Leukemia & Lymphoma, 2014; Early Online: 1–9 © 2014 Informa UK, Ltd. ISSN: 1042-8194 print / 1029-2403 online DOI: 10.3109/10428194.2014.913287
ORIGINAL ARTICLE: RESEARCH
Abnormal expression of CD66a promotes proliferation and inhibits apoptosis of human leukemic B cells in vitro Wenjin Zhao1, Yan Zhang2, Dandan Liu3, Liansheng Zhong3, Qun He3 & Yujie Zhao3 1Center of Laboratory Technology and 3Biochip Center and State Key Lab of Cell Biology, China Medical University, Shenyang,
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Liaoning, China and 2Department of Biochemistry, Shenyang Medical College, Shenyang, Liaoning, China
the CD66 family, CD66a is abundantly expressed in epithelial and vessel endothelial cells as well as blood cells in normal tissues [9]. Within the hematopoietic system, CD66a is usually expressed on myeloid cells (especially on granulocytes), and it can also be found on activated T cells and natural killer (NK) cell subpopulations [10]. Although the abnormal expression of CD66a on the surface of leukemic B cells is a well-documented phenomenon, little is known about the biological function of this aberrant expression. CD66a as an adhesion molecule is associated with cell proliferation, apoptosis, invasion, migration and morphogenesis [11]. A very important feature of CD66a is that it plays a dual role in different cancers. Studies have shown that CD66a is down-regulated in some cancers [12–14], and re-expression of CD66a in colon and prostate cancer can inhibit tumor growth [15,16]. However, CD66a expression in other cancers is up-regulated, and contributes to the development and progression of the tumor, including thyroid cancer, non-small cell lung cancer and malignant melanoma [17–19]. It has been reported that the tumorinhibiting effect of CD66a depends on the cytoplasmic domain of CD66a-4L [20]. CD66a has two major isoforms due to differential splicing: CD66a-4L (long cytoplasmic domain of 71–73 amino acids) and CD66a-4S (short cytoplasmic domain of 10–12 amino acids), which differ only in their cytoplasmic domains. In most cell types and tissues CD66a-4L and CD66a-4S are expressed together, but at characteristically different ratios, and they have different signaling activities [21]. The L isoform, but not the S isoform, contains two highly conserved, phosphorylatable tyrosine residues in its cytoplasmic domain, which play essential roles in tumor inhibition [22]. Although CD66a-4L can inhibit tumor growth in vivo, the effect is not a simple function of CD66a-4L expression. In fact, the ratio of expression levels of the L and S isoforms is the determining factor for regulating the tumor-inhibitory effect of CD66a-4L. It was found that the L isoform acted as a dominant growth inhibitor
Abstract The aberrant expression of myeloid antigen CD66 on acute B-lymphoblastic leukemia (B-ALL) cells is a well-documented phenomenon. CD66a is a major subtype of the CD66 family which plays a dual role in different cancers, and the contradictory effect may depend on the isoform ratio of CD66a-4L to CD66a-4S. Although the abnormal expression of CD66a on leukemic B-cells has been reported widely, little is known about the biological function of this aberrant expression. In this study, we showed that inhibition of CD66a in human B-ALL cell lines reduced the cellular proliferative rate and increased the percentage of cellular apoptosis, and the ratio of CD66a-4L to CD66a-4S in leukemic B cells is much higher than that in granulocytes. In addition, alteration of the L:S ratio by silencing and overexpressing the L isoform in B-ALL cell lines confirmed that a high L:S ratio of CD66a in leukemic B cells promotes proliferation and inhibits FasL-induced apoptosis. Keywords: CD66a, acute leukemic B cells, proliferation, apoptosis
Introduction CD66a, also known as CEACAM1, a member of the CD66 antigen family, is a transmembrane multifunctional adhesion molecule, belonging to the carcinoembryonic antigen (CEA) family [1–3]. The CD66 family can be divided into CD66a– CD66e subtypes, and CD66a–CD66d are mainly expressed on the surface of myeloid cells in normal hematopoiesis; CD66e has been found only on epithelial cells, and does not occur in hematopoietic cells [4,5]. Although the CD66 family has been identified as a myeloid marker, a number of reports have shown that CD66 is abnormally expressed on the membrane of B-lymphocytes in cases of acute B-lymphoblastic leukemia (B-ALL) [6–8]. Furthermore, it has been observed that the CD66/CD34 combination can be used to detect minimal residual disease (MRD) in B-ALL, and the CD66 reactivity can be attributed to CD66c reactivity and/or CD66a up-regulation in leukemic B cells [8]. As a major subtype of
Correspondence: Yujie Zhao, Biochip Center and State Key Lab of Cell Biology, China Medical University, Beier Road 92, Heping District, Shenyang, Liaoning, 110001, China. Tel: (⫹ 86)024-23251393. Fax: (⫹ 86)024-23251393. E-mail: [email protected] Received 25 October 2013; revised 28 March 2014; accepted 3 April 2014
1
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
2 W. Zhao et al. when the ratio of L:S expression remained within normal physiological levels, but overexpression of the L isoform, consequently increasing the ratio of the two isoforms, led to abrogation of its tumor suppressor phenotype [23]. Therefore, besides the total expression level of CD66a on the cell surface, the actual effect of CD66a on cancer cells may depend on the expression patterns of the two isoforms of CD66a. In view of the facts that CD66a has a contradictory feature in cancer cells and there is little information about the role of CD66a in B-ALL, the biological function of this molecule in leukemic B cells needs to be studied. In our study, we found that inhibition of CD66a in B-ALL cell lines led to a reduced cellular proliferative rate and an increased percentage of cellular apoptosis. We also found that the isoform ratio of CD66a-4L to CD66a-4S in B-ALL cell lines is much higher than that in granulocytes. Since the effect of CD66a on cancer cells is related to the ratio of CD66a-L to CD66a-S, we examined the correlation between the ratio L:S and the growth of leukemic B cells in human B-ALL cell lines BALL-1 and CCRF-SB, which were originally obtained from the peripheral blood of patients with B-ALL. Alteration of the L:S ratio by silencing and overexpressing the L isoform confirmed that a high L:S ratio in leukemic B cells contributes to cellular proliferation and inhibits FasL-induced apoptosis.
Materials and methods Cell culture and isolation of granulocytes Human acute B-lymphoblastic leukemia cell lines BALL-1 (Riken Cell Bank, Japan) and CCRF-SB (American Type Culture Collection) were grown in Dulbecco’s modified Eagle medium (DMEM) and RPMI 1640 medium, respectively. All media contained 10% fetal bovine serum (HyClone). Cells were cultured in a humidified atmosphere of 5% CO2 at 37°C. Granulocytes were isolated from peripheral blood (treated with heparin) of five healthy volunteers using Histopaque1119 and Histopaque-1077 (Sigma Aldrich). The purity of the isolated granulocytes was more than 98% as determined with flow cytometry using anti-CD16b–phycoerythrin (PE) (BD Pharmingen), a specific marker for granulocytes.
CD66 expression by flow cytometry analysis For the detection of cell surface expression of CD66, 5 ⫻ 105 leukemic B cells and granulocytes were resuspended in phosphate buffered saline (PBS) and incubated for 30 min at 4°C with 20 μL fluorescein isothiocyanate (FITC)-conjugated pan-CD66 antibody B1.1 (a monoclonal antibody able to recognize CD66a, CD66c, CD66d, CD66e; BD Pharmingen). After being washed three times, cells were resuspended in PBS and analyzed immediately by flow cytometry using a FACSCalibur flow cytometer and CellQuest software (Becton Dickinson). An isotype-matched negative control (BD Pharmingen) was used in all cases to assess background fluorescence intensity.
siRNA electroporation siRNA duplexes against CD66a, CD66a-L and negative control were synthesized by GenePharma. The following siRNA
duplexes were used: CD66a siRNA (siCD66a, containing three different targeted oligonucleotides for all the variants of CD66a), sense 5′-GACCCAC CUAACAAGAUGATT-3′ and antisense 5′-UCAUCUUGUUAGGUGGGUCTT-3′; sense 5′-GAGCUCUUUAUCCCUAACATT-3′ and antisense 5′-UGUUA GGGAUAAAGAGCUC TT-3′; sense 5′-GCUGAACGUAAACU AUAAUTT-3′ and antisense 5′-AUUAUAGUUUACGUUCA GCTT-3′; CD66a-L siRNA (containing three different targeted oligonucleotides), sense 5′-CCCAUCAUGCUGAACGUAAA CUAUA-3′ and antisense UAUAGUUUACGUUCAGCAUGA UGGG-3′;sense5′-GGACGUAUUGGUGUGAGGUCUUCAA-3′ and antisense 5′-UUGAAGACCUCACACCAAUACGUCC-3′; sense 5′-CACAAACCCUCAGUCUCCAACCACA-3′ and antisense 5′-UGUGGUUGGAGACUGAGGGUUUGUG-3′; negative control (sicontrol), sense 5′-UUCUCCGAACGUGUCAC GUTT-3′ and antisense 5′-ACGUGACACGUUCGGAGAATT-3′, which bears no homology with relevant human genes. Prior to electroporation, 2 ⫻ 106 B cells were washed twice and resuspended in 200 μL Opti-MEM (Invitrogen). Subsequently, 200 μL of the cell suspension was mixed with 5 μg of siRNA in a standard 0.4 cm cuvette and electroporated at 340 V for 4 ms using an Electro Square Porator ECM 830 (BTX). After electroporation, fresh complete medium was added to the cell suspension and cells were incubated further at 37°C with 5% CO2.
