Absence of Persistent Infection with Enteroviruses in Muscles of Patients with Inflammatory Myopathies Marta Leon-Monzon, PhD, and Marinos C. Dalakas, M D
We searched for enteroviral nucleic acid sequences using the polymerase chain reaction and slot-blot hybridization in coded muscle biopsy specimens from 39 patients with active inflammatory myopathies (polymyositis,dermatomyositis, and inclusion-body myositis) and from 16 patients with other neuromuscular diseases, including patients with postpolio syndrome. For primers, we used sequences of the noncoding region at the 5' end of the viral RNA. We failed to detect specific enteroviral nucleic acid sequences in the muscle biopsy specimens. Because this sensitive technique can amplify even low copy numbers of the viral genome, it appears unlikely that a persistent enteroviral infection is the cause of inflammatory myopathies. Leon-Monzon M, Dalakas MC. Absence of persistent infection with enteroviruses in muscles of patients with inflammatory myopathies. Ann Neurol 1992;32:219-222
There are reports that coxsackieviruses may be implicated in the pathogenesis of the inflammatory myopathies 11-51. Because the evidence is circumstantial and the results are conflicting, we searched the muscle biopsy specimens from 39 patients with active polymyositis (PM), dermatomyositis (DM), and inclusion-body myositis (IBM) for evidence of persistent infection with picornaviruses. We used the amplification technique to detect viral RNA, using as primers sequences of the highly conserved noncoding region at the 5 ' end of the viral RNA 167.
Methods We obtained muscle biopsy specimens from 39 patients (16 with PM, 12 with DM, and 11 with IBM) who fulfilled the strict diagnostic clinicopathological criteria of active inflammatory myopathy 17, 8). Control specimens were obtained
from 16 patients with noninflammatory myopathy, amyotrophic lateral sclerosis, and postpolio syndrome. Ten consecutive, 10-pm-thick, fresh-frozen sections were studied from each specimen. All specimens were coded and blindly analyzed.
R N A and D N A Extraction Mixtures of total RNA and DNA were extracted from four consecutive sections of each specimen. Proteins were digested with pronase, and the D N A and RNA were precipitated with ethanol. The resulting pellets were dried and dissolved in polycarbonated-treated water. Sterile solutions and sterile siliconized microfuge tubes were used to avoid RNase digestion. The concentration of nucleic acid was estimated by optical density reading. Muscle RNA was also extracted from the remaining six consecutive sections according to the guanidinium thiocynate-phenol-chlorophorm procedure 191, using an RNA isolation kit (Stratagene, La Jolla, CA).
Polymerase Chain Reaction and Electrophoresis The polymerase chain reaction (PCR) was performed twice in the nucleic acids extracted from each specimen, using standard procedures {lo] and an RNA/PCR kit (Cetus, Boston, MA). In brief, extracted RNA was first copied to cDNA with reverse transcriptase, using upstream (antisense to genomic RNA) and downstream (sense to genomic RNA) primers. After 15 minutes at 42"C, reverse transcriptase activity was destroyed by heating the samples for 5 minutes at 95"C, followed by cooling for 5 minutes at 4°C. The Ampli Taq enzyme (0.25 U/tube) was then added to the tubes, and 30 cycles of amplification began for 45 seconds at 94"C, 45 seconds at 50°C, and 60 seconds at 72"C, followed by another cycle for 10 minutes at 72°C. In each experiment, positive viral control specimens and nucleic acid-negative control samples containing only water were included. All specimens were then analyzed by 10% polyacrylamide gel electrophoresis with ethidium bromide staining.
Slot-Blot Hybridization The specificity of the viral sequences was confirmed by hybridizing the amplified PCR products with a 2 l-oligonucleotide probe between position 548-568 of the 5' end of the genomic RNA of the enteroviruses { 1If, labeled by the T4 kinase method t12). The amplified DNA was blotted into nylon membranes and prehybridized in a solution containing bovine serum albumin, denatured salmon DNA, and 0.5% sodium dodecyl sulfate. Hybridization was then followed in the same solution containing a lo7 dpm/mI 32P-labeled probe, for 16 hours at 50°C. The blots were washed and exposed to x-ray film.
Primers and Controls ~~~~~
From the Neuromuscular Diseases Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD. Received Nov 25, 1991, and in revised form Feb 6, 1992. Accepted for publication Feb 16, 1992. Address correspondence to Dr Dalakas, Neuromuscular Diseases Section, Building 10, Room 4N248, NINDS, NIH, Bethesda, MD 20892.
