Mol Biol Rep DOI 10.1007/s11033-014-3423-z
ABC transporters as differentiation markers in glioblastoma cells Ana R. Rama • Pablo J. Alvarez • Roberto Madeddu Antonia Aranega
•
Received: 4 April 2014 / Accepted: 17 May 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Glioblastoma multiforme (GBM) is the most common primary malignant brain tumour, characterized by a high aggressivity, a huge heterogeneity attending a hierarchical model and resistance to therapy. Drug resistance has been correlated with the presence of the ABC efflux transporters which are able to exclude drugs for the cellular cytoplasm. In the nucleus of the GBM, initiating cells (ICs) can self-renew and give rise to cancer stem cells, which differ to the side population cells and the different cellular subtypes that form the mass around them. The ICs do not express or express ATP binding cassette (ABC) at very low levels, but this expression may increase with the differentiation process. We suggest that the differentiation process may be responsible of chemoresistance of the GBM cells. We compared three ABC transporters expression: ABCA1, MRP4 and MRP5, in the ICs obtained from 9 patients with GBM and their respective differentiated GBM cells. We show an overexpression of the three ABC transporters in the differentiated GBM cells in comparison to ICs. Implications of the hypothesis: The blockade of these ABC transporters could help to improve the drug effectivity and thus reduce the tumour growth and prevent the tumour recurrence. Keywords ATP binding cassette Cancer stem cells Glioblastoma Multidrug resistance
A. R. Rama (&) Department of Health Sciences, University of Jaen, Campus Las Lagunillas, s/n, 23071 Jaen, Spain e-mail: [email protected] A. R. Rama P. J. Alvarez R. Madeddu A. Aranega Institute of Biopathology and Regenerative Medicine (IBIMER), University of Granada, Granada, Spain
Abbreviations GBM Glioblastoma multiforme ABC ATP binding cassette ABCA1 ABC transporter A1/cholesterol exporter MRP4 Multidrug resistance-associated protein 4 MRP5 Multidrug resistance-associated protein 5 CSCs Cancer stem cells SP Side population ICs Initiating cells NS Neurospheres
Introduction ATP binding cassette (ABC) efflux transporters bind endogenous compounds and xenobiotics, and move them out of the cell through the membrane. These proteins have been related with a variety of cancers and mediate multidrug-resistance to many drugs. The ABC transporters allow cancer cells to escape chemotherapy treatment, thus it may result in tumour recurrence [1–4]. ABC transporter A1/ cholesterol exporter (ABCA1) mediates the transfer of cholesterol across the plasma membrane to apolipoprotein A-I [5]. Its expression level has been observed in glioblastoma, astrocytoma, neuroblastoma and hepatoma cells among others. Vik-Mo et al. [4], demonstrated the relationship between the cholesterol transport genes and cancer multidrug resistance using cell exposure to drugs such as clozapine, olanzapine, haloperidol or imipramine. Multidrug resistance-associated protein 4 (MRP4), the shortest member of the ABCC/MRP family, was originally described as a nucleotide transporter but it is capable to transport other diverse components. MRP4 decreases the brain
123
Mol Biol Rep
penetration of cytotoxic drugs, such as irinotecan or topotecan, which are relevant to neuroblastoma treatment, through the active export in the blood–brain and bloodCSF barriers [2]. Finally, MRP5 takes the organic anion of glutathione conjugates out and it is overexpressed in several tumours. In GMB, the MRP5 high expression has been correlated with worse survival and resistance to a wide range of antiviral and anticancer drugs, such as 5-FU [1]. Glioblastoma multiforme (GBM), the most common primary malignant brain tumour, is characterized by a high heterogeneity, including glioblastoma stem-like cells, cancer stem cells (CSCs) and the side population (SP) cell. According to Mazzoleni and Galli [6], this heterogeneity could be following a hierarchical model, where the stemlike cells, also called initiating cells (ICs), have the capacity of self-renewal of differentiating into CSCs and are responsible for the tumour progression and the recurrence [7–10]. The SP cell is a small subpopulation of CSCs which has been identified in different cancers based on their efflux properties of the ABC transporters [9]. During the process of differentiation the CSCs lose their proliferation properties but may up-regulate the ABC transporter expression which could favour the tumour chemoresistance [2, 3, 11]. ICs are generally identified based on their growth potential as non-adherent neurospheres (NS) in a serumfree medium or specific medium [3, 4, 6, 7, 9]. Several studies correlate their differentiation degree with the modulation of the cell adhesion. In fact, the adhesion molecule L1CAM expression is increased during the differentiation of the glioma ICs [6]. On the other hand, the EGFR pathway, necessary for the cell proliferation, is active in NS, while loss of the EGFR expression has been found in their corresponding adherent cells [3]. The aim of this preliminary study was to compare the expression of the ABC transporters ABCA1, MRP4 and MRP5 in GMB ICs and their respective differentiated cells. The ICs from 9 GBM patients were cultured in a serumfree medium as NS and in serum-containing medium as monolayer cells after differentiation. Our results allow hypothesizing that the ABC transporters may be overexpressed in these cells after the differentiation and may be responsible for the chemotherapy resistance. These molecules could represent a prominent functional marker for the treatment of GBM.