Quantitative real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. RNA concentrations were quantified by spectrometry and were reverse-transcribed using oligo (dT) primer and a Takara PrimeScript RT reagent kit (Takara). The mRNA levels of CD66 were examined by quantitative real-time polymerase chain reaction (QRT-PCR) using a SYBR Premix Ex Taq™II kit (Takara) and calculated employing the 2⫺ΔΔCT method. The amplification condition was 30 s at 95°C followed by 40 cycles of 5 s at 95°C, 20 s at 60°C in a LightCycler (Roche Diagnostics). Primers for detection of CD66 subtypes expressed on leukemic B cells and granulocytes were (Takara): CD66a, 5’-GCCTCTCACCTGGGGCCATT-3′ and 5’-TGGTCCTGAGCTG CCGGTCTT-3′ (116 bp); CD66b, 5’-GCGGAACGTCACCAGAAATG-3′ and 5’-GAGTC TCCGGATGTACGCTG-3′ (107 bp); CD66c, 5′-GCTCTGATATAGCAGCCCTGGTG-3′ and 5′-CTTCAGGAGCAGAGCAGACCTTG-3′ (141 bp); CD66d, 5’-GTGGGTTGATGGAGAGTCCC-3′ and 5’-GAGAGGCCTT TGTCCTGACC-3′ (196 bp); β-actin, 5’-TGGCA CCCAGCACAATGAA-3’ and 5’-CTAAGTCATAGTCCGCCTAGAAGCA -3’ (186 bp). To evaluate the effect of CD66a gene silencing, primers for all the variants of CD66a were used (Takara): 5’-GACCACTCCAATGACCCACC-3′ and 5’-GGGAGGCTGAA GTTGGTT GT-3′. To detect the ratio of L:S, the following primers were used (Takara): L isoform, 5’-CAACCCAATCAGTAAGAACCAA-3’ and 5’-CGCTGGTCGCTTGCC-3’; S isoform, 5’-GACCCCATCATGCTGAACGT-3’ and 5’-CATTGGAGTGGTCCTGAGCT-3’. Each sample was analyzed in triplicate and normalized to levels of the housekeeping gene β-actin.
Effect of CD66a on leukemic B cells
Plasmid construction and transfection
Assay of FasL-induced apoptosis
To increase the ratio of L:S in BALL-1 and CCRF-SB cells, CD66a-L expression plasmids were constructed with pcDNA3.1 vectors (Invitrogen). Briefly, the full-length of CD66a-L cDNA was amplified from a liver cDNA library of human normal tissue (Invitrogen) and inserted into the pcDNA3.1 vectors using a pENTR Directional TOPO® Cloning Kit (Invitrogen). All constructed plasmids were confirmed by DNA sequencing. An empty expression plasmid of the same type was used as a control. For transfection, 200 μL of cell suspension (2.5 ⫻ 107 cells/mL) and 10 μg of plasmid were mixed in a 0.4 cm cuvette and electroporated at 360 V for 7 ms.
After silencing and overexpressing L isoform for 48 h, the transfected cells were treated with 100 ng/mL of recombinant human FasL (BD Pharmingen) for 4 h to induce apoptosis. Apoptotic cell death was evaluated using a FITC– annexin V/propidium iodide (PI) double-staining kit (KeyGEN Biotech) according to the manufacturer’s instructions. Briefly, the FasL-treated cells were washed with PBS and resuspended in 500 μL binding buffer with 5 μL annexin V and 5 μL propidium iodide. The apoptosis assay of CD66a gene silencing was also performed at 48 h after transfection. Stained cells were analyzed by flow cytometry and all observations were reproduced at least three times in independent experiments.
Western blot Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
3
Protein extracts were equally loaded on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels, and subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). After blocking with 5% non-fat milk in PBS, the membranes were incubated with primary antibodies. The following antibodies were used: rabbit polyclonal antibody against CD66 (BD Pharmingen), mouse monoclonal antibody against β-actin (Santa Cruz) and goat anti-rabbit and goat anti-mouse horseradish peroxidase (HRP)-linked secondary antibodies (Cell Signaling). Detection was performed using a chemiluminescence phototope-HRP kit (Thermo Scientific).
FasL-treated cells were lysed and lysates were assayed for caspase 2, 3, 8 and 9 activities using an ApoAlert Caspase Profiling Assay Plate (Clontech) according to the manufacturer’s instructions. Plates were analyzed in the fluorescence plate reader with excitation at 360 nm and emission at 480 nm. The role of caspase activation in apoptosis was confirmed by performing FasL culture in the presence of the caspase inhibitor Z-VAD-FMK (100 μM final concentration).
Cell proliferation analysis
Statistical analysis
Cell proliferation was measured using a 5-bromo-2deoxyuridine (BrdU) staining kit (eBioscience) according to the manufacturer’s instructions. Briefly, 2 ⫻ 105 cells at 48 h after transfection were incubated with 10 μM BrdU for 1 h at 37°C with 5% CO2, then stained with FITC-conjugated antiBrdU antibody for 0.5 h at room temperature after permeabilization. Stained cells were analyzed by flow cytometry.
Statistical significance was analyzed by the use of Student’s t-test. A value of p ⬍ 0.05 was considered to be statistically significant.
CCK-8 assay Briefly, cells were seeded into 96-well (3000 cells/well) plates and incubated with CCK-8 solution (Dojindo, Japan) for 2 h at 37°C with 5% CO2, followed by detection with a microplate reader at 450 nm absorbance (BioRad). Cells were analyzed at 12, 24, 36 and 48 h after transfection.
Analysis of caspase activity
Results CD66a surface expression on BALL-1 and CCRF-SB cells For the reason that there is no specific anti-CD66a antibody produced commercially, we used pan-CD66 antibody to measure the surface expression of CD66 on BALL-1 and CCRF-SB cells. Flow cytometry analysis showed that CD66 is expressed on both cells [Figure 1(A)]. Primers of CD66a, b, c and d were designed for QRT-PCR to detect the subtypes of CD66 expressed in the two cell lines, and the results
Figure 1. CD66a surface expression on BALL-1 and CCRF-SB cells. (A) CD66 surface expression on BALL-1 and CCRF-SB cells (filled graph) was measured by flow cytometry using pan-CD66 antibody. Dotted curves obtained with an isotype control antibody indicate background fluorescence. (B) BALL-1 and CCRF-SB cells express only CD66a and granulocytes express different levels of CD66a–d as determined by QRT-PCR analysis. Results are the means of three independent determinations (normalized to β-actin).
4 W. Zhao et al. showed that only CD66a exists in BALL-1 and CCRF-SB cells [Figure 1(B)].
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Effect of CD66a inhibition on proliferation and apoptosis of leukemic B cells Suppression of CD66a by siRNA in BALL-1 and CCRF-SB cells was confirmed at the mRNA level by QRT-PCR analysis 36 h after electroporation [Figure 2(A)] and at the protein level by Western blot analysis 48 h after electroporation [Figure 2(B)]. Data of the BrdU staining assay showed that inhibition of CD66a in BALL-1 and CCRF-SB cells significantly reduced the number of BrdU positive cells compared to sicontrol [Figure 2(C)], and the data of double-staining showed that the mean percentage of apoptosis (annexin V-positive, PInegative) for CD66a-inhibited cells increased significantly compared to sicontrols [Figure 2(D), lower right quadrant]. These results demonstrated that CD66a expression in leukemic B cells contributes to cell proliferation and inhibits cell apoptosis.
Difference of isoform ratio of CD66a between leukemic B cells and granulocytes To determine whether the expression of CD66a in leukemic B cells is different from that in granulocytes, we compared the isoform ratio of CD66a between these cells. Expression of CD66 on granulocytes was confirmed by flow cytometry analysis [Figure 3(A)] and CD66a–d were coexpressed in granulocytes [Figure 1(B)]. Because there is no antibody specific for the L or S isoform of CD66a, we decided to analyze the expression patterns of the two isoforms in more detail at the mRNA level. Specific primers that could distinguish between CD66a-L and CD66a-S were designed to analyze mRNA levels of the two differentially spliced isoforms. QRT-PCR analysis showed that the L and S isoforms were coexpressed in both granulocytes and leukemic B cells, but the L:S ratios differed significantly between granulocytes and leukemic B cells. A CD66a L:S ratio of 2.35 ⫾ 0.12 was found in granulocytes and the L:S ratio in BALL-1 and CCRF-SB cells
Figure 2. Effect of CD66a inhibition on the proliferation and apoptosis of leukemic B cells. (A) Suppression of CD66a by siRNA was verified at the mRNA level by QRT-PCR analysis. Data are mean ⫾ SD of triplicate determinations (*p ⬍ 0.05). (B) Inhibition of CD66a expression was confirmed at the protein level by Western blot. (C) BrdU positive rate of siCD66a cells declined compared to sicontrol cells in both BALL-1 and CCRF-SB cells as determined by BrdU staining assay at 48 h after transfection (*p ⬍ 0.05). (D) siCD66a treatment resulted in an increase of apoptosis compared to sicontrol at 48 h after transfection in both BALL-1 and CCRF-SB cells (p ⬍ 0.05). Values are means of three independent experiments and representative results are shown.
