This article was downloaded by: [UZH Hauptbibliothek / Zentralbibliothek Zürich] On: 23 December 2014, At: 09:09 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
Association of IL8 -105G/A with Mastitis Somatic Cell Score in Chinese Holstein Dairy Cows a
b
c
a
c
Renjin Chen , Zhenzhen Wang , Zhangping Yang , Xiaorong Zhu , Dejun Ji & Yongjiang Mao
c
a
Laboratory Animal Center , Xuzhou Medical College , Xuzhou , Jiangsu , China
b
Research Center for Neurobiology , Xuzhou Medical College , Xuzhou , Jiangsu , China
c
Animal Science and Technology College , Yangzhou University , Yangzhou , Jiangsu , China Published online: 07 Nov 2014.
Click for updates To cite this article: Renjin Chen , Zhenzhen Wang , Zhangping Yang , Xiaorong Zhu , Dejun Ji & Yongjiang Mao (2015) Association of IL8 -105G/A with Mastitis Somatic Cell Score in Chinese Holstein Dairy Cows, Animal Biotechnology, 26:2, 143-147, DOI: 10.1080/10495398.2014.939657 To link to this article: http://dx.doi.org/10.1080/10495398.2014.939657
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Animal Biotechnology, 0:143–147, 2015 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2014.939657
Association of IL8 -105G/A with Mastitis Somatic Cell Score in Chinese Holstein Dairy Cows Renjin Chen,1 Zhenzhen Wang,2 Zhangping Yang,3 Xiaorong Zhu,1 Dejun Ji,3 and Yongjiang Mao3 1
Laboratory Animal Center, Xuzhou Medical College, Xuzhou, Jiangsu, China Research Center for Neurobiology, Xuzhou Medical College, Xuzhou, Jiangsu, China 3 Animal Science and Technology College, Yangzhou University, Yangzhou, Jiangsu, China
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
2
The single nucleotide polymorphisms (SNPs) in the 50 upstream of bovine IL8 gene were investigated in 810 Chinese Holstein cows from 35 bull families in a dairy farm in Shanghai using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) technique. The Real-time PCR and Western blot were used to detect the mRNA and protein levels of genotype Chinese Holstein dairy cows. The results showed that one SNP -105G>A was detected, designating three genotypes (GG, GA and AA) with respective frequencies of 0.38, 0.46, and 0.16. The significant association of the SNP -105G>A with somatic cell score (SCS) was identified. Genotype GG had a significantly lower SCS than genotype GA or AA (P < 0.01), and the relative mRNA expression and protein level of GG was found to be the highest. These results suggest that the genotype GG may be a useful genetic marker for mastitis resistance selection and breeding in Chinese Holstein dairy cows. Keywords
Chinese holstein; Interleukin 8; Mastitis; Polymorphism; Somatic cell score
Mastitis is the most frequently occurring and expensive disease in the dairy industry worldwide (1). It leads to extensive economic losses in the dairy industry (2). The methods currently being used to control the complex disease include improving the environment of dairy cows, vaccines, using dry-cow antibiotic therapy, and Chinese herbal medicine (3). Using somatic cell score (SCS) traits as indicators of resistance to mastitis has been widely practiced (4). SCS was converted from somatic cell count (SCC) to eliminate the effect of the lactation days and the period of sampling. This strategy is effective because of the strong positive genetic correlation between clinical mastitis and SCS (5). Interleukin 8 (IL8) plays an important role in inflammation reaction. Transcription of the gene coding for IL8 is influenced by IL2, IL6, IL10, and IFN-c factors, and regulatory region of IL8 gene is situated between 607 and 40 sites (6). The mRNA concentration of IL8 increased rapidly in mammary epithelial cells and mammary tissue in response to E. coli challenge (7, 8). Whelehan et al. researched that IL8 expression was enhanced in response to experimental infection with Staphylococcus aureus in mammary tissue (9). The genetic associations between polymorphism in the promoter region of the human IL8 gene and disease have been demonstrated (10, 11). Address correspondence to Zhangping Yang, Animal Science and Technology College, Yangzhou University, Yangzhou, Jiangsu 225009, China. E-mail: [email protected]
Donofrio et al. showed that a 136 bp region of the bovine IL8 promoter contains critical response elements for the immune response against viral antigens (12). The genetic diversity of 5’ flanking region of IL8 gene has seldom been reported in bovine. The 25 polymorphic positions have only recently been detected in the IL8 gene promoter in 30 Norwegian Red and 30 Holstein-Friesian cattle (13). In the present work, we investigated the association between the polymorphism of the 5’ flanking region of IL8 gene and SCS, as well measured the relative mRNA and protein expression levels of IL8 gene in blood of different genotypes. The study will find the association between SNPs of IL8 gene and somatic cell score (SCS) in Chinese Holstein dairy cows.
