MOLECULAR AND CELLULAR BIOLOGY, Dec. 1990, p. 6204-6215 0270-7306/90/126204-12$02.00/0 Copyright X 1990, American Society for Microbiology
Vol. 10, No. 12
Activation of Octamer-Containing Promoters by Either OctamerBinding Transcription Factor 1 (OTF-1) or OTF-2 and Requirement of an Additional B-Cell-Specific Component for Optimal Transcription of Immunoglobulin Promoters ALESSANDRA PIERANI, ADRIANA HEGUY,t HIROSHI FUJII, AND ROBERT G. ROEDER*
Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, New York 10021 Received 29 June 1990/Accepted 30 August 1990
Several distinct octamer-binding transcription factors (OTFs) interact with the sequence ATTTGCAT (the octamer motif), which acts as a transcription regulatory element for a variety of differentially controlled genes. The ubiquitous OTF-1 plays a role in expression of the cell cycle-regulated histone H2b gene as well as several other genes, while the tissue-specific OTF-2 has been implicated in the tissue-specific expression of immunoglobulin genes. In an attempt to understand the apparent transcriptional selectivity of these factors, we have investigated the physical and functional characteristics of OTF-l purified from HeLa cells and both OTF-1 and OTF-2 purified from B cells. High-resolution footprinting and mobility shift-competition assays indicated that these factors were virtually indistinguishable in binding affinities and DNA-protein contacts on either the H2b or an immunoglobulin light-chain (K) promoter. In addition, each of the purified factors showed an equivalent intrinsic capacity to activate transcription from either immunoglobulin promoters (K and heavy chain) or the H2b promoter in OTF-depleted HeLa and B-cell extracts. However, with OTF-depleted HeLa extracts, neither factor could restore immunoglobulin gene transcription to the relatively high level observed in unfractionated B-cell extracts. Restoration of full immunoglobulin gene activity appears to require an additional B-cell regulatory component which interacts with the OTFs. The additional B-cell factor could act either by facilitating interaction of OTF activation domains with components of the general transcriptional machinery or by contributing
a
novel activation domain.
The promoters of class II genes are composed of discrete DNA elements that are necessary for accurate initiation, basal transcriptional activity, and temporal, spatial, or inducible regulation of gene expression. These DNA elements serve to mediate the action of transcription factors (for review, see references 21, 29, 32, and 44), which bind directly or indirectly to them. Interestingly, genes that have very different patterns of expression nevertheless possess common DNA regulatory elements that interact with the same or similar activator proteins. Among the most versatile of these regulatory elements is the octamer motif, which is a primary determinant of the B-cell-specific activity of immunoglobulin promoters and enhancers (2, 10, 13, 17, 30, 33, 41, 62; for reviews, see references 4, 22, and 46), the cell cycle regulation of the human histone H2b gene (11, 25, 52), and the ubiquitous transcription of both the 7SK and the U6 RNA genes by RNA polymerase III (35-37) and the Ul and U2 small nuclear RNAs by RNA polymerase II (7). Thus far, one ubiquitous and several cell type-specific octamer-binding transcription factors (OTFs) have been identified (26, 50, 53, 54; reviewed in reference 22). The ubiquitous OTF-1 (also called NFA1, OBP100, NFIII, and oct-1) is a 97-kDa protein involved in both the cell cycle regulation of a histone H2b gene (11, 25) and the constitutive expression of the small nuclear RNA genes. OTF-1 is also functionally equivalent to NFIII and mediates adenovirus DNA replication (40, 43, 45, 60). The tissue-specific OTF-2 is composed of three polypeptides of approximately 60 kDa
(48; see also reference 49), which have been shown to activate immunoglobulin promoters in vitro (48) and which are presumed to mediate tissue-specific expression. Cloning and sequence comparisons of OTF-1 and OTF-2 (5, 23, 34, 47, 56) showed a very high amino acid sequence conservation in a region (POU domain) implicated in DNA binding (18, 57), with little external sequence conservation. This explains the similar binding specificity of these proteins and, given the separation of DNA-binding and activation domains in other regulatory proteins (44), could provide a molecular basis for the differential function of these proteins. The mechanisms involved in differential promoter activation by related factors that bind to common DNA control elements in noncoordinately regulated genes remain unknown and constitute one of the most interesting problems in transcription. Recent studies (27) reported that both OTF-1 and OTF-2 are able to stimulate transcription of an immunoglobulin heavy-chain (IgH) promoter in vitro and suggested that B-cell-specific transcription is due simply to a quantitative difference in OTF abundance. However, no direct correlation has been found between levels of immunoglobulin heavy-chain gene transcription and OTF-2 expression in vivo (6, 20), and other studies have shown markedly higher levels of heavy- and light-chain gene transcription in extracts from lymphoid cells whose levels of OTFs approximate those found in nonlymphoid cell extracts (33, 42, 48). How then can B-cell-specific transcription occur in an octamer-dependent manner? To address this question, we compared OTF-1 and OTF-2 with respect to both their site-specific DNA-binding properties and their capacities for octamer-dependent stimulation of transcription from the
* Corresponding author. t Present address: Centro Ricerche, Sclavo, Via Fiorentina 1, Siena 53100, Italy.