Materials and methods Tumour cultures NS from 9 GBM, G48, G52, G59, G63, G73, G77, G97, G33, G118, were kindly provided by Dr. Ferna´ndez-Luna from Molecular Genetics Unit, Hospital Valdecilla and
123
Instituto de Formacio´n e Investigacio´n Marque´s de Valdecilla (IFIMAV). They were obtained from surgical patients as described Nogueira et al. [10], and identified as neuronal stem cells by markers as CD133, Nestin, GFAP and Tuj1. Also, mRNA expression levels of progenitor cell markers, CD133, Sox2, Nanog and Nestin, and of lineagespecific markers, GFAP and Tuj1, were studied by Nogueria et al. [10]. Those NS growth media serum-free Dulbecco’s modified Eagle’s medium/F12 medium (Invitrogen, Carlsbad, CA, USA) containing human recombinant EGF (20 ng/ml; Sigma, St Louis, MO, USA), bFGF (20 ng/ml; Sigma), B-27 (20 ml/ml of medium; Invitrogen) and heparin (2 mg/ml). To promote differentiation, NS were cultured in the same medium but in the presence of 10 % fetal calf serum for 7 days. RNA extraction and quantitative real-time PCR Total RNA from NS to differentiated glioblastoma cells was extracted with TRIZOL reagent (Invitrogen) and cDNA was generated by means of the MMLV-RT (Promega) using total cellular RNA (1 lg) and amplified by using primers MRP4 (5´GCACTGAGGAAGATGCTGAA ´ 3 and 5´AGTTCCTGGAAGGTCTTGTTCAC ´ 3), MRP5 A ´ ´ ´ (5GGGATAACTTCTCAGTGGGG3 and 5GGAATGGCA ´ 3) and the ABCA1 (5´GCACTGAGGAA ATGCTCTAAAG ´ GATGCTGAAA3 and 5´AGTTCCTGGAAGGTCTTGTT CAC´3) and G6PD (5´CGATGGCAGAGCAGGT´3 and 5´GA ´ 3). Quantitative real-time PCR was TCTGGTCCTCACG performed in a 7000 Sequence Detection System (AppliedBiosystems, Foster City, CA, USA) (Applied Biosystems). Specificity of the desired PCR products was determined by melting curve analysis. The ratio of the abundance of the different transcripts to that of G6PD transcript was calculated as 2n, where n is the Ct (threshold cycle) value of G6PD minus the Ct value of the corresponding mRNA. For each MRP, the data were presented as fold change in relative expression levels of differentiated cells over NS cells. Positive cases were defined as those with mRNA levels two-fold higher than the levels in the NS.