Enterovirus primers 1 and 2 (positions 450-474 and 584-603) {6] were selected from the highly conserved 5' end, noncoding region, of the genomic enterovirus RNA. For positive controls, we used poliovirus types 1 , 2 , and 3, and coxsackievirus B, (American Tissue Culture Collection, Rockville, MD) grown in Vero cells after standard procedures. For amplification, we used unconcentrated cell-free culture supernatant as well as viral RNA extracted from concentrated
Brief Communication: Leon-Monzon and Dalakas: Enteroviruses and Inflammatory Myopathies
2 19
supernatant. Myosin primers 1 ( 5 ’GGCTTGAATGAGGAGTAGCT3’) and 2 (5’CTGCTTCCTCCCAAGGAGCT3’) [13] were used in the PCR amplification to ensure the integrity of the nucleic acids extracted from the samples.
Results With the myosin primers, the 106-bp fragment of myosin DNA of the correct size was detected in all specimens, indicating that sufficient nucleic acids were extracted from the sections (Fig 1). With the viral primers, the poliovirus and coxsackievirus RNA was easily detected in the infected vero cells (Fig 2). By contrast, with the same primers, no amplification bands of the correct size were detected in the patient or control specimens (see Fig 2). The DNA fragments of low molecular weight observed in some of the amplified products (see Fig 2) were nonspecific, as they did not correspond to the expected viral RNA sequences. Such nonspecific fragments, which were also observed in the control samples containing water instead of RNA (see Fig 2), were most likely caused by selfannealing of the primers. When the amplified products were hybridized to the enteroviral probe, only the coxsackievirus- and the poliovirus-infected cells gave positive hybridization signals (Fig 3). None of the nonspecific amplified fragments hybridized with the probe.
Discussion Using the sensitive amplification technique and specific primers that recognize the noncoding region at the 5‘ end of the viral RNA, which is highly conserved in all members of the picornaviridae family (coxsackievirus A and B, Theiler’s virus, poliomyelitis virus, echovirus, and encephalomyocarditis virus) 161, we failed to detect RNA enteroviral sequences in muscle biopsy specimens of patients with PM, DM, and IBM. Contrary to previous reports El-51, our study shows no evidence of persistent enteroviral infection in the muscles of these patients. The evidence that enteroviruses may be implicated in the pathogenesis of inflammatory myopathies is circumstantial for several reasons. First, the presence of high neutralization antibody titers to coxsackie B virus found in some patients with PM and D M El] has no causal relationship with the disease because high titers can be found in asymptomatic persons exposed to the enteroviruses. Second, the enterovirus-like particles in muscle biopsy specimens of occasional patients could be artifacts because of their morphological similarity to glycogen and ribosomes C2, 141. Third, the reported slot-blot hybridization bands produced by the coxsackie B virus probe in preparations from 5 to 9 muscle biopsy specimens of PM and D M patients C33 were weak and identical to the bands observed with -the control b-tubulin probe, making their distinction from background bands difficult. Fourth, the in situ hybridization signals reported in 3 of 9 biopsy specimens of 220 Annals of Neurology Vol 32
No 2
August 1992
Fig I . Polyacylamide gel electrophoresis of myosin amplified by polymerase chain reaction zlsing myosin primers in h e n d e i c acids extracted from the muscle biopsy sections. The expected 206-bp DNA fragment of myosin DNA (arrow) was detected in all muscle biopsy specimens, as shown in these representative samples from patients with dermatomyositis (lanes I and 21,polymyositis (lanes 3 and 4), inclusion-body myositis (lanes 5 and 61, amyotrophic lateral sclerosis (lane 71, and postpolio syndrome (lanes 8 and 9).
patients with DM C51 are of uncertain specificity because they were observed only within the endomysial macrophages, not the muscle fibers, and only with Theiler’s murine encephalomyelitis virus, not the COXsackievirus or PV1 poliovirus, which contains the highly conserved noncoding region of the enteroviral genome. Last, coxsackie B viral mRNA was reportedly detected within the muscle fibers in 8 of 19 patients with PM or DM, using the PV1 poliovirus probe and in situ hybridization [4). However, the detection of positive signals with this method is not based on absolute nucleic acid homology between the probe and the targeted viral sequences, allowing a large probe, such as the one used in that study C4], to recognize partial sequences that belong to other, nonviral RNA. The specificity of this finding was further clouded by the inability of the investigators to demonstrate viral antigens on the same specimens with immunocytochemistry c41. The amplification method we used offers superior specificity and avoids the difficulties inherent in in situ hybridization. Because the PCR technique requires absolute nucleotide homology between the primer and the targeted RNA for a positive reaction, it detects only the specific nucleotide sequences of the enteroviral genome. Further, the PCR was performed under a high annealing temperature to avoid nonspecific amplification caused by mismatching sequences between the primers and the nucleic acids extracted from the muscle. Additionally, slot-blot hybridization confirmed the specificity of the amplified products. In comparison
A
B Fig 2. Polyacrylamide gel electrophoresis of enteroviral R N A amplified by polymerase chain reaction, using enteroviral primers in the extracted R N A from patients with infEammatory myopathies, other neuromuscukar diseases, positive viral cultures, and in water. Lanes 1 to 4 (A) and lanes 1 and 2 (B) are from patients with polymyositis, lanes 5 t o 8 (A) and lanes 3 and 4 (B) are from patients with dermatomyositis, lanes 5 t o 7 (B) are from patients with inclusion-body myositis, and lanes 9 and 10 (A) and 8 to 10 (B) are from patients with other neuromuscukar diseases, including postpolio syndrome. In A, P I and P2 are ampli$ed R N A from poliwirus-infected cultures. i n A and B, C represents amplified R N A from the coxsackievirus-infected cultures, and W represents amplijication products obtained with water alone. Note specijic amplijication of the 134-bp fragment of the enteroviral D N A (arrows) only in the virus-infected cells, but not in the muscle biopsy specimens. In A and B, the lower molecular weight bands (arrowheads), seen also in water (A), are nonspecific products.
