearrangement of mitogenome (Beagley et al., 1998; Davila et al., 2005; Jeyaprakash & Hoy, 2007; Helfenbein et al., 2004;
Correspondence: Dr. Tianjun Xu, Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan, Zhejiang Province 316000, P.R. China. Tel/Fax: +86 580 2550826. E-mail: [email protected]
History Received 18 August 2013 Revised 6 September 2013 Accepted 7 September 2013 Published online 23 October 2013
Papetti et al., 2007), while the gene rearrangement of J. belangerii mitogenome is different from other croakers that always contain 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs and 1 putative control region (Figure 1). For most croaker mitogenomes, the tRNAPhe, 12SrRNA, tRNAVal and 16SrRNA genes are orderly placed at the beginning of heavy strand, but in J. belangerii mitogenome, the first was tRNAVal, followed by 12SrRNA, 16SrRNA and tRNAPhe. In J. belangerii mitogenome, the control region was missing from the usual mitochondrial gene composition, but replaced by a non-coding nucleotide fragment (the non-coding-5, A þ T ¼ 81.0%) between tRNAPro and tRNAVal. Due to the location and AT-richness of this large non-coding region, we tend to consider it as the control region, which in the similar case of Cherax destructor and Shinkaia crosnieri (Miller et al., 2004; Yang & Yang, 2008). In the non-coding-5, a short nucleotide fragment (TAATAGCTTGTAATTATAAA) repeated for 40 times. However, the homology between the non-coding regions and other croaker control regions is low. To clear the phylogenetic position J. belangerii within family Sciaenidae, phylogenetic trees were produced by the Neighbor Joining (Tamura et al., 2011), Maximum likelihood (Stamatakis, 2006) and partitioned Bayesian (Ronquist & Huelsenbeck, 2003) using concatenated mitochondrial DNA data excepted control region genes. Phylogenetic reconstructions revealed that J. belangerii was the sister taxon to all remaining croakers, and placed at the basal of this family. Therefore, J. belangerii should be considered as the most ancient genus. Furthermore, the unexpectedly short branch length of J. belangerii and its novel genes arrangement indicated that the evolutionary retardation is potentially evident for this croaker species (reviewed in Yang & Yang, 2008).
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/11/15 For personal use only.
656
T. Xu et al.
Mitochondrial DNA, 2015; 26(4): 655–657
Figure 1. The phylogenetic relationships and mitochondrial arrangement patterns. (a) As a representation of the tree topologies, the partition Bayesian tree is shown, numbers represent support values. (b) Mitochondrial genes are ordinal highlight with colors (filled boxes), whereas single capital letter represents corresponding tRNA gene, atp6, 8 (ATPase subunits 6, 8), cox1-3 (cytochrome c oxidase subunits 1, 2, 3), nd1-6 and nd4L (NADH dehydrogenase subunits 1-6 and 4L), 12S and 16S (small and large subunit rRNAs), CR (control region gene) and non-coding region (N-1,2,3,4,5).
Acknowledgements We thank Prof. Shenglong Zhao for sampling and morphologically identifying.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the article. This study was supported by National Natural Science Foundation of China (31272661) and Zhejiang Provincial Natural Science Foundation (LY13C040001).
References Beagley CT, Okimoto R, Wolstenholme DR. (1998). The mitochondrial genome of the sea anemone Metridium senile (Cnidaria): Introns, a paucity of tRNA genes, and a near-standard genetic code. Genetics 148:1091–8. Cheng YZ, Wang RX, Xu TJ. (2011a). The mitochondrial genome of the spinyhead croaker Collichthys lucida: Genome organization and phylogenetic consideration. Mar Genom 4:17–23. Cheng YZ, Xu TJ, Jin XX, Shi G, Wang RX. (2011b). Complete mitochondrial genome of the yellow drum Nibea albiflora (Perciformes, Sciaenidae). Mitochondrial DNA 22:80–2. Cheng YZ, Shi G, Xu TJ, Li H, Sun YN, Wang RX. (2012a). Complete mitochondrial genome of the red drum, Sciaenops ocellatus (Perciformes, Sciaenidae): Absence of the typical conserved motif in the origin of the light-strand replication. Mitochondrial DNA 23: 126–8.
Cheng YZ, Xu TJ, Jin XX, Shi G, Wang RX. (2012b). The complete mitochondrial genome of Silver croaker Argyrosomus argentatus (Perciformes, Sciaenidae): Genome characterization and phylogenetic considerations. Mol Biol 46:200–9. Cheng YZ, Xu TJ, Shi G, Wang RX. (2010). Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciforms, Scienidae) with phylogenetic consideration. Mar Genom 3:201–9. Davila S, Pinero D, Bustos P, Cevallos MA, Davila G. (2005). The mitochondrial genome sequence of the scorpion Centruroides limpidus (Karsch 1879) (Chelicerata; Arachnida). Gene 360:92–102. Helfenbein KG, Fourcade HM, Vanjani RG, Boore JL. (2004). The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister group to protostomes. Proc Natl Acad Sci USA 101:10639–43. Jeyaprakash A, Hoy MA. (2007). The mitochondrial genome of the predatory mite Metaseiulus occidentalis (Arthropoda: Chelicerata: Acari: Phytoseiidae) is unexpectedly large and contains several novel features. Gene 391:264–74. Miller AD, Nguyen TT, Burridge CP, Austin CM. (2004). Complete mitochondrial DNA sequence of the Australian freshwater crayfish, Cherax destructor (Crustacea: Decapoda: Parastacidae): A novel gene order revealed. Gene 331:65–72. Papetti C, Lio P, Ruber L, Patarnello T, Zardoya R. (2007). Antarctic fish mitochondrial genomes lack ND6 gene. J Mol Evol 65:519–28. Ronquist F, Huelsenbeck JP. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–4.
DOI: 10.3109/19401736.2013.843077
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/11/15 For personal use only.
Stamatakis A. (2006). RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688–90. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using likelihood, distance, and parsimony methods. Mol Biol Evol 28:2731–9. Xie Zi, Liu X, Guo Y, Liu C. (2013). Genetic diversity analysis of Beibu Gulf Johnius belengerii. J Southern Agricul 44:140–4. Xu GB, Shao CW, Liao XL, Tian YS, Chen SL. (2009). Isolation and characterization of 12 dinucleotide microsatelliteloci from
Mitochondrial genome of J. belangerii
657
Belenger’s jewfish (Johnius belengerii Cuvier 1830). Conserv Genet 10:1009–11. Xu TJ, Cheng YZ, Sun YN, Shi G, Wang RX. (2011). The complete mitochondrial genome of bighead croaker, Collichthys niveatus (Perciformes, Sciaenidae): Structure of control region and phylogenetic considerations. Mol Biol Rep 38:4673–85. Yang JS, Yang WJ. (2008). The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura): A novel arrangement and incomplete tRNA suite. BMC Genomics 9:257.