Results and discussion We studied the mRNA expression of the ABCA1, MRP4 and MRP5 ABC transporters in NS and differentiated cells from GBM patients (Figs. 1a, b, c). Differentiated cells in comparison to NS showed that of the 9 GBM samples, 6 were positive for the ABCA1 (67 %), 3 for MRP4 (33.3 %) and 5 for MRP5 (55.5 %). The up-regulation of these genes has been described in other studies. Quantitative PCR and immunoblotting have been used to determine the ABCA1 expression levels in the GaMg glioblastoma cell line and in
Mol Biol Rep
B
12
Relative mRNA MRP4 levels
Relative mRNA ABCA1 levels
A 10 8 6 4 2 0
12 10 8 6 4 2 0 G48 G52 G59 G63 G73 677 G97 G33 G118
G48 G52 G59 G63 G73 677 G97 G33 G118
Relative mRNA MRP5 levels
12 10 8 6 4 2 0 G48 G52 G59 G63 G73 677 G97 G33 G118
Relative mRNA ABC transporter level sfrom positive samples
D
C
6 5 4 3 2 1 0 ABCA1
MRP4
MRP5
Fig. 1 Quantitative comparison of the ABCA1, MRP4 and MRP5 mRNA levels in differentiated glioblastoma cells. Total RNA was extracted from NS before and after differentiation, and the expression of the ABC transporters was analyzed by quantitative reverse transcriptase (RT)–PCR. ABCA1, MRP4 and MRP5 mRNA transcript level were standardized to G6PDH mRNA transcript levels. These standardized values of the differentiated GBM cells were
compared versus their respective ones of normal NS. All ABC transporters genes showed significant differences (P \ 0.01). a– c Histograms represent the mean ± SD of triplicate measurements of each ABC transporter in each sample of GBM. d Histograms represent the mean ± SD of triplicate measurements of the positive samples for each gene
the SH-SY5Y neuroblastoma cells, showing a high expression in both lines [12]. Similarly, other studies showed an increase of the MRP4 and MRP5 expression in neuroblastoma and GBM cells respectively as well as their significant correlation with a worse patient prognostic [1, 2]. Besides, these overexpressions have been enhanced by drug exposure which explains the multidrug resistance of these cancers [1, 2, 12]. On the other hand, the mean of the expression of the ABCA1, MRP4 and MRP5 mRNA from the positive differentiated cells was 4.87, 3.27 and 3.54 fold higher than each of the NS from the 9 GBM samples (Fig. 1d). These results are supported by various studies in which it has been shown an increased resistance to chemotherapy after the cell differentiation. Held- Feindt et al. [11], showed a higher resistance to temozolomide in glioma ICs generated from glioblastoma patients when they were cultured in serumcontaining medium, as NS, than in a serum-free medium, as adherent cells. When the NS were subjected to differentiation (10 % FCS) they were characterized by a high L1CAM expression that was correlated with a clearly higher sensitivity to treatment with temozolomide in comparison to the corresponding non-differentiated NS. The multi-kinase inhibitor sorafenib has a selective action on glioblastoma stem cells, with lower effects in differentiated
glioblastoma cultures, which is related to the higher resistance of the glioblastoma cultures after the differentiation [7]. Erlotinib has a moderate effect on the adherent cell lines originated from the human GBM resections while induces a strong inhibition of the cell growth on their NS counterparts [8]. Likewise, Nakai et al. [13] established a NS derived from U87 cell from GBM and compared the MDR1 and CD133 expression levels on them. They showed an increase of the MDR1 and CD133 expression levels on NS, which was related with a stronger drug-resistance. Our hypothesis is based on the hierarchical model [14] (Fig. 2). The GBM tumour nucleus is formed by ICs, which are either not expressed or expressed at very low levels of the ABC transporter, thus they could be hit for the drugs. These can self- renew and give rise to the CSCs which will differ into the SP cells and the different cellular subtypes that form the tumour mass around them. Significantly related to this process of differentiation, the expression of the ABC transporter levels will be increased. For this reason, the drugs may be released by these efflux pump and the ICs are not target. The inhibition of the ABC transporters will allow the drugs to hit the differentiated cells and the CSCs, reducing the tumour mass around the ICs being these finally beaten up, and could be affected for not expressing the ABC transporter.
123
Mol Biol Rep
ICs CSCs SP cells Differentiated cells ABC transporters ABC transporters Inhibitor Drugs
Fig. 2 Therapy based on a hierarchical model: ICs form the nucleus of the tumour. They can self- renew and give rise to the CSCs which will differ into the SP cells and the different cellular subtypes, all of them around ICs, forming the tumour mass. ICs are either not expressed or expressed at very low levels of the ABC transporter, but these expression levels increase with the process of differentiation. The drugs are efflux by the ABC transporters expressed higher in this
cell mass unable to act on the ICs. By inhibiting these ABC transporters the drugs could attack the cells of the tumour mass, reducing the tumour size and reaching the ICs. The drugs could kill ICs because they are either not expressed or expressed at very low levels of the ABC transporters, therefore the tumour could be eliminated
Future studies will be necessary to demonstrate the activity of the mechanisms of resistance and the difference of differentiated cells versus non-differentiated cells. These experiments could demonstrate the relevance of resistance in glioblastoma as a new target to the development of a therapeutic strategy against GMB treatment.