Effect of CD66a on leukemic B cells
5
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Figure 3. Difference of CD66a isoform ratios between granulocytes and leukemic B cells. (A) Expression of CD66 on granulocytes was confirmed by flow cytometry. (B) L:S ratio of CD66a in granulocytes was 2.35 ⫾ 0.12 and the L:S ratio in BALL-1 and CCRF-SB cells reached up to 24.2 ⫾ 0.33 and 19.3 ⫾ 0.29 as determined by QRT-PCR analysis, respectively (*p ⬍ 0.05, n ⫽ 5).
reached up to 24.2 ⫾ 0.33 and 19.3 ⫾ 0.29, respectively [Figure 3(B)].
from 24.2 ⫾ 0.33 to 150.8 ⫾ 1.23 in BALL-1 cells and from 19.3 ⫾ 0.29 to 142.7 ⫾ 1.34 in CCRF-SB cells [Figure 4(D)].
Alteration of L:S ratio of CD66a by changing L-isoform expression level
High L:S ratio of CD66a promotes proliferation of leukemic B cells
To determine the relationship between the high L:S ratio of CD66a and the growth of leukemic B cells, we altered the ratio of L:S by silencing and overexpressing the L isoform to detect changes in proliferation and apoptosis of BALL-1 and CCRF-SB cells. Knockdown of CD66a-L by siRNA led to a significant down-regulation of CD66a expression in the two cell lines [Figure 4(A)] and reduced the ratio of L:S from 24.2 ⫾ 0.33 to 10.6 ⫾ 0.58 in BALL-1 cells and from 19.3 ⫾ 0.29 to 9.5 ⫾ 0.3 in CCRF-SB cells compared to their controls [Figure 4(B)]. On the other hand, to increase the L:S ratio, CD66a-L expression plasmids were constructed and transfected into BALL-1 and CCRF-SB cells, respectively. Overexpression of CD66a-L led to a significant up-regulation of CD66a expression in both cells [Figure 4(C)] and increased the L:S ratio
To examine the effect of the L:S ratio on the proliferation of leukemic B cells, we used the CCK-8 assay and BrdU staining assay to measure the proliferative status of BALL-1 and CCRF-SB cells after changing the ratio of L:S. The results of the CCK-8 assay showed that a lower L:S ratio significantly reduced the number of live cells and a higher ratio of L:S significantly increased the cell number in both BALL-1 and CCRF-SB cells compared to their controls [Figures 5(A) and 5(B)]. Data of the BrdU staining assay showed that a lower L:S ratio significantly reduced the level of BrdU positive cells, whereas a higher ratio of L:S significantly increased the level of BrdU positive cells [Figures 5(C) and 5(D)], which demonstrated that CD66a with a high ratio of L:S is conducive to the proliferation of leukemic B cells.
Figure 4. Alteration of L:S ratio by silencing and overexpressing L isoform in BALL-1 and CCRF-SB cells. (A) Knockdown of CD66a-L led to downregulation of CD66a expression in BALL-1 and CCRF-SB cells as determined by Western blot. (B) Knockdown of L isoform reduced the ratio of L:S from 24.2 ⫾ 0.33 to 10.6 ⫾ 0.58 in BALL-1 cells and from 19.3 ⫾ 0.29 to 9.5 ⫾ 0.3 in CCRF-SB cells (*p ⬍ 0.05). (C) Overexpression of CD66a-L led to up-regulation of CD66a expression in BALL-1 and CCRF-SB cells as determined by Western blot. (D) Overexpression of L isoform increased the L:S ratio from 24.2 ⫾ 0.33 to 150.8 ⫾ 1.23 in BALL-1 cells and from 19.3 ⫾ 0.29 to 142.7 ⫾ 1.34 in CCRF-SB cells (*p ⬍ 0.05).
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
6 W. Zhao et al.
Figure 5. Effect of L:S ratio on proliferation of BALL-1 and CCRF-SB cells. (A, B) Lower L:S ratio (si-L) significantly reduced the number of live cells in both BALL-1 and CCRF-SB cells compared to their controls, whereas higher ratio of L:S (pcDNA3.1-L) significantly increased the cell number as determined by CCK-8 assay (p ⬍ 0.05). (C, D) BrdU positive rate declined in cells with lower L:S ratio and increased in cells with higher L:S ratio compared to their controls in both BALL-1 and CCRF-SB cells as determined by BrdU staining assay at 48 h after transfection (*p ⬍ 0.05).
CD66a aberrantly expressed in leukemic B cells inhibits FasL-induced apoptosis by decreasing caspase activities To investigate whether CD66a with a high L:S ratio affects apoptosis, we examined the effect of the L:S ratio on FasLinduced apoptosis in BALL-1 and CCRF-SB cells. This was analyzed by comparing the percentage of apoptosis in cells cultured for 4 h with FasL using FITC–annexin V/PI doublestaining after changing the L:S ratio. A lower ratio of L:S caused by knockdown of the L isoform markedly increased the percentage of apoptosis compared to sicontrol after treatment with FasL, which was abrogated by addition of the broad-spectrum caspase inhibitor Z-VAD-FMK [Figure 6(A)]. A higher ratio of L:S caused by overexpression of the L isoform decreased the level of apoptotic cells compared to control after incubation with FasL, and the addition of Z-VAD-FMK caused a further decline in the level of apoptosis [Figure 6(B)]. We examined caspase activities in FasL-treated cells and found that a lower L:S ratio of CD66a in both BALL-1 and CCRF-SB cells induced a significant activation of caspase-3 and caspase-8 compared to their controls after FasL treatment. Smaller but statistically significant changes in caspase-2 and -9 activities were also observed in both cells [Figure 7(A)]. In contrast, reduced apoptosis caused by a higer L:S ratio of CD66a in both BALL-1 and CCRF-SB cells was associated with significant decreases in caspase-3 and
caspase-8 activities and small decreases in caspase-2 and caspase-9 activities, compared to their controls after FasL treatment [Figure 7(B)]. These findings demonstrated that CD66a with a high L:S ratio inhibits FasL-induced apoptosis by decreasing caspase activities, especially the activities of caspase-3 and caspase-8.
Discussion Leukemia cells often show an altered protein expression pattern, one of which is a change in the antigen molecules present on the surface of leukemia cells, such as CD66a. CD66a is a myeloid antigen but is aberrantly expressed on acute B-cell leukemia. Acute leukemia is a rapidly progressive disease that results in the accumulation of immature, ineffective leukocytes in the marrow and blood. These abnormal leukocytes do not die easily and flood the bloodstream, crowding out the normal leukocytes; hence our study focused on investigating the effect of CD66a on the proliferation and apoptosis of leukemic B cells. We used B-ALL cell lines BALL-1 and CCRF-SB for our study because both cell lines carry only the CD66a subtype, which was confirmed by QRT-PCR analysis. To evaluate the effect of CD66a on leukemic B cells, we inhibited CD66a expression by siRNA and tested its involvement in the regulation of proliferation and apoptosis. CD66a functions primarily via homophilic
7
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Effect of CD66a on leukemic B cells
Figure 6. Effect of L:S ratio on FasL-induced apoptosis in leukemic B cells. (A) Lower L:S ratio of CD66a promoted apoptosis in FasL-treated BALL-1 and CCRF-SB cells compared to controls, and the response was abrogated by addition of the caspase inhibitor Z-VAD-FMK as determined by double-staining (p ⬍ 0.05). (B) Higher L:S ratio of CD66a inhibited apoptosis in FasL-treated BALL-1 and CCRF-SB cells compared to controls, and Z-VAD-FMK caused a further decline in the level of apoptosis (p ⬍ 0.05). Values are means of three independent experiments and representative results are shown.
binding, i.e. it binds to itself [24], so the reduced intercellular CD66a–CD66a interaction caused by gene silencing may reduce the effect of CD66a on leukemic B cells. Our results showed that CD66a gene silencing results in a decreased proliferative rate and an increased percentage of apoptosis
in BALL-1 and CCRF-SB cells, meaning that CD66a contributes to cell proliferation and plays an anti-apoptotic role in leukemic B cells. In addition, we also found that the isoform ratio of CD66a-4L to CD66a-4S in leukemic B cells is much higher than that in granulocytes.
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
8 W. Zhao et al.
Figure 7. Analysis of caspase activities in FasL-treated leukemic B cells. (A) Lower L:S ratio of CD66a in both BALL-1 and CCRF-SB cells induced a significant activation of caspase-3 and caspase-8 after FasL treatment. (B) Higher L:S ratio of CD66a in BALL-1 and CCRF-SB cells reduced caspase-3 and caspase-8 activities after FasL treatment. Changes in caspase-2 and -9 activities were of a lesser magnitude in all experiments. Values of caspase activities are represented as ratios relative to control cells with FasL treatment. Data are means of three independent experiments (*p ⬍ 0.05).