MATERIALS AND METHODS Animals and Traits All animals used for this study were in accordance with ethical guidelines of Xuzhou Medical College. The 810 Chinese Holstein were collected from Holstein offspring of 35 bulls, which belong to one Chinese Holstein cattle farm. Data included 35 sire families with 3 to 39 daughters per sire. These cows have integrated production data from 2008 to 2010. The blood samples were collected for extracting DNA. The fresh blood of 30 Holstein offspring (10 offspring from each genotype) were collected for extracting RNA and protein. Phenotypic data comprised
143
144
R. CHEN ET AL.
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
8956 test-day records from in total 1186 lactations (1 to 5) of 810 cows. Mixed milk (morning:noon:night ¼ 4:3:3) samples were collected monthly from June 2008 to May 2010. Milk samples were treated with potassium bichromate (30 mg=tube) immediately after milking, and samples of fresh milk were analyzed for SCC by flow cytometry. The SCC converted into the SCS (14) (SCC=100000) þ 3), and was rectified to eliminate the effect of lactation days and period of sampling on SCS (15), 305 d milk yield were estimated between 1000–18000 kg from the DHI report. SNP Genotyping Genomic DNA was extracted with phenol chloroform protocol as described by Mullenbach et al. (16). The primer (Table 1) was designed according to the sequences of the IL8 (AY627308) on GenBank by software primer 5.0. The polymorphism of IL8 was detected by method of polymerase chain reaction-Single strand Conformation polymorphism (PCR-SSCP). A total of 2.0 mL PCR product was mixed with 8 mL of the denaturation solution (50 mmol=L NaOH, 1 mmol=L EDTA), and 1 mL of the loading buffer containing 0.25% bromophenol blue and 0.25% xylene cyannol, denatured for 10 min at 98 C, and rapidly chilled in 20 C. The samples were then electrophoresed in 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). A thermostatically controlled refrigerated circulator was used to maintain constant temperature (4 C) of the gels. The gels were run in the following conditions: 250 V, 40 mA, 10 min (preelectrophoresis) and 150 V, 24 mA, for 8 h. The gels were then stained by Silver Stain (Kucharczyk Techniki Elektroforetyczne). The patterns of DNA bands were observed and photographed with the GDS7500 System (UVP). After the polymorphism was detected, 4 samples of each type of band were sequenced and analyzed. Detection of IL8 Gene Expression by Real-time PCR Total RNA extraction was performed from the fresh blood using TRIZOL (TaKaRa, CA) according to the manufacturer’s instructions. The residual genomic DNA was removed by an on-column DNAse digestion with RNAse-free DNAse (Invitrogene) according to the
manufacturer recommendations. The RNA concentration was quantified spectrophotometrically at 260 nm with A260=A280 ratios between 1.8 and 1.9, indicating pure and clean RNA isolates, and the RNA integrity was checked by agarose gel (2%) electrophoresis to ensure that RNA was intact. The primers (Table 1) were designed according to the sequences of the IL8 (NM_173925) and GAPDH (NM_001034034) genes on GenBank by software primer 5.0. The mRNA amount of each genotype was measured by Real time-PCR. A typical 20 mL system included 10 mL 2 SYBRGreenI Master mix (Brilliant SYBR Green QPCR master mix), 0.8 mL forward and reverse primers (100 nM), 0.4 mL ROX Reference Dye, 2 mL cDNA, and 6 mL water. The LightCycler was programmed in 4 steps: (1) denaturation at 95 C for 30 s; (2) amplification for 40 cycles of denaturation at 95 C for 5 s, annealing at 60 C for 34 s; (3) melting curve by 95 C for 15 s, 60 C for 1 min, and 95 C for 15 s; and (4) cooling at 40 C. In each reaction, the cycle number at which the fluorescence rises appreciably above the background fluorescence is determined as a crossing point (CP). Western Blot Analysis Serum of different genotype cows was rapidly separated. Protein was extracted according to the improved Lowry et al. method (17). Proteins (30–50 mg protein=lane) were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked for 0.5 h with 5% BSA-0.1% Tween 20, membranes were incubated with primary antibody: IL8 mouse monoclonal, 1:1000 (Abcam), GAPDH: cow monoclonal, 1:1,000 (Santa Cruz Biotechnology Inc., Santa Cruz, CA), with GAPDH used as the loading control. After being washed in buffer, the membranes were incubated with appropriate horseradish peroxidase-conjugated secondary antibodies (IL8: antimouse, 1:100, GAPDH: anti-mouse, 1:100, all from Gene Company Ltd., Hong Kong) for 2 h at room temperature (RT), after being washed in buffer, Western blot analysis was performed using odyssey for the signal detection. Signal intensities were quantified by densitometry using Image J software.
