Cell Tissue Res (2015) 359:589–603 DOI 10.1007/s00441-014-2035-1
REGULAR ARTICLE
Aberrant elastin remodeling in the lungs of O2-exposed newborn mice; primarily results from perturbed interaction between integrins and elastin Wenli Han & Chunbao Guo & Qiutong Liu & Benli Yu & Zhaoyun Liu & Junqing Yang & Chun Deng
Received: 9 July 2014 / Accepted: 13 October 2014 / Published online: 27 November 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Excessive localization of elastin from septal tips to alveolar walls is a key feature of bronchopulmonary dysplasia (BPD). The abnormal accumulation of lung elastin, involving the structural and functional interaction of a series of proteins, remains poorly understood. To further investigate the mechanisms accounting for the abnormal accumulation of elastin in the lungs of newborn mice with BPD, we evaluate elastin distribution and its interaction with proteins involved in its aberrant localization, such as integrin αv, fibulin-5 and transforming growth factor β1 (TGF-β1), in lungs of newborn mice exposed to 60 % O2 for 21 days. Lung histology revealed aberrant elastin production and impaired lung septation in O 2 -exposed lungs, while tropoelastin, integrin αv, fibulin-1, fibulin-2 and fibulin4 gene expression were elevated. Dual staining image analysis of lung sections revealed that co-localization of
integrin αv and elastin increased following O2 exposure with elastin distributed throughout the walls of air spaces rather than at septal tips. Furthermore, integrin αv appeared to be induced initially. Concurrently, increased fibulin-5 and TGF-β1 (which may regulate elastic fiber assembly) expression was detected, which may explain the altered lung elastin deposition and defective septation that are observed during BPD. These data support the hypothesis that excessive and aberrant αv integrin expression was initially induced by hyperoxia; αv integrin then interacted with and recruited elastin. These alterations were accompanied by fibulin-5 deposition and TGF-β1 activation, which may impede normal matrix remodeling, thereby contributing to the pathological pulmonary features of BPD. Keywords Bronchopulmonary dysplasia . Integrin αv . Elastin . Alveolarization
Wenli Han and Chunbao Guo contributed equally to the manuscript. W. Han : Q. Liu : B. Yu : Z. Liu : C. Deng (*) Department of Neonatology, Children’s Hospital of Chongqing Medical University, Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing Medical University, Chongqing, China e-mail: [email protected] C. Deng e-mail: [email protected] W. Han : J. Yang (*) Department of Pharmacology, Chongqing Medical University, Chongqing, China e-mail: [email protected] C. Guo Department of Hepatology and Liver transplantation Center, Children’s Hospital of Chongqing Medical University, Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing Medical University, Chongqing, China
Introduction Bronchopulmonary dysplasia (BPD) typically develops as a result of long-term oxygen- and ventilation-mediated injuries, particularly in premature neonates whose lungs are incompletely developed (Bland et al. 2007a; Wang et al. 2014). In the consistent presence of oxygen-mediated injury, the host initiates a repeated process of repair and destruction, subsequently leading to tissue remodeling and resulting in structural and functional abnormalities that resemble pulmonary emphysema (Lohmann et al. 2014; McKenna et al. 2014). Failed formation and remodeling of matrix structures may affect the development of the immature lung, thereby contributing to this disorder. Perturbation of alveolar and lung microvessel formation, coupled with disordered elastin expression and widespread interstitial fibrosis in the lungs, has been
590