Since myeloid antigen CD66a is aberrantly expressed in some human B-ALL samples and the function of CD66a in cancer cells is related to the ratio of CD66a-L to CD66a-S based on these previous reports, we speculated that a high L:S ratio of CD66a may be involved in the pathogenesis of this subset of patients with B-ALL. In our study, alteration of the L:S ratio by silencing and overexpressing the L isoform in B-ALL cell lines confirmed that a higher L:S ratio of CD66a in leukemic B cells promotes proliferation and a lower L:S ratio plays an opposite role. These findings are consistent with a previous study of Singer et al, in which an increased ratio of CD66a-L to CD66a-S could lose the inhibitory effect on proliferation and conversely stimulate proliferation in a rat prostate epithelial cell line NbE and bladder carcinoma-derived NBT4II cell line, respectively [25]. Singer et al. revealed that actively proliferating cells of both cell lines acquired an almost identical CD66a isoform ratio (increased ratio of L to S), indicating that this expression pattern of CD66a is functionally associated with and is important for the proliferative state of rodent epithelial cells. Similar expression patterns have also been observed in proliferating, regenerating hepatocytes [26] and in proliferating placental trophoblasts [27]. Furthermore, it was reported that the L isoform of CD66a was strongly up-regulated in activated human T cells, and it was demonstrated that CD66a under these conditions acted as a costimulatory receptor that enhanced T-cell receptor-mediated, CD3triggered cell proliferation [28]. In addition, we also examined the effect of the L:S ratio on apoptosis. It is well known that the Fas/FasL pathway is an important apoptotic system in cancer, which led us to analyze whether CD66a correlates with FasL-induced apoptosis in leukemic B cells. Fas (CD95) is a receptor of apoptosis signaling on the cell surface, which interacts with FasL to trigger apoptotic signals through a caspasedependent pathway [29]. As demonstrated in our study, we showed that inhibition of FasL-induced apoptosis by a higher L:S ratio of CD66a in leukemic B cells is accompanied by decreased caspase activities, particularly those of caspases 3 and 8.
Taken together, these data indicate that certain expression levels of CD66a, characterized by a relatively high ratio of L:S, may promote cell proliferation and inhibit apoptosis. Thus, the difference of L:S ratio between leukemic B cells and granulocytes explains why CD66a expression in granulocytes works normally, but provides growth advantages to leukemic B cells in acute leukemia. It is important to note that this study was conducted in B-ALL cell lines, and a large-scale clinical study collecting bone marrow samples is needed to further confirm the correlation between the CD66a isoform ratio and the growth of leukemic B cells in the clinical setting. Furthermore, another issue to consider is the mechanism(s) that cause the aberrant expression of CD66a on leukemic B cells, exploration of which would make a further contribution to research into B-ALL pathogenesis. Our results reported here establish a previously unrecognized role for CD66a as a pro-proliferative and anti-apoptotic molecule in leukemic B cells. In the future, these findings might be exploited for the targeted design of antileukemic therapy.
Acknowledgement This work was supported by the Intramural Research Program of China Medical University. Potential conflict of interest: Disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal.
References [1] Williams AF, Barclay AN. The immunoglobulin superfamilydomains for cell surface recognition. Ann Rev Immunol 1988; 6:381–405. [2] Thomson J, Grunert F, Zimmermann W. Carcinoembryonic antigen gene family: molecular biology and clinical perspectives. Clin Lab Anal 1991;5:344–366. [3] Beauchemin N, Draber P, Dveksler G, et al. Redefined nomenclature for members of the carcinoembryonic antigen family. Exp Cell Res 1999;252:243–249.
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Effect of CD66a on leukemic B cells [4] Nagel G, Murdoch SJ, Tchilian E, et al. CD66 identifies a neutrophil-specific epitope within the hematopoietic system that is expressed by members of the carcinoembryonic antigen family of adhesion molecules. Blood 1991;78:63–74. [5] Stocks SC, Ruchaud-Sparagano MH, Kerr MA , et al. CD66: role in the regulation of neutrophil effector function. Eur J Immunol 1996;26:2924–2932. [6] Hanenberg H, Baumann M, Quentin I, et al. Expression of the CEA gene family members NCA-50/90 and NCA-160 (CD66) in childhood acute lymphoblastic leukemias (ALLs) and in cell lines of B-cell origin. Leukemia 1994;8:2127–2133. [7] Ratei R, Karawajew L, Schabath R, et al. Differential expression of the carcinoembryonicantigen-related cell adhesion molecules panCD66, CD66a, CD66c and of sialyl-Lewis x (CD15s) on blast cells of acute leukemias. Int J Hematol 2008;87:137–143. [8] Carrasco M, Muñoz L, Bellido M, et al. CD66 expression in acute leukaemia. Ann Hematol 2000;79:299–303. [9] Prall F, Nollau P, Neumaier M, et al. CD66a (BGP), an adhesion molecule of the carcinoembryonic antigen family, is expressed in epithelium, endothelium, and myeloid cells in a wide range of normal human tissues. J Histochem Cytochem 1996;44:35–41. [10] Moller MJ, Kammerer R, Grunert F, et al. Biliary glycoprotein (BGP) expression on T cells and on a natural-killer-cell sub-population. Int J Cancer 1996;65:740–745. [11] Öbrink B. On the role of CEACAM1 in cancer. Lung Cancer 2008;60:309–312. [12] Neumaier M, Paululat S, Chan A , et al. Biliary glycoprotein, a potential human cell adhesion molecule, is down-regulated in colorectal carcinomas. Proc Natl Acad Sci USA 1993;90:10744–10748. [13] Tanaka K, Hinoda Y, Takahashi H, et al. Decreased expression of biliary glyco-protein in hepatocellular carcinomas. Int J Cancer 1997;74:15–19. [14] Kammerer R, Riesenberg R, Weiler C, et al. The tumour suppressor gene CEACAM1 is completely but reversibly downregulated in renal cell carcinoma. J Pathol 2004;204:258–267. [15] Kunath T, Ordoñez-Garcia C, Turbide C, et al. Inhibition of colonic tumor cell growth by biliary glycoprotein. Oncogene 1995; 11:2375–2382. [16] Hsieh J, Luo W, Song W, et al. Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (C-CAM) in prostate carcinoma cell revealed by sense and antisense approaches. Cancer Res 1995;55:190–197.
9
[17] Liu W, Wei W, Winer D, et al. CEACAM1 impedes thyroid cancer growth but promotes invasiveness: a putative mechanism for early metastases. Oncogene 2007;26:2747–2758. [18] Sienel W, Dango S, Woelfle U, et al. Elevated expression of carcinoembryonic antigen-related cell adhesion molecule promotes progression of non-small cell lung cancer. Clin Cancer Res 2003; 9:2260–2266. [19] Sivan S, Suzan F, Rona O, et al. Serum CEACAM1 Correlates with Disease Progression and Survival in Malignant Melanoma Patients. Clin Dev Immunol 2012;2012:290536–290544. [20] Luo W, Wood CG, Earley K , et al. Suppression of tumorigenicity of breast cancer cells by an epithelial cell adhesion molecule (C-CAM1): the adhesion and growth suppression are mediated by different domains. Oncogene 1997;14:1697–1704. [21] Öbrink B. CEA adhesion molecules: multifunctional proteins with signal-regulatory properties. Curr Opin Cell Biol 1997;9:616–626. [22] Sippel CJ, Fallon RJ, Perlmutter DH. Bile acid efflux mediated by the rat liver canelicular bile acid transport/ecto-ATPase protein requires serine 503 phosphorylation and is regulated by tyrosine 488 phosphorylation. J Biol Chem 1994;269:19539–19545. [23] Turbide C, Kunath T, Daniels E, et al. Optimal ratios of biliary glycoprotein isoforms required for inhibition of colonic tumor cell growth. Cancer Res 1997;57:2781–2788. [24] Wikström K , Kjellström G, Öbrink B. Homophilic intercellular adhesion mediated by C-CAM is due to a domain 1-domain 1 reciprocal binding. Exp Cell Res 1996;227:360–366. [25] Singer BB, Scheffrahn I, Öbrink B. The tumor growth-inhibiting cell adhesion molecule CEACAM1 (C-CAM) is differently expressed in proliferating and quiescent epithelial cells and regulates cell proliferation. Cancer Res 2000;60:1236–1244. [26] Odin P, Öbrink B. The cell surface expression of cell-CAM 105 in rat fetal tissues and regenerating liver. Exp Cell Res 1988;179: 89–103. [27] Sawa H, Ukita H, Fukuda M, et al. Spatiotemporal expression of C-CAM in the rat placenta. J Histochem Cytochem 1997;45:1021–1034. [28] Kammerer R, Hahn S, Singer BB, et al. Biliary glycoprotein (CD66a), a cell adhesion molecule of the immunoglobulin superfamily, on human lymphocytes: structure, expression and involvement in T cell activation. Eur J Immunol 1998;28:3664–3674. [29] Sharma K , Wang RX, Zhang LY, et al. Death the Fas way: regulation and pathophysiology of CD95 and its ligand. Pharmacol Ther 2000;88:333–347.