with other studies, we also have examined a larger number of muscle biopsy sections from more patients with active disease, as well as samples from patients with the postpolio syndrome who had suffered an acute infection with the poliomyelitis virus, to exclude randomly spaced enteroviral genomes within the muscle. The PCR technique is so sensitive that it can detect even low copy numbers of the viral genome. However, viral particles sparsely distributed within the muscle could escape detection if they happen to fall outside the 100-pm total length of the muscle tissue examined. Theoretically, enteroviruses, though highly lytic, can cause a persistent infection by becoming either mutant or defective [15]. The PCR and the primers we used can detect all the mutant and defective enteroviruses, except those occurring within the sequences of the primers or those lacking part of the 5' noncoding con-
Fig 3. Slot-blot hybridization of the pol'ymerase chain reaction products, using a 23-mer 32P-radiolabeledoligonucleotideprobe. Lanes 1 to 6 represent amp(kfiedDNA from patimts with polymyositis, lanes 7 to 12 from patients with dermatomyositis, lanes 13 to 17 from patients with inclusion-body myositis, and lanes 18 to 23 from other disease controls, including patients with postpolio syndrome. P I , P,, and P3 represent amplzj'ied products from the poliovirus type I-, 2-, and .+infected cultures, W represents amplijied products in water alone, and P(s) represents products from the supernatant of the poliovirus-infected vero cells. Note specijic hybridization only in the virusinfected cultures {PI, P,, P3 P(s)), but not in the muscle biopsy specimens.
served region. It is therefore unlikely, but not impossible, that a persisteat enteroviral infection has a causative role in the pathogenesis of PM, DM, and IBM.
References 1. Travers RL,Hughes GRV, Cambridge G, SewellJR. Coxsackie B neutralization titers in polymyositis dermatomyositis. Lancet 1977;1:1268 2. Tang 'IT, Sedmak GV, Siegesmund KA, McCreadie SR. Chronic myopathy associated with coxsackievirus type A. A combined electronmicroscopical and viral isolation study. N Engl J Med 1975;292:608-611 3. Bowles NE, Dubowitz V, Sewry CA, Archard LC. Dermatomyositis, polymyositis and Coxsackie B virus infections. Lancet 1987;1:1004- 1007 4. Yousef GF, Isenberg DA, Mowbray JF. Detection of enteroviNS specific FWA sequences in muscle biopsy specimens from patients with adult onset myositis. Ann Rheum Dis 1990; 49:310-315 5. Rosenberg NL, Rotbart HA, Abzug MJ, et al. Evidence for a novel picornavirus in human dermatomyositis. Ann Neurol 1989;26:204-209 6. Harley A, Rotbart HA. PCR amplification of enteroviruses. In: Innis MA, Gelfand D H , Sninsky JJ, White TJ, eds. PCR protocols. San Diego: Academic Press, 1990;372-377 7. Banker BQ, Engel AG. The polymyositis and dermatomyositis syndromes. In: Engel AG, Banker BQ, eds. Myology. New York: McGraw-Hill, 1956: 1385- 1422 8. Dalakas MC. Polymyositis, dermatomyositis, and inclusion-body myositis. N Engl J Med 1991;325:1487-1498 9. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidiurn thiocyanate-phenol-chloroformextraction. Anal Biochem 1987;162:156-159 10. Saiki RK, Scharf SJ, Faloona F, et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985;230:1350-1354
Brief Communication: Leon-Monzon and Dalakas: Enteroviruses and Inflammatory Myopathies 221
11. Jenkins 0, Booth JD, Minor PD, Almond JW. The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the picornaviridae. J Gen Virol 1987; 68:1835-1838 12. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning. Cold Spring Harbor: Cold Spring Harbor Laboratory, 1982 13. Harbarth P, Vosberg HP. Enzymatic amplification of myosin heavy-chain mRNA sequences in vitro. DNA 1988;7:297-306 14. Katsuragi S, Miyayama H , Takeuchi T. Picornavirus-like inclusions in polymyositis-aggregationof glucogen particles of the same size. Neurology 1981;31:1426-1480 15. Lipton HL. Theiler’s virus infection in mice: an unusual biphasic disease process leading to dernyelination. Infect lmmun 1975; 11:1147-1155
Juvenile Fire Setting and the Photoparoxysmal Response Lewis M. Milrod, MD, and David K. Urion, MD
Case Reports The history and clinical features of 3 boys are summarized in Table 1. Only patient 1 had a family history of seizures (mother and maternal grandmother). A11 had negative cranial computed tomographic scans, and all possessed a history of staring spells suggestive of clinical seizure activity. Therapy with carbamazepine was initiated in each patient. Patient 3 developed a rash and medication was changed to sodium valproate. Table 2 summarizes the EEG data. PPRs were elicited on multiple occasions in each patient and lasted a maximum of a tew seconds. IPS was administered for 5 to 10 seconds at a given frequency; a similar interstimulus interval elapsed before advancing to the next stimulus frequency. A fourth case has been brought to our attention that exemplifies the proposed mechanism: “A 14-year-old boy who had been an incorrigible fire setter . . . was allowed to set a fire in a container. He literally danced around the fire, blinking his eyes, and having one absence seizure after another. Successful control of his seizures and placement in a residential treatment center was accompanied by cessation of fire setting” C41 (J.B. Green, personal communication, 1990).