expression in glioblastoma. Cancer Chemother Pharmacol 69(5):1387–1391. doi:10.1007/s00280-012-1832-z Huynh T, Norris MD, Haber M, Henderson MJ (2012) ABCC4/ MRP4: a MYCN-regulated transporter and potential therapeutic target in neuroblastoma. Front Oncol 2:178. doi:10.3389/fonc. 2012.00178 Nambaru PK, Hubner T, Kock K, Mews S, Grube M, Payen L, Guitton J, Sendler M, Jedlitschky G, Rimmbach C, Rosskopf D, Kowalczyk DW, Kroemer HK, Weiss FU, Mayerle J, Lerch MM, Ritter CA (2011) Drug efflux transporter multidrug resistanceassociated protein 5 affects sensitivity of pancreatic cancer cell lines to the nucleoside anticancer drug 5-fluorouracil. Drug Metab Dispos 39(1):132–139. doi:10.1124/dmd.110.033613 Vik-Mo AO, Ferno J, Skrede S, Steen VM (2009) Psychotropic drugs up-regulate the expression of cholesterol transport proteins including ApoE in cultured human CNS- and liver cells. BMC Pharmacol 9:10. doi:10.1186/1471-2210-9-10 Attie AD (2007) ABCA1: at the nexus of cholesterol, HDL and atherosclerosis. Trends Biochem Sci 32(4):172–179. doi:10.1016/ j.tibs.2007.02.001 Paglialonga F, Ardissino G, Galli MA, Scarfia RV, Testa S, Edefonti A (2012) Bioimpedance analysis and cardiovascular status in pediatric patients on chronic hemodialysis. Hemodial Int 16(Suppl 1):S20–S25. doi:10.1111/j.1542-4758.2012.00743.x Carra E, Barbieri F, Marubbi D, Pattarozzi A, Favoni RE, Florio T, Daga A (2013) Sorafenib selectively depletes human
Acknowledgments This study was supported by the Instituto de Salud Carlos III (FIS) through Project n8 PI11/01862 and by the Consejerı´a de Salud de la Junta de Andalucı´a through Project n8 PI0338. We thank the collaboration of Dr. Ferna´ndez-Luna from Molecular Genetics Unit, Hospital Valdecilla and Instituto de Formacio´n e Investigacio´n Marque´s de Valdecilla (IFIMAV), Santander, Spain. Conflict of interests peting interests.
The authors declare that they have no com-
References 1. Alexiou GA, Goussia A, Voulgaris S, Fotopoulos AD, Fotakopoulos G, Ntoulia A, Zikou A, Tsekeris P, Argyropoulou MI, Kyritsis AP (2012) Prognostic significance of MRP5 immunohistochemical
123
2.
3.
4.
5.
6.
7.
Mol Biol Rep glioblastoma tumor-initiating cells from primary cultures. Cell Cycle 12(3):491–500. doi:10.4161/cc.23372 8. Eimer S, Dugay F, Airiau K, Avril T, Quillien V, Belaud-Rotureau MA, Belloc F (2012) Cyclopamine cooperates with EGFR inhibition to deplete stem-like cancer cells in glioblastomaderived spheroid cultures. Neuro oncol 14(12):1441–1451. doi:10.1093/neuonc/nos266 9. Golebiewska A, Bougnaud S, Stieber D, Brons NH, Vallar L, Hertel F, Klink B, Schrock E, Bjerkvig R, Niclou SP (2013) Side population in human glioblastoma is non-tumorigenic and characterizes brain endothelial cells. Brain 136(Pt 5):1462–1475. doi:10.1093/brain/awt025 10. Nogueira L, Ruiz-Ontanon P, Vazquez-Barquero A, Lafarga M, Berciano MT, Aldaz B, Grande L, Casafont I, Segura V, Robles EF, Suarez D, Garcia LF, Martinez-Climent JA, Fernandez-Luna JL (2011) Blockade of the NFkappaB pathway drives differentiating
11.
12.
13.
14.