TABLE 1 Sequence of primers of bovine IL8 and GAPDH genes in PCR and real-time PCR Gene IL8(DNA) IL8 (cDNA) GAPDH (cDNA)
Sequence (50 30 )
Length
Localization
F:CAGATGACTCAGATGTGC R:AGGAAAAGCTGCCAAGAG F:CACTGTGAAAATTCAGAAATCATTGTTA R:CTTCACAAATACCTGCACAACCTTC F: CCCGTTCGACAGATAGCC R:CTGTGCCGTTGAACTTGC
250 bp
19278
AY627308
105 bp
250335
NM_173925
229 bp
16245
NM_001034034
Accession
MASTITIS SOMATIC CELL SCORE IN CHINESE HOLSTEIN COWS
Statistical Analysis The frequencies of alleles and genotypes were analyzed by POPGENE software (ver.1.31). The v2-test was utilized to test linkage disequilibrium. All the production data were analyzed with the GLM procedure of SAS (9.0) software. The relation of the IL8 polymorphisms with SCS were analyzed by general linear model:
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
y ¼ l þ genotypei þ e where Y ¼ individuality trait phenotypic value, m ¼ overall mean, genotypei ¼ the fixed effect of genotype, and e ¼ the the random residual effect. Gene expression and protein values were shown as means SE. Statistical significance in the parameter values among the different genotype was tested by ANOVA procedure, the treatment means were separated by Duncan’s multiple range test, and accepted if p < 0.05. The raw realtime PCR values (Ct) had to be processed by comparative Ct (DCt) method to obtain gene expression levels. The fold change of expression of the genes normalized against IL8 mRNA levels from different bloods were calculated with 2DCt (18, 19), where DCt ¼ Ct (IL8)-Ct (GAPDH). RESULTS PCR-SSCP results showed that the bovine IL8 gene had three types of SSCP bands, and sequences of these three genotypes were compared with the referenced sequence (AY627308) in GenBank, one nucleotide variation was found at 105G>A site in the 5’flanking region of bovine IL8 gene and, consequently, three different bands (AA, AG, and GG genotypes) were designated, respectively. The genotypic and allelic frequencies of the SNP (105G>A) were shown in Table 2. The frequency of G (0.61) allele was higher than A allele (0.39). The v2 test showed that the population deviated from Hardy-Weinberg equilibrium. The results showed the genotype altered SCS with an decrease in SCS for GG but not AG or AA (Table 3), the cows with GG genotype had lower SCS than those with AA and AG genotypes (P < 0.01); whereas, the genotype did not affect the 305d milk yield. The real-time PCR technique was used to detect the level of mRNA on different genotypes. Melting (Dissociation)
145
TABLE 3 Genotypic effect of SNP-105G>A of the 5’ flanking region of IL8 gene on SCS and 305 d corrected milk yield Genotype GG AG AA p-value
Number 308 372 130
Somatic cell score (SCS)
305 d corrected milk yield
4.032 0.079a 4.590 0.073b 4.27 0.112b 0.0084
6982.9 2643.3 7168.7 2232.2 6893.3 2308.7 0.066
Note: Small letters mean values in the same column with different superscripts significantly differ at P < 0.01, P < 0.01.
FIG. 1.
Relative variation of IL8 gene mRNA expression of three genotypes at -105G>A site in Chinese Holstein dairy cows, n ¼ 10=genotype; p < 0.05 for GG versus AA or AG.
TABLE 2 Polymorphic information of SNP-105G>A of the 5’ flanking region of IL8 gene in Chinese Holstein dairy cows Number
Genotype frequency
810
GG 0.38
GA 0.46
AA 0.16
Allele frequency G 0.61
A 0.39
v2 57.37
FIG. 2. IL8 protein expression of three genotypes was measured by Western blot and normalized to GAPDH. n ¼ 10=genotype; p < 0.05 for AA versus AG; # p < 0.05 for GG versus AA or AG.
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
146
R. CHEN ET AL.
curves of a typical PCR run where only a specific product was amplified. Dissociation temperature of GAPDH and IL8 was 60 C and 60 C, respectively. In this study, melting curves of the two genes had a single melt-curve peak which showed better DNA quantitative detection with real-time PCR. Melting curve analysis and relative quantification of IL8 indicated that mRNA level of GG was significantly higher than AA and AG (P < 0.05) (Fig. 1). A significant increase of the content of IL8 was observed in GG genotype compared to AA and AG genotypes (P < 0.05), whereas the content of IL8 was significantly higher in AA genotype than that in AG genotype (P < 0.05) (Fig. 2).
ACKNOWLEDGMENT Renjin Chen and Zhenzhen Wang contributed equally to this work. FUNDING The National Natural Science Foundation of China (31172171, 31272407, and 31372286), the Natural Science Foundation for Youth in Jiangsu Province (BK2012138), the President Foundation of Xuzhou Medical College (2012KJZ20), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). REFERENCES
DISCUSSION Some studies reported that a sequence variation from 1 to 133 within the 5’flanking region of the human IL8 gene may modify the transcriptional regulation (20, 21). Some binding sites were associated with activating protein-1 (AP-1) transcription factor and regulated the expression of NF-jB family of transcription factors in coding region of the human IL8 gene (22, 23). The same mechanism may occur in bovine IL8, activity of IL8 promoter was stimulated by bovine herpes virus 4 in bovine endometrial stromal cells and IL8 protein secretion (12). Two distinct promoter haplotypes of IL8 promoter demonstrated significant differential activation profiles in response to LPS and TNFa (13). In this study, we detected one SNP -105G>A in the 5’flanking region of the bovine IL8 gene. The SNPs (-105G>A) located in the region of IL8 gene promoter, which some regulatory element overlapped partially with the NF-jB binding site element (24). Meade et al. (13) predicted that the ‘‘A’’ allele of this SNP creates two binding sites for the transcription factor Oct-1. And, the Oct-1 transcriptional repressor could repress the IL8 expression (25, 26). Our results indicated that the SNP-105G>A altered SCS (P < 0.01), GG genotype had lower SCS than those with AA and AG genotypes and protein and mRNA level of GG was significantly higher than AA and AG (P < 0.05). The ‘‘G’’ allele was substituted by the ‘‘A’’ allele leading to the expression decrease of IL8; therefore, our results validated Meade’s prediction (13). The allele frequencies of 0.61 for ‘‘G’’ allele and 0.39 for ‘‘A’’ allele. ‘‘A’’ allele was the recessive gene in natural and artificial selection, and the ‘‘G’’ allele was the advantageous. In summary, the mutation on -105G>A site led to the variation of IL8 expression, and the genotype altered SCS. The polymorphic site (-105G>A) of IL8 gene may be a useful genetic marker for production and mastitis resistance selection and breeding in Chinese Holstein. However, the mechanism of the gene needs further study.