recognized as a prominent feature of BPD (Bland et al. 2007b, 2008; Hilgendorff et al. 2011). Elastin may intrinsically function to passively expand and contract under gas and liquid pressure gradients, providing structural integrity and distensibility to the alveoli, blood vessels and airways (Craig et al. 2013; Deslee et al. 2009; Mokres et al. 2010; Sakurai et al. 2013). The lung pathology of infants who have died with severe BPD has revealed an abnormal abundance and distribution of elastin in the connective tissue matrix surrounding the distal airspaces, accounting for the reduced septation and decreased number of alveoli (Pierce et al. 1997; Thibeault et al. 2000). Increased expression of elastin-related genes has been reported to be associated with abnormal accumulation of elastin in the terminal respiratory units, a major event precipitating the clinical pathology (Rich et al. 2003). In addition, in infants with evolving BPD, urinary excretion of desmosine, a biomarker of elastin degradation, was observed to be increased (as measured using mechanical ventilation and O2). These changes were associated with the reduced secondary septation and decreased number of alveoli that are observed during BPD (Kumarasamy et al. 2009). Although differential expression of the matrix proteins that regulate elastin synthesis and assembly was observed upon examination of the lung tissues of lambs with BPD (Bland et al. 2008), the specific mechanisms by which abnormal elastin production and deposition in blunted secondary crests contribute to failed alveolar and lung vascular formation in BPD remain unclear. Therefore, therapeutic interventions for these age-related changes have not been established. Much evidence exists indicating that tropoelastin and therefore elastin, interact directly with cells via several cell surface receptors, including elastin-binding protein (EBP), glycosaminoglycans (GAGs) and integrins, which may contribute to aberrant elastin accumulation (Blanchevoye et al. 2013; Kumarasamy et al. 2009; Merrilees et al. 2008; Miao et al. 2013; Roman et al. 1991). The interaction of tropoelastin with other extracellular matrix (ECM) proteins, such as integrin αv and fibulin-5, has not yet been evaluated in the pathological condition of BPD. We therefore designed studies to evaluate the genes and proteins that contribute to abnormal elastin deposition. Although the pathogenesis of BPD is incompletely understood, prolonged exposure to sublethal hyperoxia in animal models may recapitulate some of the processes observed during the development of BPD (Deng et al. 2011). This model allowed us to analyze the phenotypes of abnormal elastin production derived from O2 exposure, as well as evaluate the functional contributions of several genes and proteins that participate in aberrant elastin localization in distal airways and the consequent structural lesions that result from 60 % O2 exposure.
Cell Tissue Res (2015) 359:589–603
Materials and methods Animal experimental design Full-term 1-day-old C57BL/6 mice weighing 1.32±0.10 g were obtained from the experimental animal center of Chongqing Medical University. The animal studies were conducted according to protocols approved by the Chongqing Medical University Animal Use Committee. Within 24 h after delivery, littermates were randomly divided into paired chambers (containing either air or 60 % O2) for scheduled exposure periods, as previously described (Deng et al. 2011). The maternal mice were switched daily between the O2 group and the air control group to avoid oxygen toxicity-induced reductions in the nursing of the neonatal mice. Each chamber was opened for 1 h per day to water, feed, weigh, and change the dressings of the mice. The rearing conditions were identical in the two groups. Lung processing for quantitative histology To obtain lungs for histopathology on postnatal days (P) 1, 3, 7, 14 and 21, eight mice were euthanized using CO2. Endotracheal intubation was utilized to maintain the lung inflation states. The left lobe was frozen in liquid nitrogen for quantitative real-time PCR (qPCR) and western blotting. The right lobe was fixed in 4 % paraformaldehyde for hematoxylin and eosin (H&E) staining to observe the morphological structure of the lung tissue (Deng et al. 2011). All of the fixed tissue samples were embedded in paraffin and sectioned at 4 μm for histochemical analysis. To assess the amount and localization of elastin deposition in the lung tissue, the sections were stained using Gomori’s aldehyde-fuchsin method, as described previously (de Lurdes et al. 2006). Quantitative histological morphometric analyses To compare specific structural features of the lungs, we used a design-based method to systematically and randomly sample the lungs for quantitative histology. We performed quantitative morphometric assessments on the right middle lobe. The mean linear intercepts were measured, as previously