glioblastoma-initiating cells into senescence both in vitro and in vivo. Oncogene 30(32):3537–3548. doi:10.1038/onc.2011.74 Held-Feindt J, Schmelz S, Hattermann K, Mentlein R, Mehdorn HM, Sebens S (2012) The neural adhesion molecule L1CAM confers chemoresistance in human glioblastomas. Neurochem Int 61(7):1183–1191. doi:10.1016/j.neuint.2012.08.011 Vik-Mo H (2009) Better results with the new generation bare metal stents. Scand Cardiovasc J 43(2):84–86. doi:10.1080/ 14017430802651829 Nakai E, Park K, Yawata T, Chihara T, Kumazawa A, Nakabayashi H, Shimizu K (2009) Enhanced MDR1 expression and chemoresistance of cancer stem cells derived from glioblastoma. Cancer Invest 27(9):901–908. doi:10.3109/07357900801946679 Mazzoleni S, Galli R (2012) Gliomagenesis: a game played by few players or a team effort? Front Biosci (Elite Ed) 4:205–213
123
ABC transporters as differentiation markers in glioblastoma cells Ana R. Rama • Pablo J. Alvarez • Roberto Madeddu Antonia Aranega
•
Received: 4 April 2014 / Accepted: 17 May 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Glioblastoma multiforme (GBM) is the most common primary malignant brain tumour, characterized by a high aggressivity, a huge heterogeneity attending a hierarchical model and resistance to therapy. Drug resistance has been correlated with the presence of the ABC efflux transporters which are able to exclude drugs for the cellular cytoplasm. In the nucleus of the GBM, initiating cells (ICs) can self-renew and give rise to cancer stem cells, which differ to the side population cells and the different cellular subtypes that form the mass around them. The ICs do not express or express ATP binding cassette (ABC) at very low levels, but this expression may increase with the differentiation process. We suggest that the differentiation process may be responsible of chemoresistance of the GBM cells. We compared three ABC transporters expression: ABCA1, MRP4 and MRP5, in the ICs obtained from 9 patients with GBM and their respective differentiated GBM cells. We show an overexpression of the three ABC transporters in the differentiated GBM cells in comparison to ICs. Implications of the hypothesis: The blockade of these ABC transporters could help to improve the drug effectivity and thus reduce the tumour growth and prevent the tumour recurrence. Keywords ATP binding cassette Cancer stem cells Glioblastoma Multidrug resistance
A. R. Rama (&) Department of Health Sciences, University of Jaen, Campus Las Lagunillas, s/n, 23071 Jaen, Spain e-mail: [email protected] A. R. Rama P. J. Alvarez R. Madeddu A. Aranega Institute of Biopathology and Regenerative Medicine (IBIMER), University of Granada, Granada, Spain
Abbreviations GBM Glioblastoma multiforme ABC ATP binding cassette ABCA1 ABC transporter A1/cholesterol exporter MRP4 Multidrug resistance-associated protein 4 MRP5 Multidrug resistance-associated protein 5 CSCs Cancer stem cells SP Side population ICs Initiating cells NS Neurospheres
Introduction ATP binding cassette (ABC) efflux transporters bind endogenous compounds and xenobiotics, and move them out of the cell through the membrane. These proteins have been related with a variety of cancers and mediate multidrug-resistance to many drugs. The ABC transporters allow cancer cells to escape chemotherapy treatment, thus it may result in tumour recurrence [1–4]. ABC transporter A1/ cholesterol exporter (ABCA1) mediates the transfer of cholesterol across the plasma membrane to apolipoprotein A-I [5]. Its expression level has been observed in glioblastoma, astrocytoma, neuroblastoma and hepatoma cells among others. Vik-Mo et al. [4], demonstrated the relationship between the cholesterol transport genes and cancer multidrug resistance using cell exposure to drugs such as clozapine, olanzapine, haloperidol or imipramine. Multidrug resistance-associated protein 4 (MRP4), the shortest member of the ABCC/MRP family, was originally described as a nucleotide transporter but it is capable to transport other diverse components. MRP4 decreases the brain
123
Mol Biol Rep
penetration of cytotoxic drugs, such as irinotecan or topotecan, which are relevant to neuroblastoma treatment, through the active export in the blood–brain and bloodCSF barriers [2]. Finally, MRP5 takes the organic anion of glutathione conjugates out and it is overexpressed in several tumours. In GMB, the MRP5 high expression has been correlated with worse survival and resistance to a wide range of antiviral and anticancer drugs, such as 5-FU [1]. Glioblastoma multiforme (GBM), the most common primary malignant brain tumour, is characterized by a high heterogeneity, including glioblastoma stem-like cells, cancer stem cells (CSCs) and the side population (SP) cell. According to Mazzoleni and Galli [6], this heterogeneity could be following a hierarchical model, where the stemlike cells, also called initiating cells (ICs), have the capacity of self-renewal of differentiating into CSCs and are responsible for the tumour progression and the recurrence [7–10]. The SP cell is a small subpopulation of CSCs which has been identified in different cancers based on their efflux properties of the ABC transporters [9]. During the process of differentiation the CSCs lose their proliferation properties but may up-regulate the ABC transporter expression which could favour the tumour chemoresistance [2, 3, 11]. ICs are generally identified based on their growth potential as non-adherent neurospheres (NS) in a serumfree medium or specific medium [3, 4, 6, 7, 9]. Several studies correlate their differentiation degree with the modulation of the cell adhesion. In fact, the adhesion molecule L1CAM expression is increased during the differentiation of the glioma ICs [6]. On the other hand, the EGFR pathway, necessary for the cell proliferation, is active in NS, while loss of the EGFR expression has been found in their corresponding adherent cells [3]. The aim of this preliminary study was to compare the expression of the ABC transporters ABCA1, MRP4 and MRP5 in GMB ICs and their respective differentiated cells. The ICs from 9 GBM patients were cultured in a serumfree medium as NS and in serum-containing medium as monolayer cells after differentiation. Our results allow hypothesizing that the ABC transporters may be overexpressed in these cells after the differentiation and may be responsible for the chemotherapy resistance. These molecules could represent a prominent functional marker for the treatment of GBM.