ORIGINAL ARTICLE: RESEARCH
Abnormal expression of CD66a promotes proliferation and inhibits apoptosis of human leukemic B cells in vitro Wenjin Zhao1, Yan Zhang2, Dandan Liu3, Liansheng Zhong3, Qun He3 & Yujie Zhao3 1Center of Laboratory Technology and 3Biochip Center and State Key Lab of Cell Biology, China Medical University, Shenyang,
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Liaoning, China and 2Department of Biochemistry, Shenyang Medical College, Shenyang, Liaoning, China
the CD66 family, CD66a is abundantly expressed in epithelial and vessel endothelial cells as well as blood cells in normal tissues [9]. Within the hematopoietic system, CD66a is usually expressed on myeloid cells (especially on granulocytes), and it can also be found on activated T cells and natural killer (NK) cell subpopulations [10]. Although the abnormal expression of CD66a on the surface of leukemic B cells is a well-documented phenomenon, little is known about the biological function of this aberrant expression. CD66a as an adhesion molecule is associated with cell proliferation, apoptosis, invasion, migration and morphogenesis [11]. A very important feature of CD66a is that it plays a dual role in different cancers. Studies have shown that CD66a is down-regulated in some cancers [12–14], and re-expression of CD66a in colon and prostate cancer can inhibit tumor growth [15,16]. However, CD66a expression in other cancers is up-regulated, and contributes to the development and progression of the tumor, including thyroid cancer, non-small cell lung cancer and malignant melanoma [17–19]. It has been reported that the tumorinhibiting effect of CD66a depends on the cytoplasmic domain of CD66a-4L [20]. CD66a has two major isoforms due to differential splicing: CD66a-4L (long cytoplasmic domain of 71–73 amino acids) and CD66a-4S (short cytoplasmic domain of 10–12 amino acids), which differ only in their cytoplasmic domains. In most cell types and tissues CD66a-4L and CD66a-4S are expressed together, but at characteristically different ratios, and they have different signaling activities [21]. The L isoform, but not the S isoform, contains two highly conserved, phosphorylatable tyrosine residues in its cytoplasmic domain, which play essential roles in tumor inhibition [22]. Although CD66a-4L can inhibit tumor growth in vivo, the effect is not a simple function of CD66a-4L expression. In fact, the ratio of expression levels of the L and S isoforms is the determining factor for regulating the tumor-inhibitory effect of CD66a-4L. It was found that the L isoform acted as a dominant growth inhibitor
Abstract The aberrant expression of myeloid antigen CD66 on acute B-lymphoblastic leukemia (B-ALL) cells is a well-documented phenomenon. CD66a is a major subtype of the CD66 family which plays a dual role in different cancers, and the contradictory effect may depend on the isoform ratio of CD66a-4L to CD66a-4S. Although the abnormal expression of CD66a on leukemic B-cells has been reported widely, little is known about the biological function of this aberrant expression. In this study, we showed that inhibition of CD66a in human B-ALL cell lines reduced the cellular proliferative rate and increased the percentage of cellular apoptosis, and the ratio of CD66a-4L to CD66a-4S in leukemic B cells is much higher than that in granulocytes. In addition, alteration of the L:S ratio by silencing and overexpressing the L isoform in B-ALL cell lines confirmed that a high L:S ratio of CD66a in leukemic B cells promotes proliferation and inhibits FasL-induced apoptosis. Keywords: CD66a, acute leukemic B cells, proliferation, apoptosis
Introduction CD66a, also known as CEACAM1, a member of the CD66 antigen family, is a transmembrane multifunctional adhesion molecule, belonging to the carcinoembryonic antigen (CEA) family [1–3]. The CD66 family can be divided into CD66a– CD66e subtypes, and CD66a–CD66d are mainly expressed on the surface of myeloid cells in normal hematopoiesis; CD66e has been found only on epithelial cells, and does not occur in hematopoietic cells [4,5]. Although the CD66 family has been identified as a myeloid marker, a number of reports have shown that CD66 is abnormally expressed on the membrane of B-lymphocytes in cases of acute B-lymphoblastic leukemia (B-ALL) [6–8]. Furthermore, it has been observed that the CD66/CD34 combination can be used to detect minimal residual disease (MRD) in B-ALL, and the CD66 reactivity can be attributed to CD66c reactivity and/or CD66a up-regulation in leukemic B cells [8]. As a major subtype of
Correspondence: Yujie Zhao, Biochip Center and State Key Lab of Cell Biology, China Medical University, Beier Road 92, Heping District, Shenyang, Liaoning, 110001, China. Tel: (⫹ 86)024-23251393. Fax: (⫹ 86)024-23251393. E-mail: [email protected] Received 25 October 2013; revised 28 March 2014; accepted 3 April 2014
1
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
2 W. Zhao et al. when the ratio of L:S expression remained within normal physiological levels, but overexpression of the L isoform, consequently increasing the ratio of the two isoforms, led to abrogation of its tumor suppressor phenotype [23]. Therefore, besides the total expression level of CD66a on the cell surface, the actual effect of CD66a on cancer cells may depend on the expression patterns of the two isoforms of CD66a. In view of the facts that CD66a has a contradictory feature in cancer cells and there is little information about the role of CD66a in B-ALL, the biological function of this molecule in leukemic B cells needs to be studied. In our study, we found that inhibition of CD66a in B-ALL cell lines led to a reduced cellular proliferative rate and an increased percentage of cellular apoptosis. We also found that the isoform ratio of CD66a-4L to CD66a-4S in B-ALL cell lines is much higher than that in granulocytes. Since the effect of CD66a on cancer cells is related to the ratio of CD66a-L to CD66a-S, we examined the correlation between the ratio L:S and the growth of leukemic B cells in human B-ALL cell lines BALL-1 and CCRF-SB, which were originally obtained from the peripheral blood of patients with B-ALL. Alteration of the L:S ratio by silencing and overexpressing the L isoform confirmed that a high L:S ratio in leukemic B cells contributes to cellular proliferation and inhibits FasL-induced apoptosis.
Materials and methods Cell culture and isolation of granulocytes Human acute B-lymphoblastic leukemia cell lines BALL-1 (Riken Cell Bank, Japan) and CCRF-SB (American Type Culture Collection) were grown in Dulbecco’s modified Eagle medium (DMEM) and RPMI 1640 medium, respectively. All media contained 10% fetal bovine serum (HyClone). Cells were cultured in a humidified atmosphere of 5% CO2 at 37°C. Granulocytes were isolated from peripheral blood (treated with heparin) of five healthy volunteers using Histopaque1119 and Histopaque-1077 (Sigma Aldrich). The purity of the isolated granulocytes was more than 98% as determined with flow cytometry using anti-CD16b–phycoerythrin (PE) (BD Pharmingen), a specific marker for granulocytes.
CD66 expression by flow cytometry analysis For the detection of cell surface expression of CD66, 5 ⫻ 105 leukemic B cells and granulocytes were resuspended in phosphate buffered saline (PBS) and incubated for 30 min at 4°C with 20 μL fluorescein isothiocyanate (FITC)-conjugated pan-CD66 antibody B1.1 (a monoclonal antibody able to recognize CD66a, CD66c, CD66d, CD66e; BD Pharmingen). After being washed three times, cells were resuspended in PBS and analyzed immediately by flow cytometry using a FACSCalibur flow cytometer and CellQuest software (Becton Dickinson). An isotype-matched negative control (BD Pharmingen) was used in all cases to assess background fluorescence intensity.
siRNA electroporation siRNA duplexes against CD66a, CD66a-L and negative control were synthesized by GenePharma. The following siRNA
duplexes were used: CD66a siRNA (siCD66a, containing three different targeted oligonucleotides for all the variants of CD66a), sense 5′-GACCCAC CUAACAAGAUGATT-3′ and antisense 5′-UCAUCUUGUUAGGUGGGUCTT-3′; sense 5′-GAGCUCUUUAUCCCUAACATT-3′ and antisense 5′-UGUUA GGGAUAAAGAGCUC TT-3′; sense 5′-GCUGAACGUAAACU AUAAUTT-3′ and antisense 5′-AUUAUAGUUUACGUUCA GCTT-3′; CD66a-L siRNA (containing three different targeted oligonucleotides), sense 5′-CCCAUCAUGCUGAACGUAAA CUAUA-3′ and antisense UAUAGUUUACGUUCAGCAUGA UGGG-3′;sense5′-GGACGUAUUGGUGUGAGGUCUUCAA-3′ and antisense 5′-UUGAAGACCUCACACCAAUACGUCC-3′; sense 5′-CACAAACCCUCAGUCUCCAACCACA-3′ and antisense 5′-UGUGGUUGGAGACUGAGGGUUUGUG-3′; negative control (sicontrol), sense 5′-UUCUCCGAACGUGUCAC GUTT-3′ and antisense 5′-ACGUGACACGUUCGGAGAATT-3′, which bears no homology with relevant human genes. Prior to electroporation, 2 ⫻ 106 B cells were washed twice and resuspended in 200 μL Opti-MEM (Invitrogen). Subsequently, 200 μL of the cell suspension was mixed with 5 μg of siRNA in a standard 0.4 cm cuvette and electroporated at 340 V for 4 ms using an Electro Square Porator ECM 830 (BTX). After electroporation, fresh complete medium was added to the cell suspension and cells were incubated further at 37°C with 5% CO2.