described (Ashour et al. 2006). Alveolar surface area per unit of lung volume was measured, as previously described (Yi et al. 2004). Radial alveolar counts and elastic fiber density (as an index of parenchymal elastin content) were obtained, as described previously (Albertine et al. 1999; Bolender et al. 1993; Emery and Mithal 1960). Elastin staining images were used to enhance the recognition of secondary crests. Secondary crest volume density was measured (Wendel et al. 2000) using a 130-point contiguous counting grid superimposed on each (×200) image. The numbers of points that fell on the tissue and on the secondary crests are expressed as secondary crest/
Cell Tissue Res (2015) 359:589–603
tissue ratios. H&E staining and elastin staining images were randomly acquired from observations made using a light microscope in 10 non-overlapping fields per slide, with three slides per animal and five animals per group. Quantitative real-time PCR Freshly dissected lungs, obtained at the scheduled time points, were subjected to RNA extraction using TRIzol® (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR, using proprietary primers and probes (Taqman Gene Expression Assays; Applied Biosystems, Foster City, CA, USA), was applied to measure the pulmonary mRNA expression of matrix proteins known to regulate elastin synthesis and assembly (tropoelastin, integrin αv, lysyl oxidase, fibrillin-1, fibrillin-2, fibulin-4 and fibulin-5). β-actin was used as an internal control. The sequences of the primers (Life Technologies Corporation, Carlsbad, CA, USA) are shown in Table 1. The relative quantification method (Qiu et al. 2011) was used to determine the Ct values for the PCR products of the target genes and β-actin. The relative quantification formula was: 2-ΔCt ×100 %, where ΔCt=Ct (target gene) − Ct (β-actin). Western blot analyses The snap-frozen tissues were minced and lysed in lysis buffer (10 mM HEPES, pH 7.9; 10 mM KCl; 0.1 mM EDTA; 1 % Triton X-100; 1 mM glycerophosphate; 2.5 mM sodium pyrophosphate; and 1 mM sodium orthovanadate) containing a protease inhibitor (Roche). The protein concentrations in the supernatants were determined using a Pierce BCA kit (Thermo Scientific, Rockford, IL, USA). Equivalent amounts of proteins from each sample were separated on SDS-PAGE gels (Invitrogen) and were blotted electrophoretically onto 0.45-μm nitrocellulose membranes (Invitrogen). The membranes were incubated with specific diluted primary antibodies, including tropoelastin (1:600, ab21600; Abcam, Cambridge, MA, USA) and fibulin-5 (1:1,000, 12188-1-AP;
591
Proteintech, China), overnight at 4 °C. Immunoreactive bands were revealed using a 1:5,000 dilution of secondary antibodies conjugated with horseradish peroxidase and goat anti-rabbit IgG (sc-2301; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The relative intensity of the bands was evaluated using Kodak 1D software, v.3.5.4 (Kodak Scientific Imaging System, Rockville, MD, USA). Immunohistochemical localization measurements Deparaffinized tissue sections were pretreated for antigen retrieval according to the citrate buffer protocol. Immunohistochemical analyses were conducted according to protocols published elsewhere (Deng et al. 2011). Briefly, the slides were incubated for 2 h at room temperature with the primary antibodies, including tropoelastin (1:600; Abcam), elastin (1:600, ab21610; Abcam), integrin αv (1:500, ab76609; Abcam), fibulin-5 (1:200, 12188-1-AP; Proteintech) and TGF-β1 (sc-146; Santa Cruz Biotechnology). The secondary antibody anti-digoxigeninfluorescein (FITC) (Hoffmann-La Roche) was diluted 1:100 in 3 % BSA/PBS. Microscopy was performed on a Nikon 55I microscope with a DS-Fi1c camera and NIS-Elements F software. Transmission electron microscopy The lungs were perfused with ice-cold 3 % glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4). The samples were trimmed to 1.5-mm3 pieces and were sequentially stained en bloc with 1 % osmium tetroxide, 2 % tannic acid and 2 % uranyl acetate prior to dehydration and Epon embedding. Thin sections (60 nm) were placed on formvarcoated grids and were counterstained with 7 % methanolic uranyl acetate, followed by lead citrate. The sections were viewed using a Hitachi 7500 transmission electron microscope (Hitachi, Japan) at 120 kV and images were digitally captured.