1. Sordillo LM, Streicher KL. Mammary gland immunity and mastitis susceptibility. J Mammary Gland Biol Neoplasia 2002; 7(2):135–146. 2. Nash DL, Rogers GW, Cooper JB, Hargrove GL, Keown JF. Heritability of intramammary infections at first parturition and relationships with sire transmitting abilities for somatic cell score, udder type traits, productive life, and protein yield. J Dairy Sci 2003; 86:2684–2695. 3. Hwang CY, Pak SI, Han HR. Effects of autogenous toxoid-bacterin in lactating cows with Staphylococcus aureus subclinical mastitis. J Vet Med Sci 2000; 62(8):875–880. 4. Shook GE. Major advances in determining appropriate selection goals. J Dairy Sci 2006; 89:1349–1361. 5. Rupp R, Boichard D. Genetic parameters for clinical mastitis, somatic cell score, production, udder type and milking easy in first lactation Holsteins. J Dairy Sci 1999; 82:2198–2204. 6. Mukaida N, Morita M, Ishikawa Y, et al. Novel mechanism of glucocorticoid-mediated gene repression: Nuclear factorjB is target for glucocorticoid-mediated interleukin 8 gene repression. J Biol Chem 1994; 269:13289–13295. 7. Gu¨nther J, Liu S, Esch K, Schuberth HJ, Seyfert HM. Stimulated expression of TNF-a and IL-8, but not of lingual antimicrobial peptide reflects the concentration of pathogens contacting bovine mammary epithelial cells. Vet Immunol Immunopathol 2010; 135:152–157. 8. Gu¨nther J, Koczan D, Yang W, et al. Assessment of the immune capacity of mammary epithelial cells: comparison with mammary tissue after challenge with Escherichia coli. Vet Res 2009; 40:31. 9. Whelehan CJ, Meade KG, Eckersall PD, Young FJ, O’Farrelly C. Experimental Staphylococcus aureus infection of the mammary gland induces region-specific changes in innate immune gene expression. Vet Immunol Immunopathol 2011; 140:181–189. 10. Gao LB, Pan XM, Jia J, et al. IL-8–251A=T polymorphism is associated with decreased cancer risk among populationbased studies: Evidence from a meta-analysis. Eur J Cancer 2010; 46:1333–1343. 11. Ahn MH, Park BL, Lee SH, et al. A promoter SNP rs4073T>A in the common allele of the interleukin 8 gene is associated with the development of idiopathic pulmonary fibrosis via the IL-8 protein enhancing mode. Respir Res 2011; 12:73.
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
MASTITIS SOMATIC CELL SCORE IN CHINESE HOLSTEIN COWS 12. Donofrio G, Capocefalo A, Franceschi V, Price S, Cavirani S, Sheldon IM. The chemokine IL8 is up-regulated in bovine endometrial stromal cells by the BoHV-4 IE2 gene product, ORF50=Rta: a step ahead toward a mechanism for BoHV-4 induced endometritis. Biol Reprod 2010; 8:919–928. 13. Meade KG, O’Gorman GM, Narciandi F, Machugh DE, O’Farrelly C. Functional characterisation of bovine interleukin 8 promoter haplotypes in vitro. Mol Immunol 2012; 150:08–116. 14. Shook GE. Approaches to summarizing somatic cell counts which improve interpretability. Proc Natl Mastitis Council Arlington VA 1982; 150–166. 15. Wiggans GR, Shook GE. A lactation measure of somatic cell count. J Dairy Sci 1987; 70:2666–2672. 16. Mullenbach R, Lagoda PJ, Welter C. An efficient salt-chloroform extraction of DNA from blood and tissue. Trends Genet 1989; 5:391. 17. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with Folin phenol reagent. J Biol Chem 1951; 193:265–275. 18. Houng HH, Hritz D, Kanesa-thasan N. Quantitative detection of dengue 2 virus using fluorogenic RT-PCR based on 3 noncoding sequence. J Virol Meth 2000; 86:1–11. 19. Shaw AE, Reid SM, Ebert K, Hutchings GH, Ferris NP, King DP. Implementation of a one-step real-time RT-PCR protocol for diagnosis of foot-and-mouth disease. J Virol Meth 2007; 143:81–85.
147
20. Harant H, de Martin R, Andrew PJ, Foglar E, Dittrich C, Lindley IJ. Synergistic activation of interleukin-8 gene transcription by all-trans-retinoic acid and tumor necrosis factor-alpha involves the transcription factor NF-kappa B. J Biol Chem 1996; 271:26954–26961. 21. Mukaida N, Okamoto S, Ishikawa Y, Matsushima K. Molecular mechanism of interleukin-8 gene expression. J Leukoc Biol 1994; 56:554–581. 22. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol 2002; 72:847–855. 23. Okamoto S, Mukaida N, Yasumoto K, et al. The interleukin-8 AP-1 and kappa B-like sites are genetic end targets of FK506-sensitive pathway accompanied by calcium mobilization. J Biol Chem 1994; 269:8582–8589. 24. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol 2002; 72:847–855. 25. Bhat R, Weaver JA, Sterling KM, Bresnick E. Bresnick Nuclear transcription factor Oct-1 binds to the 50 -upstream region of CYP1A1 and negatively regulates its expression. Int J Biochem Cell Biol 1996; 28:217–227. 26. Zhang H, Shepherd AT, Eason DD, et al. Retinoblastoma protein expression leads to reduced Oct-1 DNA binding activity and enhances interleukin-8 expression. Cell Growth Differ 1999; 10:457–465.