Quantitative real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. RNA concentrations were quantified by spectrometry and were reverse-transcribed using oligo (dT) primer and a Takara PrimeScript RT reagent kit (Takara). The mRNA levels of CD66 were examined by quantitative real-time polymerase chain reaction (QRT-PCR) using a SYBR Premix Ex Taq™II kit (Takara) and calculated employing the 2⫺ΔΔCT method. The amplification condition was 30 s at 95°C followed by 40 cycles of 5 s at 95°C, 20 s at 60°C in a LightCycler (Roche Diagnostics). Primers for detection of CD66 subtypes expressed on leukemic B cells and granulocytes were (Takara): CD66a, 5’-GCCTCTCACCTGGGGCCATT-3′ and 5’-TGGTCCTGAGCTG CCGGTCTT-3′ (116 bp); CD66b, 5’-GCGGAACGTCACCAGAAATG-3′ and 5’-GAGTC TCCGGATGTACGCTG-3′ (107 bp); CD66c, 5′-GCTCTGATATAGCAGCCCTGGTG-3′ and 5′-CTTCAGGAGCAGAGCAGACCTTG-3′ (141 bp); CD66d, 5’-GTGGGTTGATGGAGAGTCCC-3′ and 5’-GAGAGGCCTT TGTCCTGACC-3′ (196 bp); β-actin, 5’-TGGCA CCCAGCACAATGAA-3’ and 5’-CTAAGTCATAGTCCGCCTAGAAGCA -3’ (186 bp). To evaluate the effect of CD66a gene silencing, primers for all the variants of CD66a were used (Takara): 5’-GACCACTCCAATGACCCACC-3′ and 5’-GGGAGGCTGAA GTTGGTT GT-3′. To detect the ratio of L:S, the following primers were used (Takara): L isoform, 5’-CAACCCAATCAGTAAGAACCAA-3’ and 5’-CGCTGGTCGCTTGCC-3’; S isoform, 5’-GACCCCATCATGCTGAACGT-3’ and 5’-CATTGGAGTGGTCCTGAGCT-3’. Each sample was analyzed in triplicate and normalized to levels of the housekeeping gene β-actin.
Effect of CD66a on leukemic B cells
Plasmid construction and transfection
Assay of FasL-induced apoptosis
To increase the ratio of L:S in BALL-1 and CCRF-SB cells, CD66a-L expression plasmids were constructed with pcDNA3.1 vectors (Invitrogen). Briefly, the full-length of CD66a-L cDNA was amplified from a liver cDNA library of human normal tissue (Invitrogen) and inserted into the pcDNA3.1 vectors using a pENTR Directional TOPO® Cloning Kit (Invitrogen). All constructed plasmids were confirmed by DNA sequencing. An empty expression plasmid of the same type was used as a control. For transfection, 200 μL of cell suspension (2.5 ⫻ 107 cells/mL) and 10 μg of plasmid were mixed in a 0.4 cm cuvette and electroporated at 360 V for 7 ms.
After silencing and overexpressing L isoform for 48 h, the transfected cells were treated with 100 ng/mL of recombinant human FasL (BD Pharmingen) for 4 h to induce apoptosis. Apoptotic cell death was evaluated using a FITC– annexin V/propidium iodide (PI) double-staining kit (KeyGEN Biotech) according to the manufacturer’s instructions. Briefly, the FasL-treated cells were washed with PBS and resuspended in 500 μL binding buffer with 5 μL annexin V and 5 μL propidium iodide. The apoptosis assay of CD66a gene silencing was also performed at 48 h after transfection. Stained cells were analyzed by flow cytometry and all observations were reproduced at least three times in independent experiments.
Western blot Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
3
Protein extracts were equally loaded on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels, and subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). After blocking with 5% non-fat milk in PBS, the membranes were incubated with primary antibodies. The following antibodies were used: rabbit polyclonal antibody against CD66 (BD Pharmingen), mouse monoclonal antibody against β-actin (Santa Cruz) and goat anti-rabbit and goat anti-mouse horseradish peroxidase (HRP)-linked secondary antibodies (Cell Signaling). Detection was performed using a chemiluminescence phototope-HRP kit (Thermo Scientific).
FasL-treated cells were lysed and lysates were assayed for caspase 2, 3, 8 and 9 activities using an ApoAlert Caspase Profiling Assay Plate (Clontech) according to the manufacturer’s instructions. Plates were analyzed in the fluorescence plate reader with excitation at 360 nm and emission at 480 nm. The role of caspase activation in apoptosis was confirmed by performing FasL culture in the presence of the caspase inhibitor Z-VAD-FMK (100 μM final concentration).
Cell proliferation analysis
Statistical analysis
Cell proliferation was measured using a 5-bromo-2deoxyuridine (BrdU) staining kit (eBioscience) according to the manufacturer’s instructions. Briefly, 2 ⫻ 105 cells at 48 h after transfection were incubated with 10 μM BrdU for 1 h at 37°C with 5% CO2, then stained with FITC-conjugated antiBrdU antibody for 0.5 h at room temperature after permeabilization. Stained cells were analyzed by flow cytometry.
Statistical significance was analyzed by the use of Student’s t-test. A value of p ⬍ 0.05 was considered to be statistically significant.
CCK-8 assay Briefly, cells were seeded into 96-well (3000 cells/well) plates and incubated with CCK-8 solution (Dojindo, Japan) for 2 h at 37°C with 5% CO2, followed by detection with a microplate reader at 450 nm absorbance (BioRad). Cells were analyzed at 12, 24, 36 and 48 h after transfection.
Analysis of caspase activity
Results CD66a surface expression on BALL-1 and CCRF-SB cells For the reason that there is no specific anti-CD66a antibody produced commercially, we used pan-CD66 antibody to measure the surface expression of CD66 on BALL-1 and CCRF-SB cells. Flow cytometry analysis showed that CD66 is expressed on both cells [Figure 1(A)]. Primers of CD66a, b, c and d were designed for QRT-PCR to detect the subtypes of CD66 expressed in the two cell lines, and the results
Figure 1. CD66a surface expression on BALL-1 and CCRF-SB cells. (A) CD66 surface expression on BALL-1 and CCRF-SB cells (filled graph) was measured by flow cytometry using pan-CD66 antibody. Dotted curves obtained with an isotype control antibody indicate background fluorescence. (B) BALL-1 and CCRF-SB cells express only CD66a and granulocytes express different levels of CD66a–d as determined by QRT-PCR analysis. Results are the means of three independent determinations (normalized to β-actin).
4 W. Zhao et al. showed that only CD66a exists in BALL-1 and CCRF-SB cells [Figure 1(B)].
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Effect of CD66a inhibition on proliferation and apoptosis of leukemic B cells Suppression of CD66a by siRNA in BALL-1 and CCRF-SB cells was confirmed at the mRNA level by QRT-PCR analysis 36 h after electroporation [Figure 2(A)] and at the protein level by Western blot analysis 48 h after electroporation [Figure 2(B)]. Data of the BrdU staining assay showed that inhibition of CD66a in BALL-1 and CCRF-SB cells significantly reduced the number of BrdU positive cells compared to sicontrol [Figure 2(C)], and the data of double-staining showed that the mean percentage of apoptosis (annexin V-positive, PInegative) for CD66a-inhibited cells increased significantly compared to sicontrols [Figure 2(D), lower right quadrant]. These results demonstrated that CD66a expression in leukemic B cells contributes to cell proliferation and inhibits cell apoptosis.
Difference of isoform ratio of CD66a between leukemic B cells and granulocytes To determine whether the expression of CD66a in leukemic B cells is different from that in granulocytes, we compared the isoform ratio of CD66a between these cells. Expression of CD66 on granulocytes was confirmed by flow cytometry analysis [Figure 3(A)] and CD66a–d were coexpressed in granulocytes [Figure 1(B)]. Because there is no antibody specific for the L or S isoform of CD66a, we decided to analyze the expression patterns of the two isoforms in more detail at the mRNA level. Specific primers that could distinguish between CD66a-L and CD66a-S were designed to analyze mRNA levels of the two differentially spliced isoforms. QRT-PCR analysis showed that the L and S isoforms were coexpressed in both granulocytes and leukemic B cells, but the L:S ratios differed significantly between granulocytes and leukemic B cells. A CD66a L:S ratio of 2.35 ⫾ 0.12 was found in granulocytes and the L:S ratio in BALL-1 and CCRF-SB cells
Figure 2. Effect of CD66a inhibition on the proliferation and apoptosis of leukemic B cells. (A) Suppression of CD66a by siRNA was verified at the mRNA level by QRT-PCR analysis. Data are mean ⫾ SD of triplicate determinations (*p ⬍ 0.05). (B) Inhibition of CD66a expression was confirmed at the protein level by Western blot. (C) BrdU positive rate of siCD66a cells declined compared to sicontrol cells in both BALL-1 and CCRF-SB cells as determined by BrdU staining assay at 48 h after transfection (*p ⬍ 0.05). (D) siCD66a treatment resulted in an increase of apoptosis compared to sicontrol at 48 h after transfection in both BALL-1 and CCRF-SB cells (p ⬍ 0.05). Values are means of three independent experiments and representative results are shown.