Discussion We report on 3 boys with fire setting, photoparoxysmal responses to intermittent photic stimulation, and temporal lobe electroencephalographic abnormalities. Fire setting resolved and behavior improved with administration of anticonvulsants. Milrod LM, Urion DK. Juvenile fire setting and the photoparoxysmal response. Ann Neurol 1992;32:222-223
Self-induced seizures using a light source are well described in patients with photosensitive epilepsy (PSE). Flickering light, hand waving, television, and video games { 13 have all been implicated. The possible mechanism of fire setting as a similar form of self-stimulation has recently been reported in 2 related patients [23. This report supports and further extends this newly recognized association between fire setting, seizures, and certain electroencephalographic (EEG) abnormalities. A photoparoxysmal response (PPR) is induced by intermittent photic stimulation (IPS) and consists of bilateral, synchronous, generalized spikes or spike and wave complexes. According to Stevens [3}, PPRs are more common in patients with primary generalized seizures (53%) and less common in patients with partial seizures (3%).
From the Department of Neurology, Harvard Medical School, and The Children’s Hospital, Boston, MA. Received Jan 29, 1991, and in revised form Dec 12, 1991, and Feb 28, 1992. Accepted for publication Feb 28, 1992. Address correspondence to Dr Milrod, Department of Neurology, Franciscan Children’s Hospital and Rehabilitation Center, 30 Warren St, Boston, MA 02135-3680.
Fire setting has rarely been reported in adults as an ictal [53 or possibly postictal {6} concomitant of complex partial seizures. A recent report of a patient with human immunodeficiency virus dementia who engaged in fire setting and was improved by treatment with valproate {73 may represent another instance of epileptic fire setting. Meinhard and colleagues {23 first reported the association between a PPR and fire setting in a 6-year-old girl in 1988. Behavior normalized and PPR resolved with administration of sodium valproate. Her father also had a history of fire setting as a child preceded by unformed visual hallucinations. His EEG revealed abnormahties that were maximal in the left posterior temporal lobe, but IPS was not performed. In our Patients 1, 2, and 3, behavioral improvement and cessation of fire setting has been sustained over an average of 26 months’ follow-up. We believe that this result is primarily attributable to the anticonvulsant medication. No additional medications were used in Patients 1 and 3. Behavioral improvement after the addition of carbamazepine in Patient 2 allowed for a 20% reduction in his previously unchanged dose of methylphenidate. Prior counseling in all patients had failed to alter fire setting behavior over a two-year period. The rapid resolution of fire setting also indicates a medication effect. With our 4 patients and Meinhard and associates’ [23 2 patients, 4 of only 6 reported cases to date have left temporal lobe dysfunction on EEG. We posit that this finding is also involved in our patients’ language disorders. Furthermore, as exemplified by Patient 3, the EEG findings in our patients may be a demonstration of a PPR as a secondary generalization from a temporal lobe focus, which is believed to be a relatively
222 Copyright 0 1992 by the American Neurological Association
We searched for enteroviral nucleic acid sequences using the polymerase chain reaction and slot-blot hybridization in coded muscle biopsy specimens from 39 patients with active inflammatory myopathies (polymyositis,dermatomyositis, and inclusion-body myositis) and from 16 patients with other neuromuscular diseases, including patients with postpolio syndrome. For primers, we used sequences of the noncoding region at the 5' end of the viral RNA. We failed to detect specific enteroviral nucleic acid sequences in the muscle biopsy specimens. Because this sensitive technique can amplify even low copy numbers of the viral genome, it appears unlikely that a persistent enteroviral infection is the cause of inflammatory myopathies. Leon-Monzon M, Dalakas MC. Absence of persistent infection with enteroviruses in muscles of patients with inflammatory myopathies. Ann Neurol 1992;32:219-222
There are reports that coxsackieviruses may be implicated in the pathogenesis of the inflammatory myopathies 11-51. Because the evidence is circumstantial and the results are conflicting, we searched the muscle biopsy specimens from 39 patients with active polymyositis (PM), dermatomyositis (DM), and inclusion-body myositis (IBM) for evidence of persistent infection with picornaviruses. We used the amplification technique to detect viral RNA, using as primers sequences of the highly conserved noncoding region at the 5 ' end of the viral RNA 167.