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
Association of IL8 -105G/A with Mastitis Somatic Cell Score in Chinese Holstein Dairy Cows a
b
c
a
c
Renjin Chen , Zhenzhen Wang , Zhangping Yang , Xiaorong Zhu , Dejun Ji & Yongjiang Mao
c
a
Laboratory Animal Center , Xuzhou Medical College , Xuzhou , Jiangsu , China
b
Research Center for Neurobiology , Xuzhou Medical College , Xuzhou , Jiangsu , China
c
Animal Science and Technology College , Yangzhou University , Yangzhou , Jiangsu , China Published online: 07 Nov 2014.
Click for updates To cite this article: Renjin Chen , Zhenzhen Wang , Zhangping Yang , Xiaorong Zhu , Dejun Ji & Yongjiang Mao (2015) Association of IL8 -105G/A with Mastitis Somatic Cell Score in Chinese Holstein Dairy Cows, Animal Biotechnology, 26:2, 143-147, DOI: 10.1080/10495398.2014.939657 To link to this article: http://dx.doi.org/10.1080/10495398.2014.939657
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Animal Biotechnology, 0:143–147, 2015 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2014.939657
Association of IL8 -105G/A with Mastitis Somatic Cell Score in Chinese Holstein Dairy Cows Renjin Chen,1 Zhenzhen Wang,2 Zhangping Yang,3 Xiaorong Zhu,1 Dejun Ji,3 and Yongjiang Mao3 1
Laboratory Animal Center, Xuzhou Medical College, Xuzhou, Jiangsu, China Research Center for Neurobiology, Xuzhou Medical College, Xuzhou, Jiangsu, China 3 Animal Science and Technology College, Yangzhou University, Yangzhou, Jiangsu, China
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
2
The single nucleotide polymorphisms (SNPs) in the 50 upstream of bovine IL8 gene were investigated in 810 Chinese Holstein cows from 35 bull families in a dairy farm in Shanghai using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) technique. The Real-time PCR and Western blot were used to detect the mRNA and protein levels of genotype Chinese Holstein dairy cows. The results showed that one SNP -105G>A was detected, designating three genotypes (GG, GA and AA) with respective frequencies of 0.38, 0.46, and 0.16. The significant association of the SNP -105G>A with somatic cell score (SCS) was identified. Genotype GG had a significantly lower SCS than genotype GA or AA (P < 0.01), and the relative mRNA expression and protein level of GG was found to be the highest. These results suggest that the genotype GG may be a useful genetic marker for mastitis resistance selection and breeding in Chinese Holstein dairy cows. Keywords
Chinese holstein; Interleukin 8; Mastitis; Polymorphism; Somatic cell score
Mastitis is the most frequently occurring and expensive disease in the dairy industry worldwide (1). It leads to extensive economic losses in the dairy industry (2). The methods currently being used to control the complex disease include improving the environment of dairy cows, vaccines, using dry-cow antibiotic therapy, and Chinese herbal medicine (3). Using somatic cell score (SCS) traits as indicators of resistance to mastitis has been widely practiced (4). SCS was converted from somatic cell count (SCC) to eliminate the effect of the lactation days and the period of sampling. This strategy is effective because of the strong positive genetic correlation between clinical mastitis and SCS (5). Interleukin 8 (IL8) plays an important role in inflammation reaction. Transcription of the gene coding for IL8 is influenced by IL2, IL6, IL10, and IFN-c factors, and regulatory region of IL8 gene is situated between 607 and 40 sites (6). The mRNA concentration of IL8 increased rapidly in mammary epithelial cells and mammary tissue in response to E. coli challenge (7, 8). Whelehan et al. researched that IL8 expression was enhanced in response to experimental infection with Staphylococcus aureus in mammary tissue (9). The genetic associations between polymorphism in the promoter region of the human IL8 gene and disease have been demonstrated (10, 11). Address correspondence to Zhangping Yang, Animal Science and Technology College, Yangzhou University, Yangzhou, Jiangsu 225009, China. E-mail: [email protected]
Donofrio et al. showed that a 136 bp region of the bovine IL8 promoter contains critical response elements for the immune response against viral antigens (12). The genetic diversity of 5’ flanking region of IL8 gene has seldom been reported in bovine. The 25 polymorphic positions have only recently been detected in the IL8 gene promoter in 30 Norwegian Red and 30 Holstein-Friesian cattle (13). In the present work, we investigated the association between the polymorphism of the 5’ flanking region of IL8 gene and SCS, as well measured the relative mRNA and protein expression levels of IL8 gene in blood of different genotypes. The study will find the association between SNPs of IL8 gene and somatic cell score (SCS) in Chinese Holstein dairy cows.