Table 1 Mouse primer sequences for quantitative real-time PCR Gene
Forward primer
Reverse primer
Size (bp)
Tropoelastin
GGTGGTATTGGTGGCATCGG
GCCTTGGCTTTGACTCCTGTG
218
Fibrillin-1 Fibrillin-2 Fibulin-4 Fibulin-5 Lysyl oxidase Integrin αv Integrin β3 β-actin
CCAACTCGTGTCGGCTGTG CAACCTCGTCACAAAGTCGG CTCTGGGCGTTTCTGCTGTT GGGCTCATACTTCTGCTCG CGCAAAGAGTGAAGAACCA GGCACAAAGACCGTTGAGTA AGGGCAGTCCTCTATGTGGT CAGCCTTCCTTCTTGGGTAT
GCTGTATCTCCATTGTCTCCC TTGGCATCACCTTACATTCATC GCCATCTGTGCATTCCGTGT GATGGTGAATGGCTGGTCT GTGTCCTCCAGACAGAAGC ACCAGGACCACCGAGAAGTA CTTGGCTCTGGCTCGTTCT GCTCAGTAACAGTCCGCCTA
83 167 87 247 187 129 189 175
592
Dual immunofluorescence The blocking solution consisted of 0.1 % bovine serum albumin (BSA Fraction V; Fisher Scientific, Pittsburgh, PA, USA) in Tris buffer. Paraffin-embedded 4-μm-thick sections were incubated with the integrin αv primary antibody (host species: rabbit; isotype: IgG; 1:200, ab76609; Abcam) and elastin primary antibody (host species: mouse; isotype: IgG; 1:500, LS-B2146; LifeSpan BioSciences, Seattle, WA, USA) in the described blocking solution overnight at 4 °C, followed by several washes with phosphate-buffered saline (PBS). This process was followed by a second incubation for 1 h with donkey anti-mouse Alexa Fluor 488 (isotype: IgG; 1:200, ab21202; Invitrogen) and donkey anti-rabbit Alexa Fluor 594 (isotype: IgG; 1:200, ab21207; Invitrogen) secondary antibodies in blocking solution and rinsing with PBS. After being washed with PBS, the tissue sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000; Sigma) and mounted with glycerol. Negative control sections were incubated with either normal rabbit serum instead of the integrin αv antibody or normal mouse serum instead of the elastin antibody during all of the staining procedures and no cross-reactivity was observed. The slides were analyzed using a Zeiss Axioplan 2 fluorescence microscope (Carl Zeiss, Thornwood, NY, USA), equipped with FITC (green), PE (red) and DAPI (blue) filter sets. All the digital images were processed and merged using Photoshop software, v.6.0 (Adobe Systems, San Jose, CA, USA). ELISA analysis of lung homogenate active TGF-β1 The lung tissue samples (30–50 mg) from newborn mice exposed to O2 on P1 or P14 were homogenized with added protease inhibitor (Roche) using a method previously described (Deng et al. 2011). The protein concentrations in the supernatants were determined using a Pierce BCA kit (Thermo Scientific). Equivalent amounts of proteins (60 μg) were centrifuged and stored at −70 °C until they could be thawed for assay. Analysis of active TGF-β1 levels in lung homogenate was processed using a commercially available MB100B Mouse/Rat/Porcine TGF-beta 1 Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. All samples were analyzed in duplicate as a single batch and run with control standards. Statistical analyses The experimental data in the text and figures are expressed as means±SEM. We used Student’s unpaired t test to determine significant differences between two groups. We applied oneway analysis of variance multiple comparison tests to identify differences in mRNA expression and protein levels, as well as quantitative histological measurements in the lungs of air- and
Cell Tissue Res (2015) 359:589–603
O2-exposed pups at different time points. Statistical analyses were performed using the Prism software package, v.4 (GraphPad, San Diego, CA, USA). Differences were considered to be statistically significant if the p value was
REGULAR ARTICLE
Aberrant elastin remodeling in the lungs of O2-exposed newborn mice; primarily results from perturbed interaction between integrins and elastin Wenli Han & Chunbao Guo & Qiutong Liu & Benli Yu & Zhaoyun Liu & Junqing Yang & Chun Deng