Methods We obtained muscle biopsy specimens from 39 patients (16 with PM, 12 with DM, and 11 with IBM) who fulfilled the strict diagnostic clinicopathological criteria of active inflammatory myopathy 17, 8). Control specimens were obtained
from 16 patients with noninflammatory myopathy, amyotrophic lateral sclerosis, and postpolio syndrome. Ten consecutive, 10-pm-thick, fresh-frozen sections were studied from each specimen. All specimens were coded and blindly analyzed.
R N A and D N A Extraction Mixtures of total RNA and DNA were extracted from four consecutive sections of each specimen. Proteins were digested with pronase, and the D N A and RNA were precipitated with ethanol. The resulting pellets were dried and dissolved in polycarbonated-treated water. Sterile solutions and sterile siliconized microfuge tubes were used to avoid RNase digestion. The concentration of nucleic acid was estimated by optical density reading. Muscle RNA was also extracted from the remaining six consecutive sections according to the guanidinium thiocynate-phenol-chlorophorm procedure 191, using an RNA isolation kit (Stratagene, La Jolla, CA).
Polymerase Chain Reaction and Electrophoresis The polymerase chain reaction (PCR) was performed twice in the nucleic acids extracted from each specimen, using standard procedures {lo] and an RNA/PCR kit (Cetus, Boston, MA). In brief, extracted RNA was first copied to cDNA with reverse transcriptase, using upstream (antisense to genomic RNA) and downstream (sense to genomic RNA) primers. After 15 minutes at 42"C, reverse transcriptase activity was destroyed by heating the samples for 5 minutes at 95"C, followed by cooling for 5 minutes at 4°C. The Ampli Taq enzyme (0.25 U/tube) was then added to the tubes, and 30 cycles of amplification began for 45 seconds at 94"C, 45 seconds at 50°C, and 60 seconds at 72"C, followed by another cycle for 10 minutes at 72°C. In each experiment, positive viral control specimens and nucleic acid-negative control samples containing only water were included. All specimens were then analyzed by 10% polyacrylamide gel electrophoresis with ethidium bromide staining.
Slot-Blot Hybridization The specificity of the viral sequences was confirmed by hybridizing the amplified PCR products with a 2 l-oligonucleotide probe between position 548-568 of the 5' end of the genomic RNA of the enteroviruses { 1If, labeled by the T4 kinase method t12). The amplified DNA was blotted into nylon membranes and prehybridized in a solution containing bovine serum albumin, denatured salmon DNA, and 0.5% sodium dodecyl sulfate. Hybridization was then followed in the same solution containing a lo7 dpm/mI 32P-labeled probe, for 16 hours at 50°C. The blots were washed and exposed to x-ray film.
Primers and Controls ~~~~~
From the Neuromuscular Diseases Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD. Received Nov 25, 1991, and in revised form Feb 6, 1992. Accepted for publication Feb 16, 1992. Address correspondence to Dr Dalakas, Neuromuscular Diseases Section, Building 10, Room 4N248, NINDS, NIH, Bethesda, MD 20892.