MATERIALS AND METHODS Animals and Traits All animals used for this study were in accordance with ethical guidelines of Xuzhou Medical College. The 810 Chinese Holstein were collected from Holstein offspring of 35 bulls, which belong to one Chinese Holstein cattle farm. Data included 35 sire families with 3 to 39 daughters per sire. These cows have integrated production data from 2008 to 2010. The blood samples were collected for extracting DNA. The fresh blood of 30 Holstein offspring (10 offspring from each genotype) were collected for extracting RNA and protein. Phenotypic data comprised
143
144
R. CHEN ET AL.
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
8956 test-day records from in total 1186 lactations (1 to 5) of 810 cows. Mixed milk (morning:noon:night ¼ 4:3:3) samples were collected monthly from June 2008 to May 2010. Milk samples were treated with potassium bichromate (30 mg=tube) immediately after milking, and samples of fresh milk were analyzed for SCC by flow cytometry. The SCC converted into the SCS (14) (SCC=100000) þ 3), and was rectified to eliminate the effect of lactation days and period of sampling on SCS (15), 305 d milk yield were estimated between 1000–18000 kg from the DHI report. SNP Genotyping Genomic DNA was extracted with phenol chloroform protocol as described by Mullenbach et al. (16). The primer (Table 1) was designed according to the sequences of the IL8 (AY627308) on GenBank by software primer 5.0. The polymorphism of IL8 was detected by method of polymerase chain reaction-Single strand Conformation polymorphism (PCR-SSCP). A total of 2.0 mL PCR product was mixed with 8 mL of the denaturation solution (50 mmol=L NaOH, 1 mmol=L EDTA), and 1 mL of the loading buffer containing 0.25% bromophenol blue and 0.25% xylene cyannol, denatured for 10 min at 98 C, and rapidly chilled in 20 C. The samples were then electrophoresed in 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). A thermostatically controlled refrigerated circulator was used to maintain constant temperature (4 C) of the gels. The gels were run in the following conditions: 250 V, 40 mA, 10 min (preelectrophoresis) and 150 V, 24 mA, for 8 h. The gels were then stained by Silver Stain (Kucharczyk Techniki Elektroforetyczne). The patterns of DNA bands were observed and photographed with the GDS7500 System (UVP). After the polymorphism was detected, 4 samples of each type of band were sequenced and analyzed. Detection of IL8 Gene Expression by Real-time PCR Total RNA extraction was performed from the fresh blood using TRIZOL (TaKaRa, CA) according to the manufacturer’s instructions. The residual genomic DNA was removed by an on-column DNAse digestion with RNAse-free DNAse (Invitrogene) according to the
manufacturer recommendations. The RNA concentration was quantified spectrophotometrically at 260 nm with A260=A280 ratios between 1.8 and 1.9, indicating pure and clean RNA isolates, and the RNA integrity was checked by agarose gel (2%) electrophoresis to ensure that RNA was intact. The primers (Table 1) were designed according to the sequences of the IL8 (NM_173925) and GAPDH (NM_001034034) genes on GenBank by software primer 5.0. The mRNA amount of each genotype was measured by Real time-PCR. A typical 20 mL system included 10 mL 2 SYBRGreenI Master mix (Brilliant SYBR Green QPCR master mix), 0.8 mL forward and reverse primers (100 nM), 0.4 mL ROX Reference Dye, 2 mL cDNA, and 6 mL water. The LightCycler was programmed in 4 steps: (1) denaturation at 95 C for 30 s; (2) amplification for 40 cycles of denaturation at 95 C for 5 s, annealing at 60 C for 34 s; (3) melting curve by 95 C for 15 s, 60 C for 1 min, and 95 C for 15 s; and (4) cooling at 40 C. In each reaction, the cycle number at which the fluorescence rises appreciably above the background fluorescence is determined as a crossing point (CP). Western Blot Analysis Serum of different genotype cows was rapidly separated. Protein was extracted according to the improved Lowry et al. method (17). Proteins (30–50 mg protein=lane) were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked for 0.5 h with 5% BSA-0.1% Tween 20, membranes were incubated with primary antibody: IL8 mouse monoclonal, 1:1000 (Abcam), GAPDH: cow monoclonal, 1:1,000 (Santa Cruz Biotechnology Inc., Santa Cruz, CA), with GAPDH used as the loading control. After being washed in buffer, the membranes were incubated with appropriate horseradish peroxidase-conjugated secondary antibodies (IL8: antimouse, 1:100, GAPDH: anti-mouse, 1:100, all from Gene Company Ltd., Hong Kong) for 2 h at room temperature (RT), after being washed in buffer, Western blot analysis was performed using odyssey for the signal detection. Signal intensities were quantified by densitometry using Image J software.