Effect of CD66a on leukemic B cells
5
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Figure 3. Difference of CD66a isoform ratios between granulocytes and leukemic B cells. (A) Expression of CD66 on granulocytes was confirmed by flow cytometry. (B) L:S ratio of CD66a in granulocytes was 2.35 ⫾ 0.12 and the L:S ratio in BALL-1 and CCRF-SB cells reached up to 24.2 ⫾ 0.33 and 19.3 ⫾ 0.29 as determined by QRT-PCR analysis, respectively (*p ⬍ 0.05, n ⫽ 5).
reached up to 24.2 ⫾ 0.33 and 19.3 ⫾ 0.29, respectively [Figure 3(B)].
from 24.2 ⫾ 0.33 to 150.8 ⫾ 1.23 in BALL-1 cells and from 19.3 ⫾ 0.29 to 142.7 ⫾ 1.34 in CCRF-SB cells [Figure 4(D)].
Alteration of L:S ratio of CD66a by changing L-isoform expression level
High L:S ratio of CD66a promotes proliferation of leukemic B cells
To determine the relationship between the high L:S ratio of CD66a and the growth of leukemic B cells, we altered the ratio of L:S by silencing and overexpressing the L isoform to detect changes in proliferation and apoptosis of BALL-1 and CCRF-SB cells. Knockdown of CD66a-L by siRNA led to a significant down-regulation of CD66a expression in the two cell lines [Figure 4(A)] and reduced the ratio of L:S from 24.2 ⫾ 0.33 to 10.6 ⫾ 0.58 in BALL-1 cells and from 19.3 ⫾ 0.29 to 9.5 ⫾ 0.3 in CCRF-SB cells compared to their controls [Figure 4(B)]. On the other hand, to increase the L:S ratio, CD66a-L expression plasmids were constructed and transfected into BALL-1 and CCRF-SB cells, respectively. Overexpression of CD66a-L led to a significant up-regulation of CD66a expression in both cells [Figure 4(C)] and increased the L:S ratio
To examine the effect of the L:S ratio on the proliferation of leukemic B cells, we used the CCK-8 assay and BrdU staining assay to measure the proliferative status of BALL-1 and CCRF-SB cells after changing the ratio of L:S. The results of the CCK-8 assay showed that a lower L:S ratio significantly reduced the number of live cells and a higher ratio of L:S significantly increased the cell number in both BALL-1 and CCRF-SB cells compared to their controls [Figures 5(A) and 5(B)]. Data of the BrdU staining assay showed that a lower L:S ratio significantly reduced the level of BrdU positive cells, whereas a higher ratio of L:S significantly increased the level of BrdU positive cells [Figures 5(C) and 5(D)], which demonstrated that CD66a with a high ratio of L:S is conducive to the proliferation of leukemic B cells.
Figure 4. Alteration of L:S ratio by silencing and overexpressing L isoform in BALL-1 and CCRF-SB cells. (A) Knockdown of CD66a-L led to downregulation of CD66a expression in BALL-1 and CCRF-SB cells as determined by Western blot. (B) Knockdown of L isoform reduced the ratio of L:S from 24.2 ⫾ 0.33 to 10.6 ⫾ 0.58 in BALL-1 cells and from 19.3 ⫾ 0.29 to 9.5 ⫾ 0.3 in CCRF-SB cells (*p ⬍ 0.05). (C) Overexpression of CD66a-L led to up-regulation of CD66a expression in BALL-1 and CCRF-SB cells as determined by Western blot. (D) Overexpression of L isoform increased the L:S ratio from 24.2 ⫾ 0.33 to 150.8 ⫾ 1.23 in BALL-1 cells and from 19.3 ⫾ 0.29 to 142.7 ⫾ 1.34 in CCRF-SB cells (*p ⬍ 0.05).
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
6 W. Zhao et al.
Figure 5. Effect of L:S ratio on proliferation of BALL-1 and CCRF-SB cells. (A, B) Lower L:S ratio (si-L) significantly reduced the number of live cells in both BALL-1 and CCRF-SB cells compared to their controls, whereas higher ratio of L:S (pcDNA3.1-L) significantly increased the cell number as determined by CCK-8 assay (p ⬍ 0.05). (C, D) BrdU positive rate declined in cells with lower L:S ratio and increased in cells with higher L:S ratio compared to their controls in both BALL-1 and CCRF-SB cells as determined by BrdU staining assay at 48 h after transfection (*p ⬍ 0.05).
CD66a aberrantly expressed in leukemic B cells inhibits FasL-induced apoptosis by decreasing caspase activities To investigate whether CD66a with a high L:S ratio affects apoptosis, we examined the effect of the L:S ratio on FasLinduced apoptosis in BALL-1 and CCRF-SB cells. This was analyzed by comparing the percentage of apoptosis in cells cultured for 4 h with FasL using FITC–annexin V/PI doublestaining after changing the L:S ratio. A lower ratio of L:S caused by knockdown of the L isoform markedly increased the percentage of apoptosis compared to sicontrol after treatment with FasL, which was abrogated by addition of the broad-spectrum caspase inhibitor Z-VAD-FMK [Figure 6(A)]. A higher ratio of L:S caused by overexpression of the L isoform decreased the level of apoptotic cells compared to control after incubation with FasL, and the addition of Z-VAD-FMK caused a further decline in the level of apoptosis [Figure 6(B)]. We examined caspase activities in FasL-treated cells and found that a lower L:S ratio of CD66a in both BALL-1 and CCRF-SB cells induced a significant activation of caspase-3 and caspase-8 compared to their controls after FasL treatment. Smaller but statistically significant changes in caspase-2 and -9 activities were also observed in both cells [Figure 7(A)]. In contrast, reduced apoptosis caused by a higer L:S ratio of CD66a in both BALL-1 and CCRF-SB cells was associated with significant decreases in caspase-3 and
caspase-8 activities and small decreases in caspase-2 and caspase-9 activities, compared to their controls after FasL treatment [Figure 7(B)]. These findings demonstrated that CD66a with a high L:S ratio inhibits FasL-induced apoptosis by decreasing caspase activities, especially the activities of caspase-3 and caspase-8.
Discussion Leukemia cells often show an altered protein expression pattern, one of which is a change in the antigen molecules present on the surface of leukemia cells, such as CD66a. CD66a is a myeloid antigen but is aberrantly expressed on acute B-cell leukemia. Acute leukemia is a rapidly progressive disease that results in the accumulation of immature, ineffective leukocytes in the marrow and blood. These abnormal leukocytes do not die easily and flood the bloodstream, crowding out the normal leukocytes; hence our study focused on investigating the effect of CD66a on the proliferation and apoptosis of leukemic B cells. We used B-ALL cell lines BALL-1 and CCRF-SB for our study because both cell lines carry only the CD66a subtype, which was confirmed by QRT-PCR analysis. To evaluate the effect of CD66a on leukemic B cells, we inhibited CD66a expression by siRNA and tested its involvement in the regulation of proliferation and apoptosis. CD66a functions primarily via homophilic
7
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Effect of CD66a on leukemic B cells
Figure 6. Effect of L:S ratio on FasL-induced apoptosis in leukemic B cells. (A) Lower L:S ratio of CD66a promoted apoptosis in FasL-treated BALL-1 and CCRF-SB cells compared to controls, and the response was abrogated by addition of the caspase inhibitor Z-VAD-FMK as determined by double-staining (p ⬍ 0.05). (B) Higher L:S ratio of CD66a inhibited apoptosis in FasL-treated BALL-1 and CCRF-SB cells compared to controls, and Z-VAD-FMK caused a further decline in the level of apoptosis (p ⬍ 0.05). Values are means of three independent experiments and representative results are shown.
binding, i.e. it binds to itself [24], so the reduced intercellular CD66a–CD66a interaction caused by gene silencing may reduce the effect of CD66a on leukemic B cells. Our results showed that CD66a gene silencing results in a decreased proliferative rate and an increased percentage of apoptosis
in BALL-1 and CCRF-SB cells, meaning that CD66a contributes to cell proliferation and plays an anti-apoptotic role in leukemic B cells. In addition, we also found that the isoform ratio of CD66a-4L to CD66a-4S in leukemic B cells is much higher than that in granulocytes.
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
8 W. Zhao et al.
Figure 7. Analysis of caspase activities in FasL-treated leukemic B cells. (A) Lower L:S ratio of CD66a in both BALL-1 and CCRF-SB cells induced a significant activation of caspase-3 and caspase-8 after FasL treatment. (B) Higher L:S ratio of CD66a in BALL-1 and CCRF-SB cells reduced caspase-3 and caspase-8 activities after FasL treatment. Changes in caspase-2 and -9 activities were of a lesser magnitude in all experiments. Values of caspase activities are represented as ratios relative to control cells with FasL treatment. Data are means of three independent experiments (*p ⬍ 0.05).