Enterovirus primers 1 and 2 (positions 450-474 and 584-603) {6] were selected from the highly conserved 5' end, noncoding region, of the genomic enterovirus RNA. For positive controls, we used poliovirus types 1 , 2 , and 3, and coxsackievirus B, (American Tissue Culture Collection, Rockville, MD) grown in Vero cells after standard procedures. For amplification, we used unconcentrated cell-free culture supernatant as well as viral RNA extracted from concentrated
Brief Communication: Leon-Monzon and Dalakas: Enteroviruses and Inflammatory Myopathies
2 19
supernatant. Myosin primers 1 ( 5 ’GGCTTGAATGAGGAGTAGCT3’) and 2 (5’CTGCTTCCTCCCAAGGAGCT3’) [13] were used in the PCR amplification to ensure the integrity of the nucleic acids extracted from the samples.
Results With the myosin primers, the 106-bp fragment of myosin DNA of the correct size was detected in all specimens, indicating that sufficient nucleic acids were extracted from the sections (Fig 1). With the viral primers, the poliovirus and coxsackievirus RNA was easily detected in the infected vero cells (Fig 2). By contrast, with the same primers, no amplification bands of the correct size were detected in the patient or control specimens (see Fig 2). The DNA fragments of low molecular weight observed in some of the amplified products (see Fig 2) were nonspecific, as they did not correspond to the expected viral RNA sequences. Such nonspecific fragments, which were also observed in the control samples containing water instead of RNA (see Fig 2), were most likely caused by selfannealing of the primers. When the amplified products were hybridized to the enteroviral probe, only the coxsackievirus- and the poliovirus-infected cells gave positive hybridization signals (Fig 3). None of the nonspecific amplified fragments hybridized with the probe.
Discussion Using the sensitive amplification technique and specific primers that recognize the noncoding region at the 5‘ end of the viral RNA, which is highly conserved in all members of the picornaviridae family (coxsackievirus A and B, Theiler’s virus, poliomyelitis virus, echovirus, and encephalomyocarditis virus) 161, we failed to detect RNA enteroviral sequences in muscle biopsy specimens of patients with PM, DM, and IBM. Contrary to previous reports El-51, our study shows no evidence of persistent enteroviral infection in the muscles of these patients. The evidence that enteroviruses may be implicated in the pathogenesis of inflammatory myopathies is circumstantial for several reasons. First, the presence of high neutralization antibody titers to coxsackie B virus found in some patients with PM and D M El] has no causal relationship with the disease because high titers can be found in asymptomatic persons exposed to the enteroviruses. Second, the enterovirus-like particles in muscle biopsy specimens of occasional patients could be artifacts because of their morphological similarity to glycogen and ribosomes C2, 141. Third, the reported slot-blot hybridization bands produced by the coxsackie B virus probe in preparations from 5 to 9 muscle biopsy specimens of PM and D M patients C33 were weak and identical to the bands observed with -the control b-tubulin probe, making their distinction from background bands difficult. Fourth, the in situ hybridization signals reported in 3 of 9 biopsy specimens of 220 Annals of Neurology Vol 32
No 2
August 1992
Fig I . Polyacylamide gel electrophoresis of myosin amplified by polymerase chain reaction zlsing myosin primers in h e n d e i c acids extracted from the muscle biopsy sections. The expected 206-bp DNA fragment of myosin DNA (arrow) was detected in all muscle biopsy specimens, as shown in these representative samples from patients with dermatomyositis (lanes I and 21,polymyositis (lanes 3 and 4), inclusion-body myositis (lanes 5 and 61, amyotrophic lateral sclerosis (lane 71, and postpolio syndrome (lanes 8 and 9).
patients with DM C51 are of uncertain specificity because they were observed only within the endomysial macrophages, not the muscle fibers, and only with Theiler’s murine encephalomyelitis virus, not the COXsackievirus or PV1 poliovirus, which contains the highly conserved noncoding region of the enteroviral genome. Last, coxsackie B viral mRNA was reportedly detected within the muscle fibers in 8 of 19 patients with PM or DM, using the PV1 poliovirus probe and in situ hybridization [4). However, the detection of positive signals with this method is not based on absolute nucleic acid homology between the probe and the targeted viral sequences, allowing a large probe, such as the one used in that study C4], to recognize partial sequences that belong to other, nonviral RNA. The specificity of this finding was further clouded by the inability of the investigators to demonstrate viral antigens on the same specimens with immunocytochemistry c41. The amplification method we used offers superior specificity and avoids the difficulties inherent in in situ hybridization. Because the PCR technique requires absolute nucleotide homology between the primer and the targeted RNA for a positive reaction, it detects only the specific nucleotide sequences of the enteroviral genome. Further, the PCR was performed under a high annealing temperature to avoid nonspecific amplification caused by mismatching sequences between the primers and the nucleic acids extracted from the muscle. Additionally, slot-blot hybridization confirmed the specificity of the amplified products. In comparison
A
B Fig 2. Polyacrylamide gel electrophoresis of enteroviral R N A amplified by polymerase chain reaction, using enteroviral primers in the extracted R N A from patients with infEammatory myopathies, other neuromuscukar diseases, positive viral cultures, and in water. Lanes 1 to 4 (A) and lanes 1 and 2 (B) are from patients with polymyositis, lanes 5 t o 8 (A) and lanes 3 and 4 (B) are from patients with dermatomyositis, lanes 5 t o 7 (B) are from patients with inclusion-body myositis, and lanes 9 and 10 (A) and 8 to 10 (B) are from patients with other neuromuscukar diseases, including postpolio syndrome. In A, P I and P2 are ampli$ed R N A from poliwirus-infected cultures. i n A and B, C represents amplified R N A from the coxsackievirus-infected cultures, and W represents amplijication products obtained with water alone. Note specijic amplijication of the 134-bp fragment of the enteroviral D N A (arrows) only in the virus-infected cells, but not in the muscle biopsy specimens. In A and B, the lower molecular weight bands (arrowheads), seen also in water (A), are nonspecific products.