TABLE 1 Sequence of primers of bovine IL8 and GAPDH genes in PCR and real-time PCR Gene IL8(DNA) IL8 (cDNA) GAPDH (cDNA)
Sequence (50 30 )
Length
Localization
F:CAGATGACTCAGATGTGC R:AGGAAAAGCTGCCAAGAG F:CACTGTGAAAATTCAGAAATCATTGTTA R:CTTCACAAATACCTGCACAACCTTC F: CCCGTTCGACAGATAGCC R:CTGTGCCGTTGAACTTGC
250 bp
19278
AY627308
105 bp
250335
NM_173925
229 bp
16245
NM_001034034
Accession
MASTITIS SOMATIC CELL SCORE IN CHINESE HOLSTEIN COWS
Statistical Analysis The frequencies of alleles and genotypes were analyzed by POPGENE software (ver.1.31). The v2-test was utilized to test linkage disequilibrium. All the production data were analyzed with the GLM procedure of SAS (9.0) software. The relation of the IL8 polymorphisms with SCS were analyzed by general linear model:
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
y ¼ l þ genotypei þ e where Y ¼ individuality trait phenotypic value, m ¼ overall mean, genotypei ¼ the fixed effect of genotype, and e ¼ the the random residual effect. Gene expression and protein values were shown as means SE. Statistical significance in the parameter values among the different genotype was tested by ANOVA procedure, the treatment means were separated by Duncan’s multiple range test, and accepted if p < 0.05. The raw realtime PCR values (Ct) had to be processed by comparative Ct (DCt) method to obtain gene expression levels. The fold change of expression of the genes normalized against IL8 mRNA levels from different bloods were calculated with 2DCt (18, 19), where DCt ¼ Ct (IL8)-Ct (GAPDH). RESULTS PCR-SSCP results showed that the bovine IL8 gene had three types of SSCP bands, and sequences of these three genotypes were compared with the referenced sequence (AY627308) in GenBank, one nucleotide variation was found at 105G>A site in the 5’flanking region of bovine IL8 gene and, consequently, three different bands (AA, AG, and GG genotypes) were designated, respectively. The genotypic and allelic frequencies of the SNP (105G>A) were shown in Table 2. The frequency of G (0.61) allele was higher than A allele (0.39). The v2 test showed that the population deviated from Hardy-Weinberg equilibrium. The results showed the genotype altered SCS with an decrease in SCS for GG but not AG or AA (Table 3), the cows with GG genotype had lower SCS than those with AA and AG genotypes (P < 0.01); whereas, the genotype did not affect the 305d milk yield. The real-time PCR technique was used to detect the level of mRNA on different genotypes. Melting (Dissociation)
145
TABLE 3 Genotypic effect of SNP-105G>A of the 5’ flanking region of IL8 gene on SCS and 305 d corrected milk yield Genotype GG AG AA p-value
Number 308 372 130
Somatic cell score (SCS)
305 d corrected milk yield
4.032 0.079a 4.590 0.073b 4.27 0.112b 0.0084
6982.9 2643.3 7168.7 2232.2 6893.3 2308.7 0.066
Note: Small letters mean values in the same column with different superscripts significantly differ at P < 0.01, P < 0.01.
FIG. 1.
Relative variation of IL8 gene mRNA expression of three genotypes at -105G>A site in Chinese Holstein dairy cows, n ¼ 10=genotype; p < 0.05 for GG versus AA or AG.
TABLE 2 Polymorphic information of SNP-105G>A of the 5’ flanking region of IL8 gene in Chinese Holstein dairy cows Number
Genotype frequency
810
GG 0.38
GA 0.46
AA 0.16
Allele frequency G 0.61
A 0.39
v2 57.37
FIG. 2. IL8 protein expression of three genotypes was measured by Western blot and normalized to GAPDH. n ¼ 10=genotype; p < 0.05 for AA versus AG; # p < 0.05 for GG versus AA or AG.
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
146
R. CHEN ET AL.
curves of a typical PCR run where only a specific product was amplified. Dissociation temperature of GAPDH and IL8 was 60 C and 60 C, respectively. In this study, melting curves of the two genes had a single melt-curve peak which showed better DNA quantitative detection with real-time PCR. Melting curve analysis and relative quantification of IL8 indicated that mRNA level of GG was significantly higher than AA and AG (P < 0.05) (Fig. 1). A significant increase of the content of IL8 was observed in GG genotype compared to AA and AG genotypes (P < 0.05), whereas the content of IL8 was significantly higher in AA genotype than that in AG genotype (P < 0.05) (Fig. 2).
ACKNOWLEDGMENT Renjin Chen and Zhenzhen Wang contributed equally to this work. FUNDING The National Natural Science Foundation of China (31172171, 31272407, and 31372286), the Natural Science Foundation for Youth in Jiangsu Province (BK2012138), the President Foundation of Xuzhou Medical College (2012KJZ20), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). REFERENCES
DISCUSSION Some studies reported that a sequence variation from 1 to 133 within the 5’flanking region of the human IL8 gene may modify the transcriptional regulation (20, 21). Some binding sites were associated with activating protein-1 (AP-1) transcription factor and regulated the expression of NF-jB family of transcription factors in coding region of the human IL8 gene (22, 23). The same mechanism may occur in bovine IL8, activity of IL8 promoter was stimulated by bovine herpes virus 4 in bovine endometrial stromal cells and IL8 protein secretion (12). Two distinct promoter haplotypes of IL8 promoter demonstrated significant differential activation profiles in response to LPS and TNFa (13). In this study, we detected one SNP -105G>A in the 5’flanking region of the bovine IL8 gene. The SNPs (-105G>A) located in the region of IL8 gene promoter, which some regulatory element overlapped partially with the NF-jB binding site element (24). Meade et al. (13) predicted that the ‘‘A’’ allele of this SNP creates two binding sites for the transcription factor Oct-1. And, the Oct-1 transcriptional repressor could repress the IL8 expression (25, 26). Our results indicated that the SNP-105G>A altered SCS (P < 0.01), GG genotype had lower SCS than those with AA and AG genotypes and protein and mRNA level of GG was significantly higher than AA and AG (P < 0.05). The ‘‘G’’ allele was substituted by the ‘‘A’’ allele leading to the expression decrease of IL8; therefore, our results validated Meade’s prediction (13). The allele frequencies of 0.61 for ‘‘G’’ allele and 0.39 for ‘‘A’’ allele. ‘‘A’’ allele was the recessive gene in natural and artificial selection, and the ‘‘G’’ allele was the advantageous. In summary, the mutation on -105G>A site led to the variation of IL8 expression, and the genotype altered SCS. The polymorphic site (-105G>A) of IL8 gene may be a useful genetic marker for production and mastitis resistance selection and breeding in Chinese Holstein. However, the mechanism of the gene needs further study.