Materials and methods Tumour cultures NS from 9 GBM, G48, G52, G59, G63, G73, G77, G97, G33, G118, were kindly provided by Dr. Ferna´ndez-Luna from Molecular Genetics Unit, Hospital Valdecilla and
123
Instituto de Formacio´n e Investigacio´n Marque´s de Valdecilla (IFIMAV). They were obtained from surgical patients as described Nogueira et al. [10], and identified as neuronal stem cells by markers as CD133, Nestin, GFAP and Tuj1. Also, mRNA expression levels of progenitor cell markers, CD133, Sox2, Nanog and Nestin, and of lineagespecific markers, GFAP and Tuj1, were studied by Nogueria et al. [10]. Those NS growth media serum-free Dulbecco’s modified Eagle’s medium/F12 medium (Invitrogen, Carlsbad, CA, USA) containing human recombinant EGF (20 ng/ml; Sigma, St Louis, MO, USA), bFGF (20 ng/ml; Sigma), B-27 (20 ml/ml of medium; Invitrogen) and heparin (2 mg/ml). To promote differentiation, NS were cultured in the same medium but in the presence of 10 % fetal calf serum for 7 days. RNA extraction and quantitative real-time PCR Total RNA from NS to differentiated glioblastoma cells was extracted with TRIZOL reagent (Invitrogen) and cDNA was generated by means of the MMLV-RT (Promega) using total cellular RNA (1 lg) and amplified by using primers MRP4 (5´GCACTGAGGAAGATGCTGAA ´ 3 and 5´AGTTCCTGGAAGGTCTTGTTCAC ´ 3), MRP5 A ´ ´ ´ (5GGGATAACTTCTCAGTGGGG3 and 5GGAATGGCA ´ 3) and the ABCA1 (5´GCACTGAGGAA ATGCTCTAAAG ´ GATGCTGAAA3 and 5´AGTTCCTGGAAGGTCTTGTT CAC´3) and G6PD (5´CGATGGCAGAGCAGGT´3 and 5´GA ´ 3). Quantitative real-time PCR was TCTGGTCCTCACG performed in a 7000 Sequence Detection System (AppliedBiosystems, Foster City, CA, USA) (Applied Biosystems). Specificity of the desired PCR products was determined by melting curve analysis. The ratio of the abundance of the different transcripts to that of G6PD transcript was calculated as 2n, where n is the Ct (threshold cycle) value of G6PD minus the Ct value of the corresponding mRNA. For each MRP, the data were presented as fold change in relative expression levels of differentiated cells over NS cells. Positive cases were defined as those with mRNA levels two-fold higher than the levels in the NS.