Since myeloid antigen CD66a is aberrantly expressed in some human B-ALL samples and the function of CD66a in cancer cells is related to the ratio of CD66a-L to CD66a-S based on these previous reports, we speculated that a high L:S ratio of CD66a may be involved in the pathogenesis of this subset of patients with B-ALL. In our study, alteration of the L:S ratio by silencing and overexpressing the L isoform in B-ALL cell lines confirmed that a higher L:S ratio of CD66a in leukemic B cells promotes proliferation and a lower L:S ratio plays an opposite role. These findings are consistent with a previous study of Singer et al, in which an increased ratio of CD66a-L to CD66a-S could lose the inhibitory effect on proliferation and conversely stimulate proliferation in a rat prostate epithelial cell line NbE and bladder carcinoma-derived NBT4II cell line, respectively [25]. Singer et al. revealed that actively proliferating cells of both cell lines acquired an almost identical CD66a isoform ratio (increased ratio of L to S), indicating that this expression pattern of CD66a is functionally associated with and is important for the proliferative state of rodent epithelial cells. Similar expression patterns have also been observed in proliferating, regenerating hepatocytes [26] and in proliferating placental trophoblasts [27]. Furthermore, it was reported that the L isoform of CD66a was strongly up-regulated in activated human T cells, and it was demonstrated that CD66a under these conditions acted as a costimulatory receptor that enhanced T-cell receptor-mediated, CD3triggered cell proliferation [28]. In addition, we also examined the effect of the L:S ratio on apoptosis. It is well known that the Fas/FasL pathway is an important apoptotic system in cancer, which led us to analyze whether CD66a correlates with FasL-induced apoptosis in leukemic B cells. Fas (CD95) is a receptor of apoptosis signaling on the cell surface, which interacts with FasL to trigger apoptotic signals through a caspasedependent pathway [29]. As demonstrated in our study, we showed that inhibition of FasL-induced apoptosis by a higher L:S ratio of CD66a in leukemic B cells is accompanied by decreased caspase activities, particularly those of caspases 3 and 8.
Taken together, these data indicate that certain expression levels of CD66a, characterized by a relatively high ratio of L:S, may promote cell proliferation and inhibit apoptosis. Thus, the difference of L:S ratio between leukemic B cells and granulocytes explains why CD66a expression in granulocytes works normally, but provides growth advantages to leukemic B cells in acute leukemia. It is important to note that this study was conducted in B-ALL cell lines, and a large-scale clinical study collecting bone marrow samples is needed to further confirm the correlation between the CD66a isoform ratio and the growth of leukemic B cells in the clinical setting. Furthermore, another issue to consider is the mechanism(s) that cause the aberrant expression of CD66a on leukemic B cells, exploration of which would make a further contribution to research into B-ALL pathogenesis. Our results reported here establish a previously unrecognized role for CD66a as a pro-proliferative and anti-apoptotic molecule in leukemic B cells. In the future, these findings might be exploited for the targeted design of antileukemic therapy.
Acknowledgement This work was supported by the Intramural Research Program of China Medical University. Potential conflict of interest: Disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal.
References [1] Williams AF, Barclay AN. The immunoglobulin superfamilydomains for cell surface recognition. Ann Rev Immunol 1988; 6:381–405. [2] Thomson J, Grunert F, Zimmermann W. Carcinoembryonic antigen gene family: molecular biology and clinical perspectives. Clin Lab Anal 1991;5:344–366. [3] Beauchemin N, Draber P, Dveksler G, et al. Redefined nomenclature for members of the carcinoembryonic antigen family. Exp Cell Res 1999;252:243–249.
Leuk Lymphoma Downloaded from informahealthcare.com by Queen's University on 10/08/14 For personal use only.
Effect of CD66a on leukemic B cells [4] Nagel G, Murdoch SJ, Tchilian E, et al. CD66 identifies a neutrophil-specific epitope within the hematopoietic system that is expressed by members of the carcinoembryonic antigen family of adhesion molecules. Blood 1991;78:63–74. [5] Stocks SC, Ruchaud-Sparagano MH, Kerr MA , et al. CD66: role in the regulation of neutrophil effector function. Eur J Immunol 1996;26:2924–2932. [6] Hanenberg H, Baumann M, Quentin I, et al. Expression of the CEA gene family members NCA-50/90 and NCA-160 (CD66) in childhood acute lymphoblastic leukemias (ALLs) and in cell lines of B-cell origin. Leukemia 1994;8:2127–2133. [7] Ratei R, Karawajew L, Schabath R, et al. Differential expression of the carcinoembryonicantigen-related cell adhesion molecules panCD66, CD66a, CD66c and of sialyl-Lewis x (CD15s) on blast cells of acute leukemias. Int J Hematol 2008;87:137–143. [8] Carrasco M, Muñoz L, Bellido M, et al. CD66 expression in acute leukaemia. Ann Hematol 2000;79:299–303. [9] Prall F, Nollau P, Neumaier M, et al. CD66a (BGP), an adhesion molecule of the carcinoembryonic antigen family, is expressed in epithelium, endothelium, and myeloid cells in a wide range of normal human tissues. J Histochem Cytochem 1996;44:35–41. [10] Moller MJ, Kammerer R, Grunert F, et al. Biliary glycoprotein (BGP) expression on T cells and on a natural-killer-cell sub-population. Int J Cancer 1996;65:740–745. [11] Öbrink B. On the role of CEACAM1 in cancer. Lung Cancer 2008;60:309–312. [12] Neumaier M, Paululat S, Chan A , et al. Biliary glycoprotein, a potential human cell adhesion molecule, is down-regulated in colorectal carcinomas. Proc Natl Acad Sci USA 1993;90:10744–10748. [13] Tanaka K, Hinoda Y, Takahashi H, et al. Decreased expression of biliary glyco-protein in hepatocellular carcinomas. Int J Cancer 1997;74:15–19. [14] Kammerer R, Riesenberg R, Weiler C, et al. The tumour suppressor gene CEACAM1 is completely but reversibly downregulated in renal cell carcinoma. J Pathol 2004;204:258–267. [15] Kunath T, Ordoñez-Garcia C, Turbide C, et al. Inhibition of colonic tumor cell growth by biliary glycoprotein. Oncogene 1995; 11:2375–2382. [16] Hsieh J, Luo W, Song W, et al. Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (C-CAM) in prostate carcinoma cell revealed by sense and antisense approaches. Cancer Res 1995;55:190–197.
9
[17] Liu W, Wei W, Winer D, et al. CEACAM1 impedes thyroid cancer growth but promotes invasiveness: a putative mechanism for early metastases. Oncogene 2007;26:2747–2758. [18] Sienel W, Dango S, Woelfle U, et al. Elevated expression of carcinoembryonic antigen-related cell adhesion molecule promotes progression of non-small cell lung cancer. Clin Cancer Res 2003; 9:2260–2266. [19] Sivan S, Suzan F, Rona O, et al. Serum CEACAM1 Correlates with Disease Progression and Survival in Malignant Melanoma Patients. Clin Dev Immunol 2012;2012:290536–290544. [20] Luo W, Wood CG, Earley K , et al. Suppression of tumorigenicity of breast cancer cells by an epithelial cell adhesion molecule (C-CAM1): the adhesion and growth suppression are mediated by different domains. Oncogene 1997;14:1697–1704. [21] Öbrink B. CEA adhesion molecules: multifunctional proteins with signal-regulatory properties. Curr Opin Cell Biol 1997;9:616–626. [22] Sippel CJ, Fallon RJ, Perlmutter DH. Bile acid efflux mediated by the rat liver canelicular bile acid transport/ecto-ATPase protein requires serine 503 phosphorylation and is regulated by tyrosine 488 phosphorylation. J Biol Chem 1994;269:19539–19545. [23] Turbide C, Kunath T, Daniels E, et al. Optimal ratios of biliary glycoprotein isoforms required for inhibition of colonic tumor cell growth. Cancer Res 1997;57:2781–2788. [24] Wikström K , Kjellström G, Öbrink B. Homophilic intercellular adhesion mediated by C-CAM is due to a domain 1-domain 1 reciprocal binding. Exp Cell Res 1996;227:360–366. [25] Singer BB, Scheffrahn I, Öbrink B. The tumor growth-inhibiting cell adhesion molecule CEACAM1 (C-CAM) is differently expressed in proliferating and quiescent epithelial cells and regulates cell proliferation. Cancer Res 2000;60:1236–1244. [26] Odin P, Öbrink B. The cell surface expression of cell-CAM 105 in rat fetal tissues and regenerating liver. Exp Cell Res 1988;179: 89–103. [27] Sawa H, Ukita H, Fukuda M, et al. Spatiotemporal expression of C-CAM in the rat placenta. J Histochem Cytochem 1997;45:1021–1034. [28] Kammerer R, Hahn S, Singer BB, et al. Biliary glycoprotein (CD66a), a cell adhesion molecule of the immunoglobulin superfamily, on human lymphocytes: structure, expression and involvement in T cell activation. Eur J Immunol 1998;28:3664–3674. [29] Sharma K , Wang RX, Zhang LY, et al. Death the Fas way: regulation and pathophysiology of CD95 and its ligand. Pharmacol Ther 2000;88:333–347.