with other studies, we also have examined a larger number of muscle biopsy sections from more patients with active disease, as well as samples from patients with the postpolio syndrome who had suffered an acute infection with the poliomyelitis virus, to exclude randomly spaced enteroviral genomes within the muscle. The PCR technique is so sensitive that it can detect even low copy numbers of the viral genome. However, viral particles sparsely distributed within the muscle could escape detection if they happen to fall outside the 100-pm total length of the muscle tissue examined. Theoretically, enteroviruses, though highly lytic, can cause a persistent infection by becoming either mutant or defective [15]. The PCR and the primers we used can detect all the mutant and defective enteroviruses, except those occurring within the sequences of the primers or those lacking part of the 5' noncoding con-
Fig 3. Slot-blot hybridization of the pol'ymerase chain reaction products, using a 23-mer 32P-radiolabeledoligonucleotideprobe. Lanes 1 to 6 represent amp(kfiedDNA from patimts with polymyositis, lanes 7 to 12 from patients with dermatomyositis, lanes 13 to 17 from patients with inclusion-body myositis, and lanes 18 to 23 from other disease controls, including patients with postpolio syndrome. P I , P,, and P3 represent amplzj'ied products from the poliovirus type I-, 2-, and .+infected cultures, W represents amplijied products in water alone, and P(s) represents products from the supernatant of the poliovirus-infected vero cells. Note specijic hybridization only in the virusinfected cultures {PI, P,, P3 P(s)), but not in the muscle biopsy specimens.
served region. It is therefore unlikely, but not impossible, that a persisteat enteroviral infection has a causative role in the pathogenesis of PM, DM, and IBM.
References 1. Travers RL,Hughes GRV, Cambridge G, SewellJR. Coxsackie B neutralization titers in polymyositis dermatomyositis. Lancet 1977;1:1268 2. Tang 'IT, Sedmak GV, Siegesmund KA, McCreadie SR. Chronic myopathy associated with coxsackievirus type A. A combined electronmicroscopical and viral isolation study. N Engl J Med 1975;292:608-611 3. Bowles NE, Dubowitz V, Sewry CA, Archard LC. Dermatomyositis, polymyositis and Coxsackie B virus infections. Lancet 1987;1:1004- 1007 4. Yousef GF, Isenberg DA, Mowbray JF. Detection of enteroviNS specific FWA sequences in muscle biopsy specimens from patients with adult onset myositis. Ann Rheum Dis 1990; 49:310-315 5. Rosenberg NL, Rotbart HA, Abzug MJ, et al. Evidence for a novel picornavirus in human dermatomyositis. Ann Neurol 1989;26:204-209 6. Harley A, Rotbart HA. PCR amplification of enteroviruses. In: Innis MA, Gelfand D H , Sninsky JJ, White TJ, eds. PCR protocols. San Diego: Academic Press, 1990;372-377 7. Banker BQ, Engel AG. The polymyositis and dermatomyositis syndromes. In: Engel AG, Banker BQ, eds. Myology. New York: McGraw-Hill, 1956: 1385- 1422 8. Dalakas MC. Polymyositis, dermatomyositis, and inclusion-body myositis. N Engl J Med 1991;325:1487-1498 9. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidiurn thiocyanate-phenol-chloroformextraction. Anal Biochem 1987;162:156-159 10. Saiki RK, Scharf SJ, Faloona F, et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985;230:1350-1354
Brief Communication: Leon-Monzon and Dalakas: Enteroviruses and Inflammatory Myopathies 221
11. Jenkins 0, Booth JD, Minor PD, Almond JW. The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the picornaviridae. J Gen Virol 1987; 68:1835-1838 12. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning. Cold Spring Harbor: Cold Spring Harbor Laboratory, 1982 13. Harbarth P, Vosberg HP. Enzymatic amplification of myosin heavy-chain mRNA sequences in vitro. DNA 1988;7:297-306 14. Katsuragi S, Miyayama H , Takeuchi T. Picornavirus-like inclusions in polymyositis-aggregationof glucogen particles of the same size. Neurology 1981;31:1426-1480 15. Lipton HL. Theiler’s virus infection in mice: an unusual biphasic disease process leading to dernyelination. Infect lmmun 1975; 11:1147-1155
Juvenile Fire Setting and the Photoparoxysmal Response Lewis M. Milrod, MD, and David K. Urion, MD