Results and discussion We studied the mRNA expression of the ABCA1, MRP4 and MRP5 ABC transporters in NS and differentiated cells from GBM patients (Figs. 1a, b, c). Differentiated cells in comparison to NS showed that of the 9 GBM samples, 6 were positive for the ABCA1 (67 %), 3 for MRP4 (33.3 %) and 5 for MRP5 (55.5 %). The up-regulation of these genes has been described in other studies. Quantitative PCR and immunoblotting have been used to determine the ABCA1 expression levels in the GaMg glioblastoma cell line and in
Mol Biol Rep
B
12
Relative mRNA MRP4 levels
Relative mRNA ABCA1 levels
A 10 8 6 4 2 0
12 10 8 6 4 2 0 G48 G52 G59 G63 G73 677 G97 G33 G118
G48 G52 G59 G63 G73 677 G97 G33 G118
Relative mRNA MRP5 levels
12 10 8 6 4 2 0 G48 G52 G59 G63 G73 677 G97 G33 G118
Relative mRNA ABC transporter level sfrom positive samples
D
C
6 5 4 3 2 1 0 ABCA1
MRP4
MRP5
Fig. 1 Quantitative comparison of the ABCA1, MRP4 and MRP5 mRNA levels in differentiated glioblastoma cells. Total RNA was extracted from NS before and after differentiation, and the expression of the ABC transporters was analyzed by quantitative reverse transcriptase (RT)–PCR. ABCA1, MRP4 and MRP5 mRNA transcript level were standardized to G6PDH mRNA transcript levels. These standardized values of the differentiated GBM cells were
compared versus their respective ones of normal NS. All ABC transporters genes showed significant differences (P \ 0.01). a– c Histograms represent the mean ± SD of triplicate measurements of each ABC transporter in each sample of GBM. d Histograms represent the mean ± SD of triplicate measurements of the positive samples for each gene
the SH-SY5Y neuroblastoma cells, showing a high expression in both lines [12]. Similarly, other studies showed an increase of the MRP4 and MRP5 expression in neuroblastoma and GBM cells respectively as well as their significant correlation with a worse patient prognostic [1, 2]. Besides, these overexpressions have been enhanced by drug exposure which explains the multidrug resistance of these cancers [1, 2, 12]. On the other hand, the mean of the expression of the ABCA1, MRP4 and MRP5 mRNA from the positive differentiated cells was 4.87, 3.27 and 3.54 fold higher than each of the NS from the 9 GBM samples (Fig. 1d). These results are supported by various studies in which it has been shown an increased resistance to chemotherapy after the cell differentiation. Held- Feindt et al. [11], showed a higher resistance to temozolomide in glioma ICs generated from glioblastoma patients when they were cultured in serumcontaining medium, as NS, than in a serum-free medium, as adherent cells. When the NS were subjected to differentiation (10 % FCS) they were characterized by a high L1CAM expression that was correlated with a clearly higher sensitivity to treatment with temozolomide in comparison to the corresponding non-differentiated NS. The multi-kinase inhibitor sorafenib has a selective action on glioblastoma stem cells, with lower effects in differentiated
glioblastoma cultures, which is related to the higher resistance of the glioblastoma cultures after the differentiation [7]. Erlotinib has a moderate effect on the adherent cell lines originated from the human GBM resections while induces a strong inhibition of the cell growth on their NS counterparts [8]. Likewise, Nakai et al. [13] established a NS derived from U87 cell from GBM and compared the MDR1 and CD133 expression levels on them. They showed an increase of the MDR1 and CD133 expression levels on NS, which was related with a stronger drug-resistance. Our hypothesis is based on the hierarchical model [14] (Fig. 2). The GBM tumour nucleus is formed by ICs, which are either not expressed or expressed at very low levels of the ABC transporter, thus they could be hit for the drugs. These can self- renew and give rise to the CSCs which will differ into the SP cells and the different cellular subtypes that form the tumour mass around them. Significantly related to this process of differentiation, the expression of the ABC transporter levels will be increased. For this reason, the drugs may be released by these efflux pump and the ICs are not target. The inhibition of the ABC transporters will allow the drugs to hit the differentiated cells and the CSCs, reducing the tumour mass around the ICs being these finally beaten up, and could be affected for not expressing the ABC transporter.
123
Mol Biol Rep
ICs CSCs SP cells Differentiated cells ABC transporters ABC transporters Inhibitor Drugs
Fig. 2 Therapy based on a hierarchical model: ICs form the nucleus of the tumour. They can self- renew and give rise to the CSCs which will differ into the SP cells and the different cellular subtypes, all of them around ICs, forming the tumour mass. ICs are either not expressed or expressed at very low levels of the ABC transporter, but these expression levels increase with the process of differentiation. The drugs are efflux by the ABC transporters expressed higher in this
cell mass unable to act on the ICs. By inhibiting these ABC transporters the drugs could attack the cells of the tumour mass, reducing the tumour size and reaching the ICs. The drugs could kill ICs because they are either not expressed or expressed at very low levels of the ABC transporters, therefore the tumour could be eliminated
Future studies will be necessary to demonstrate the activity of the mechanisms of resistance and the difference of differentiated cells versus non-differentiated cells. These experiments could demonstrate the relevance of resistance in glioblastoma as a new target to the development of a therapeutic strategy against GMB treatment.