Received: 9 July 2014 / Accepted: 13 October 2014 / Published online: 27 November 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Excessive localization of elastin from septal tips to alveolar walls is a key feature of bronchopulmonary dysplasia (BPD). The abnormal accumulation of lung elastin, involving the structural and functional interaction of a series of proteins, remains poorly understood. To further investigate the mechanisms accounting for the abnormal accumulation of elastin in the lungs of newborn mice with BPD, we evaluate elastin distribution and its interaction with proteins involved in its aberrant localization, such as integrin αv, fibulin-5 and transforming growth factor β1 (TGF-β1), in lungs of newborn mice exposed to 60 % O2 for 21 days. Lung histology revealed aberrant elastin production and impaired lung septation in O 2 -exposed lungs, while tropoelastin, integrin αv, fibulin-1, fibulin-2 and fibulin4 gene expression were elevated. Dual staining image analysis of lung sections revealed that co-localization of
integrin αv and elastin increased following O2 exposure with elastin distributed throughout the walls of air spaces rather than at septal tips. Furthermore, integrin αv appeared to be induced initially. Concurrently, increased fibulin-5 and TGF-β1 (which may regulate elastic fiber assembly) expression was detected, which may explain the altered lung elastin deposition and defective septation that are observed during BPD. These data support the hypothesis that excessive and aberrant αv integrin expression was initially induced by hyperoxia; αv integrin then interacted with and recruited elastin. These alterations were accompanied by fibulin-5 deposition and TGF-β1 activation, which may impede normal matrix remodeling, thereby contributing to the pathological pulmonary features of BPD. Keywords Bronchopulmonary dysplasia . Integrin αv . Elastin . Alveolarization
Wenli Han and Chunbao Guo contributed equally to the manuscript. W. Han : Q. Liu : B. Yu : Z. Liu : C. Deng (*) Department of Neonatology, Children’s Hospital of Chongqing Medical University, Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing Medical University, Chongqing, China e-mail: [email protected] C. Deng e-mail: [email protected] W. Han : J. Yang (*) Department of Pharmacology, Chongqing Medical University, Chongqing, China e-mail: [email protected] C. Guo Department of Hepatology and Liver transplantation Center, Children’s Hospital of Chongqing Medical University, Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing Medical University, Chongqing, China
Introduction Bronchopulmonary dysplasia (BPD) typically develops as a result of long-term oxygen- and ventilation-mediated injuries, particularly in premature neonates whose lungs are incompletely developed (Bland et al. 2007a; Wang et al. 2014). In the consistent presence of oxygen-mediated injury, the host initiates a repeated process of repair and destruction, subsequently leading to tissue remodeling and resulting in structural and functional abnormalities that resemble pulmonary emphysema (Lohmann et al. 2014; McKenna et al. 2014). Failed formation and remodeling of matrix structures may affect the development of the immature lung, thereby contributing to this disorder. Perturbation of alveolar and lung microvessel formation, coupled with disordered elastin expression and widespread interstitial fibrosis in the lungs, has been
590
recognized as a prominent feature of BPD (Bland et al. 2007b, 2008; Hilgendorff et al. 2011). Elastin may intrinsically function to passively expand and contract under gas and liquid pressure gradients, providing structural integrity and distensibility to the alveoli, blood vessels and airways (Craig et al. 2013; Deslee et al. 2009; Mokres et al. 2010; Sakurai et al. 2013). The lung pathology of infants who have died with severe BPD has revealed an abnormal abundance and distribution of elastin in the connective tissue matrix surrounding the distal airspaces, accounting for the reduced septation and decreased number of alveoli (Pierce et al. 1997; Thibeault et al. 2000). Increased expression of elastin-related genes has been reported to be associated with abnormal accumulation of elastin in the terminal respiratory units, a major event precipitating the clinical pathology (Rich et al. 2003). In addition, in infants with evolving BPD, urinary excretion of desmosine, a biomarker of elastin degradation, was observed to be increased (as