Case Reports The history and clinical features of 3 boys are summarized in Table 1. Only patient 1 had a family history of seizures (mother and maternal grandmother). A11 had negative cranial computed tomographic scans, and all possessed a history of staring spells suggestive of clinical seizure activity. Therapy with carbamazepine was initiated in each patient. Patient 3 developed a rash and medication was changed to sodium valproate. Table 2 summarizes the EEG data. PPRs were elicited on multiple occasions in each patient and lasted a maximum of a tew seconds. IPS was administered for 5 to 10 seconds at a given frequency; a similar interstimulus interval elapsed before advancing to the next stimulus frequency. A fourth case has been brought to our attention that exemplifies the proposed mechanism: “A 14-year-old boy who had been an incorrigible fire setter . . . was allowed to set a fire in a container. He literally danced around the fire, blinking his eyes, and having one absence seizure after another. Successful control of his seizures and placement in a residential treatment center was accompanied by cessation of fire setting” C41 (J.B. Green, personal communication, 1990).
Discussion We report on 3 boys with fire setting, photoparoxysmal responses to intermittent photic stimulation, and temporal lobe electroencephalographic abnormalities. Fire setting resolved and behavior improved with administration of anticonvulsants. Milrod LM, Urion DK. Juvenile fire setting and the photoparoxysmal response. Ann Neurol 1992;32:222-223
Self-induced seizures using a light source are well described in patients with photosensitive epilepsy (PSE). Flickering light, hand waving, television, and video games { 13 have all been implicated. The possible mechanism of fire setting as a similar form of self-stimulation has recently been reported in 2 related patients [23. This report supports and further extends this newly recognized association between fire setting, seizures, and certain electroencephalographic (EEG) abnormalities. A photoparoxysmal response (PPR) is induced by intermittent photic stimulation (IPS) and consists of bilateral, synchronous, generalized spikes or spike and wave complexes. According to Stevens [3}, PPRs are more common in patients with primary generalized seizures (53%) and less common in patients with partial seizures (3%).
From the Department of Neurology, Harvard Medical School, and The Children’s Hospital, Boston, MA. Received Jan 29, 1991, and in revised form Dec 12, 1991, and Feb 28, 1992. Accepted for publication Feb 28, 1992. Address correspondence to Dr Milrod, Department of Neurology, Franciscan Children’s Hospital and Rehabilitation Center, 30 Warren St, Boston, MA 02135-3680.
Fire setting has rarely been reported in adults as an ictal [53 or possibly postictal {6} concomitant of complex partial seizures. A recent report of a patient with human immunodeficiency virus dementia who engaged in fire setting and was improved by treatment with valproate {73 may represent another instance of epileptic fire setting. Meinhard and colleagues {23 first reported the association between a PPR and fire setting in a 6-year-old girl in 1988. Behavior normalized and PPR resolved with administration of sodium valproate. Her father also had a history of fire setting as a child preceded by unformed visual hallucinations. His EEG revealed abnormahties that were maximal in the left posterior temporal lobe, but IPS was not performed. In our Patients 1, 2, and 3, behavioral improvement and cessation of fire setting has been sustained over an average of 26 months’ follow-up. We believe that this result is primarily attributable to the anticonvulsant medication. No additional medications were used in Patients 1 and 3. Behavioral improvement after the addition of carbamazepine in Patient 2 allowed for a 20% reduction in his previously unchanged dose of methylphenidate. Prior counseling in all patients had failed to alter fire setting behavior over a two-year period. The rapid resolution of fire setting also indicates a medication effect. With our 4 patients and Meinhard and associates’ [23 2 patients, 4 of only 6 reported cases to date have left temporal lobe dysfunction on EEG. We posit that this finding is also involved in our patients’ language disorders. Furthermore, as exemplified by Patient 3, the EEG findings in our patients may be a demonstration of a PPR as a secondary generalization from a temporal lobe focus, which is believed to be a relatively
222 Copyright 0 1992 by the American Neurological Association