1. Sordillo LM, Streicher KL. Mammary gland immunity and mastitis susceptibility. J Mammary Gland Biol Neoplasia 2002; 7(2):135–146. 2. Nash DL, Rogers GW, Cooper JB, Hargrove GL, Keown JF. Heritability of intramammary infections at first parturition and relationships with sire transmitting abilities for somatic cell score, udder type traits, productive life, and protein yield. J Dairy Sci 2003; 86:2684–2695. 3. Hwang CY, Pak SI, Han HR. Effects of autogenous toxoid-bacterin in lactating cows with Staphylococcus aureus subclinical mastitis. J Vet Med Sci 2000; 62(8):875–880. 4. Shook GE. Major advances in determining appropriate selection goals. J Dairy Sci 2006; 89:1349–1361. 5. Rupp R, Boichard D. Genetic parameters for clinical mastitis, somatic cell score, production, udder type and milking easy in first lactation Holsteins. J Dairy Sci 1999; 82:2198–2204. 6. Mukaida N, Morita M, Ishikawa Y, et al. Novel mechanism of glucocorticoid-mediated gene repression: Nuclear factorjB is target for glucocorticoid-mediated interleukin 8 gene repression. J Biol Chem 1994; 269:13289–13295. 7. Gu¨nther J, Liu S, Esch K, Schuberth HJ, Seyfert HM. Stimulated expression of TNF-a and IL-8, but not of lingual antimicrobial peptide reflects the concentration of pathogens contacting bovine mammary epithelial cells. Vet Immunol Immunopathol 2010; 135:152–157. 8. Gu¨nther J, Koczan D, Yang W, et al. Assessment of the immune capacity of mammary epithelial cells: comparison with mammary tissue after challenge with Escherichia coli. Vet Res 2009; 40:31. 9. Whelehan CJ, Meade KG, Eckersall PD, Young FJ, O’Farrelly C. Experimental Staphylococcus aureus infection of the mammary gland induces region-specific changes in innate immune gene expression. Vet Immunol Immunopathol 2011; 140:181–189. 10. Gao LB, Pan XM, Jia J, et al. IL-8–251A=T polymorphism is associated with decreased cancer risk among populationbased studies: Evidence from a meta-analysis. Eur J Cancer 2010; 46:1333–1343. 11. Ahn MH, Park BL, Lee SH, et al. A promoter SNP rs4073T>A in the common allele of the interleukin 8 gene is associated with the development of idiopathic pulmonary fibrosis via the IL-8 protein enhancing mode. Respir Res 2011; 12:73.
Downloaded by [UZH Hauptbibliothek / Zentralbibliothek Zürich] at 09:09 23 December 2014
MASTITIS SOMATIC CELL SCORE IN CHINESE HOLSTEIN COWS 12. Donofrio G, Capocefalo A, Franceschi V, Price S, Cavirani S, Sheldon IM. The chemokine IL8 is up-regulated in bovine endometrial stromal cells by the BoHV-4 IE2 gene product, ORF50=Rta: a step ahead toward a mechanism for BoHV-4 induced endometritis. Biol Reprod 2010; 8:919–928. 13. Meade KG, O’Gorman GM, Narciandi F, Machugh DE, O’Farrelly C. Functional characterisation of bovine interleukin 8 promoter haplotypes in vitro. Mol Immunol 2012; 150:08–116. 14. Shook GE. Approaches to summarizing somatic cell counts which improve interpretability. Proc Natl Mastitis Council Arlington VA 1982; 150–166. 15. Wiggans GR, Shook GE. A lactation measure of somatic cell count. J Dairy Sci 1987; 70:2666–2672. 16. Mullenbach R, Lagoda PJ, Welter C. An efficient salt-chloroform extraction of DNA from blood and tissue. Trends Genet 1989; 5:391. 17. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with Folin phenol reagent. J Biol Chem 1951; 193:265–275. 18. Houng HH, Hritz D, Kanesa-thasan N. Quantitative detection of dengue 2 virus using fluorogenic RT-PCR based on 3 noncoding sequence. J Virol Meth 2000; 86:1–11. 19. Shaw AE, Reid SM, Ebert K, Hutchings GH, Ferris NP, King DP. Implementation of a one-step real-time RT-PCR protocol for diagnosis of foot-and-mouth disease. J Virol Meth 2007; 143:81–85.
147
20. Harant H, de Martin R, Andrew PJ, Foglar E, Dittrich C, Lindley IJ. Synergistic activation of interleukin-8 gene transcription by all-trans-retinoic acid and tumor necrosis factor-alpha involves the transcription factor NF-kappa B. J Biol Chem 1996; 271:26954–26961. 21. Mukaida N, Okamoto S, Ishikawa Y, Matsushima K. Molecular mechanism of interleukin-8 gene expression. J Leukoc Biol 1994; 56:554–581. 22. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol 2002; 72:847–855. 23. Okamoto S, Mukaida N, Yasumoto K, et al. The interleukin-8 AP-1 and kappa B-like sites are genetic end targets of FK506-sensitive pathway accompanied by calcium mobilization. J Biol Chem 1994; 269:8582–8589. 24. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol 2002; 72:847–855. 25. Bhat R, Weaver JA, Sterling KM, Bresnick E. Bresnick Nuclear transcription factor Oct-1 binds to the 50 -upstream region of CYP1A1 and negatively regulates its expression. Int J Biochem Cell Biol 1996; 28:217–227. 26. Zhang H, Shepherd AT, Eason DD, et al. Retinoblastoma protein expression leads to reduced Oct-1 DNA binding activity and enhances interleukin-8 expression. Cell Growth Differ 1999; 10:457–465.