measured using mechanical ventilation and O2). These changes were associated with the reduced secondary septation and decreased number of alveoli that are observed during BPD (Kumarasamy et al. 2009). Although differential expression of the matrix proteins that regulate elastin synthesis and assembly was observed upon examination of the lung tissues of lambs with BPD (Bland et al. 2008), the specific mechanisms by which abnormal elastin production and deposition in blunted secondary crests contribute to failed alveolar and lung vascular formation in BPD remain unclear. Therefore, therapeutic interventions for these age-related changes have not been established. Much evidence exists indicating that tropoelastin and therefore elastin, interact directly with cells via several cell surface receptors, including elastin-binding protein (EBP), glycosaminoglycans (GAGs) and integrins, which may contribute to aberrant elastin accumulation (Blanchevoye et al. 2013; Kumarasamy et al. 2009; Merrilees et al. 2008; Miao et al. 2013; Roman et al. 1991). The interaction of tropoelastin with other extracellular matrix (ECM) proteins, such as integrin αv and fibulin-5, has not yet been evaluated in the pathological condition of BPD. We therefore designed studies to evaluate the genes and proteins that contribute to abnormal elastin deposition. Although the pathogenesis of BPD is incompletely understood, prolonged exposure to sublethal hyperoxia in animal models may recapitulate some of the processes observed during the development of BPD (Deng et al. 2011). This model allowed us to analyze the phenotypes of abnormal elastin production derived from O2 exposure, as well as evaluate the functional contributions of several genes and proteins that participate in aberrant elastin localization in distal airways and the consequent structural lesions that result from 60 % O2 exposure.
Cell Tissue Res (2015) 359:589–603
Materials and methods Animal experimental design Full-term 1-day-old C57BL/6 mice weighing 1.32±0.10 g were obtained from the experimental animal center of Chongqing Medical University. The animal studies were conducted according to protocols approved by the Chongqing Medical University Animal Use Committee. Within 24 h after delivery, littermates were randomly divided into paired chambers (containing either air or 60 % O2) for scheduled exposure periods, as previously described (Deng et al. 2011). The maternal mice were switched daily between the O2 group and the air control group to avoid oxygen toxicity-induced reductions in the nursing of the neonatal mice. Each chamber was opened for 1 h per day to water, feed, weigh, and change the dressings of the mice. The rearing conditions were identical in the two groups. Lung processing for quantitative histology To obtain lungs for histopathology on postnatal days (P) 1, 3, 7, 14 and 21, eight mice were euthanized using CO2. Endotracheal intubation was utilized to maintain the lung inflation states. The left lobe was frozen in liquid nitrogen for quantitative real-time PCR (qPCR) and western blotting. The right lobe was fixed in 4 % paraformaldehyde for hematoxylin and eosin (H&E) staining to observe the morphological structure of the lung tissue (Deng et al. 2011). All of the fixed tissue samples were embedded in paraffin and sectioned at 4 μm for histochemical analysis. To assess the amount and localization of elastin deposition in the lung tissue, the sections were stained using Gomori’s aldehyde-fuchsin method, as described previously (de Lurdes et al. 2006). Quantitative histological morphometric analyses To compare specific structural features of the lungs, we used a design-based method to systematically and randomly sample the lungs for quantitative histology. We performed quantitative morphometric assessments on the right middle lobe. The mean linear intercepts were measured, as previously described (Ashour et al. 2006). Alveolar surface area per unit of lung volume was measured, as previously described (Yi et al. 2004). Radial alveolar counts and elastic fiber density (as an index of parenchymal elastin content) were obtained, as described previously (Albertine et al. 1999; Bolender et al. 1993; Emery and Mithal 1960). Elastin staining images were used to enhance the recognition of secondary crests. Secondary crest volume density was measured (Wendel et al. 2000) using a 130-point contiguous counting grid superimposed on each (×200) image. The numbers of points that fell on the tissue and on the secondary crests are expressed as secondary crest/