expression in glioblastoma. Cancer Chemother Pharmacol 69(5):1387–1391. doi:10.1007/s00280-012-1832-z Huynh T, Norris MD, Haber M, Henderson MJ (2012) ABCC4/ MRP4: a MYCN-regulated transporter and potential therapeutic target in neuroblastoma. Front Oncol 2:178. doi:10.3389/fonc. 2012.00178 Nambaru PK, Hubner T, Kock K, Mews S, Grube M, Payen L, Guitton J, Sendler M, Jedlitschky G, Rimmbach C, Rosskopf D, Kowalczyk DW, Kroemer HK, Weiss FU, Mayerle J, Lerch MM, Ritter CA (2011) Drug efflux transporter multidrug resistanceassociated protein 5 affects sensitivity of pancreatic cancer cell lines to the nucleoside anticancer drug 5-fluorouracil. Drug Metab Dispos 39(1):132–139. doi:10.1124/dmd.110.033613 Vik-Mo AO, Ferno J, Skrede S, Steen VM (2009) Psychotropic drugs up-regulate the expression of cholesterol transport proteins including ApoE in cultured human CNS- and liver cells. BMC Pharmacol 9:10. doi:10.1186/1471-2210-9-10 Attie AD (2007) ABCA1: at the nexus of cholesterol, HDL and atherosclerosis. Trends Biochem Sci 32(4):172–179. doi:10.1016/ j.tibs.2007.02.001 Paglialonga F, Ardissino G, Galli MA, Scarfia RV, Testa S, Edefonti A (2012) Bioimpedance analysis and cardiovascular status in pediatric patients on chronic hemodialysis. Hemodial Int 16(Suppl 1):S20–S25. doi:10.1111/j.1542-4758.2012.00743.x Carra E, Barbieri F, Marubbi D, Pattarozzi A, Favoni RE, Florio T, Daga A (2013) Sorafenib selectively depletes human
Acknowledgments This study was supported by the Instituto de Salud Carlos III (FIS) through Project n8 PI11/01862 and by the Consejerı´a de Salud de la Junta de Andalucı´a through Project n8 PI0338. We thank the collaboration of Dr. Ferna´ndez-Luna from Molecular Genetics Unit, Hospital Valdecilla and Instituto de Formacio´n e Investigacio´n Marque´s de Valdecilla (IFIMAV), Santander, Spain. Conflict of interests peting interests.
The authors declare that they have no com-
References 1. Alexiou GA, Goussia A, Voulgaris S, Fotopoulos AD, Fotakopoulos G, Ntoulia A, Zikou A, Tsekeris P, Argyropoulou MI, Kyritsis AP (2012) Prognostic significance of MRP5 immunohistochemical
123
2.
3.
4.
5.
6.
7.
Mol Biol Rep glioblastoma tumor-initiating cells from primary cultures. Cell Cycle 12(3):491–500. doi:10.4161/cc.23372 8. Eimer S, Dugay F, Airiau K, Avril T, Quillien V, Belaud-Rotureau MA, Belloc F (2012) Cyclopamine cooperates with EGFR inhibition to deplete stem-like cancer cells in glioblastomaderived spheroid cultures. Neuro oncol 14(12):1441–1451. doi:10.1093/neuonc/nos266 9. Golebiewska A, Bougnaud S, Stieber D, Brons NH, Vallar L, Hertel F, Klink B, Schrock E, Bjerkvig R, Niclou SP (2013) Side population in human glioblastoma is non-tumorigenic and characterizes brain endothelial cells. Brain 136(Pt 5):1462–1475. doi:10.1093/brain/awt025 10. Nogueira L, Ruiz-Ontanon P, Vazquez-Barquero A, Lafarga M, Berciano MT, Aldaz B, Grande L, Casafont I, Segura V, Robles EF, Suarez D, Garcia LF, Martinez-Climent JA, Fernandez-Luna JL (2011) Blockade of the NFkappaB pathway drives differentiating
11.
12.
13.
14.
glioblastoma-initiating cells into senescence both in vitro and in vivo. Oncogene 30(32):3537–3548. doi:10.1038/onc.2011.74 Held-Feindt J, Schmelz S, Hattermann K, Mentlein R, Mehdorn HM, Sebens S (2012) The neural adhesion molecule L1CAM confers chemoresistance in human glioblastomas. Neurochem Int 61(7):1183–1191. doi:10.1016/j.neuint.2012.08.011 Vik-Mo H (2009) Better results with the new generation bare metal stents. Scand Cardiovasc J 43(2):84–86. doi:10.1080/ 14017430802651829 Nakai E, Park K, Yawata T, Chihara T, Kumazawa A, Nakabayashi H, Shimizu K (2009) Enhanced MDR1 expression and chemoresistance of cancer stem cells derived from glioblastoma. Cancer Invest 27(9):901–908. doi:10.3109/07357900801946679 Mazzoleni S, Galli R (2012) Gliomagenesis: a game played by few players or a team effort? Front Biosci (Elite Ed) 4:205–213
123