Cell Tissue Res (2015) 359:589–603
tissue ratios. H&E staining and elastin staining images were randomly acquired from observations made using a light microscope in 10 non-overlapping fields per slide, with three slides per animal and five animals per group. Quantitative real-time PCR Freshly dissected lungs, obtained at the scheduled time points, were subjected to RNA extraction using TRIzol® (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR, using proprietary primers and probes (Taqman Gene Expression Assays; Applied Biosystems, Foster City, CA, USA), was applied to measure the pulmonary mRNA expression of matrix proteins known to regulate elastin synthesis and assembly (tropoelastin, integrin αv, lysyl oxidase, fibrillin-1, fibrillin-2, fibulin-4 and fibulin-5). β-actin was used as an internal control. The sequences of the primers (Life Technologies Corporation, Carlsbad, CA, USA) are shown in Table 1. The relative quantification method (Qiu et al. 2011) was used to determine the Ct values for the PCR products of the target genes and β-actin. The relative quantification formula was: 2-ΔCt ×100 %, where ΔCt=Ct (target gene) − Ct (β-actin). Western blot analyses The snap-frozen tissues were minced and lysed in lysis buffer (10 mM HEPES, pH 7.9; 10 mM KCl; 0.1 mM EDTA; 1 % Triton X-100; 1 mM glycerophosphate; 2.5 mM sodium pyrophosphate; and 1 mM sodium orthovanadate) containing a protease inhibitor (Roche). The protein concentrations in the supernatants were determined using a Pierce BCA kit (Thermo Scientific, Rockford, IL, USA). Equivalent amounts of proteins from each sample were separated on SDS-PAGE gels (Invitrogen) and were blotted electrophoretically onto 0.45-μm nitrocellulose membranes (Invitrogen). The membranes were incubated with specific diluted primary antibodies, including tropoelastin (1:600, ab21600; Abcam, Cambridge, MA, USA) and fibulin-5 (1:1,000, 12188-1-AP;
591
Proteintech, China), overnight at 4 °C. Immunoreactive bands were revealed using a 1:5,000 dilution of secondary antibodies conjugated with horseradish peroxidase and goat anti-rabbit IgG (sc-2301; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The relative intensity of the bands was evaluated using Kodak 1D software, v.3.5.4 (Kodak Scientific Imaging System, Rockville, MD, USA). Immunohistochemical localization measurements Deparaffinized tissue sections were pretreated for antigen retrieval according to the citrate buffer protocol. Immunohistochemical analyses were conducted according to protocols published elsewhere (Deng et al. 2011). Briefly, the slides were incubated for 2 h at room temperature with the primary antibodies, including tropoelastin (1:600; Abcam), elastin (1:600, ab21610; Abcam), integrin αv (1:500, ab76609; Abcam), fibulin-5 (1:200, 12188-1-AP; Proteintech) and TGF-β1 (sc-146; Santa Cruz Biotechnology). The secondary antibody anti-digoxigeninfluorescein (FITC) (Hoffmann-La Roche) was diluted 1:100 in 3 % BSA/PBS. Microscopy was performed on a Nikon 55I microscope with a DS-Fi1c camera and NIS-Elements F software. Transmission electron microscopy The lungs were perfused with ice-cold 3 % glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4). The samples were trimmed to 1.5-mm3 pieces and were sequentially stained en bloc with 1 % osmium tetroxide, 2 % tannic acid and 2 % uranyl acetate prior to dehydration and Epon embedding. Thin sections (60 nm) were placed on formvarcoated grids and were counterstained with 7 % methanolic uranyl acetate, followed by lead citrate. The sections were viewed using a Hitachi 7500 transmission electron microscope (Hitachi, Japan) at 120 kV and images were digitally captured.
Table 1 Mouse primer sequences for quantitative real-time PCR Gene
Forward primer
Reverse primer
Size (bp)
Tropoelastin
GGTGGTATTGGTGGCATCGG
GCCTTGGCTTTGACTCCTGTG
218
Fibrillin-1 Fibrillin-2 Fibulin-4 Fibulin-5 Lysyl oxidase Integrin αv Integrin β3 β-actin
CCAACTCGTGTCGGCTGTG CAACCTCGTCACAAAGTCGG CTCTGGGCGTTTCTGCTGTT GGGCTCATACTTCTGCTCG CGCAAAGAGTGAAGAACCA GGCACAAAGACCGTTGAGTA AGGGCAGTCCTCTATGTGGT CAGCCTTCCTTCTTGGGTAT
GCTGTATCTCCATTGTCTCCC TTGGCATCACCTTACATTCATC GCCATCTGTGCATTCCGTGT GATGGTGAATGGCTGGTCT GTGTCCTCCAGACAGAAGC ACCAGGACCACCGAGAAGTA CTTGGCTCTGGCTCGTTCT GCTCAGTAACAGTCCGCCTA
83 167 87 247 187 129 189 175
592
Dual immunofluorescence The blocking solution consisted of 0.1 % bovine serum albumin (BSA Fraction V; Fisher Scientific, Pittsburgh, PA, USA) in Tris buffer. Paraffin-embedded 4-μm-thick sections were incubated with the integrin αv primary antibody (host species: rabbit; isotype: IgG; 1:200, ab76609; Abcam) and elastin primary antibody (host species: mouse; isotype: IgG; 1:500, LS-B2146; LifeSpan BioSciences, Seattle, WA, USA) in the described blocking solution overnight at 4 °C, followed by several washes with phosphate-buffered saline (PBS). This process was followed by a second incubation for 1 h with donkey anti-mouse Alexa Fluor 488 (isotype: IgG; 1:200, ab21202; Invitrogen) and donkey anti-rabbit Alexa Fluor 594 (isotype: IgG; 1:200, ab21207; Invitrogen) secondary antibodies in blocking solution and rinsing with PBS. After being washed with PBS, the tissue sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000; Sigma) and mounted with glycerol. Negative control sections were incubated with either normal rabbit serum instead of the integrin αv antibody or normal mouse serum instead of the elastin antibody during all of the staining procedures and no cross-reactivity was observed. The slides were analyzed using a Zeiss Axioplan 2 fluorescence microscope (Carl Zeiss, Thornwood, NY, USA), equipped with FITC (green), PE (red) and DAPI (blue) filter sets. All the digital images were processed and merged using Photoshop software, v.6.0 (Adobe Systems, San Jose, CA, USA). ELISA analysis of lung homogenate active TGF-β1 The lung tissue samples (30–50 mg) from newborn mice exposed to O2 on P1 or P14 were homogenized with added protease inhibitor (Roche) using a method previously described (Deng et al. 2011). The protein concentrations in the supernatants were determined using a Pierce BCA kit (Thermo Scientific). Equivalent amounts of proteins (60 μg) were centrifuged and stored at −70 °C until they could be thawed for assay. Analysis of active TGF-β1 levels in lung homogenate was processed using a commercially available MB100B Mouse/Rat/Porcine TGF-beta 1 Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. All samples were analyzed in duplicate as a single batch and run with control standards. Statistical analyses The experimental data in the text and figures are expressed as means±SEM. We used Student’s unpaired t test to determine significant differences between two groups. We applied oneway analysis of variance multiple comparison tests to identify differences in mRNA expression and protein levels, as well as quantitative histological measurements in the lungs of air- and
Cell Tissue Res (2015) 359:589–603
O2-exposed pups at different time points. Statistical analyses were performed using the Prism software package, v.4 (GraphPad, San Diego, CA, USA). Differences were considered to be statistically significant if the p value was