6204
IN VITRO FUNCTION OF OTF-1 AND OTF-2
VOL. 10, 1990
ubiquitous H2b and two B-cell-specific promoters. Our studies suggest that the preferential transcription of immunoglobulin promoters in lymphoid cells (and derived extracts) does not reflect intrinsic differences in the DNAbinding and transcriptional activation properties of purified OTF-1 and OTF-2 and lead us to invoke the involvement of an additional lymphoid-specific component(s). MATERIALS AND METHODS Plasmid construction. pl-12-28 contains the human histone H2b sequences from -100 to +28 cloned into the HinclI site of pUC12 (52). pGT131 contains the HaeIII-AvaII fragment of the mouse T1 (a K light chain) gene (10) cloned into the pGEM1 vector (33). pGT131dcA is a double point mutant of pGT131 in which the octamer sequence ATTTGCAT (-66 to -59) has been mutated to ATGTGCAG. pEH2b2.5 contains the human histone H2b sequences from -59 to +229 (52) cloned into the HindIlI-EcoRI sites of pEMBL19 (8). pEH2b2.50- is an octamer mutant of pEH2b2.5, in which the sequence ATTTGCAT (-49 to -42) was mutated to CGGGTACG. H+O+ is a wild-type immunoglobulin heavychain BCL1 promoter linked to the OVEC vector (61), and H+O- is an octamer mutant of it (42). Cell culture and extract preparation. HeLa cells were grown in spinner flasks in Joklik medium supplemented with 5% bovine calf serum. Namalwa cells were grown in spinner flasks in RPMI 1640 medium supplemented with nonessential amino acids, glutamine, and 10% fetal bovine serum (48). Nuclear extracts were prepared as described by Dignam et al. (9). Gel retardation-competition analysis. Binding reaction mixes (20 ,ul) contained 4% Ficoll, 20 mM HEPES (N-2hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 8.4), 60 mM KCI, 1 ,ug of poly(dI-dC) heteropolymer (Pharmacia), 1 ng of end-labeled probe, and 3 ,ul of a Namalwa heparinagarose low-salt fraction (150 mM) containing the OTF-1 and OTF-2 binding activities (48). This fraction was used to avoid the formation of overlapping complexes between proteins present in the heparin-agarose high-salt fractions or in crude Namalwa extracts and the K promoter probe (48). The K probe was prepared by end-labeling an EcoRI-HindIII 212-bp fragment from pGT131 containing the K promoter region from -131 to +36. The H2b probe was an end-labeled BamHI-HindIlI 170-bp fragment from pl-12-28, containing the H2b promoter region from -100 to +28. These fragments were also used as unlabeled specific competitor DNAs in the gel shift reactions in increasing molar excess with respect to the probe, as shown in Fig. 1A. A 222-bp AvaIl fragment from pUC12 was used as nonspecific competitor DNA. Competitor oligonucleotides were a 21-bp double-stranded specific oligonucleotide (5'-CT TCACCTTATTTGCATAAGC) containing the H2b octamer site and flanking sequences, a 24-bp double-stranded K-specific oligonucleotide (5'-TTCCCAATGATTTGCATGCTC TCA), and a nonspecific double-stranded oligonucleotide containing fos promoter sequences (a gift of Ron Prywes). After incubation for 20 min at 30°C, the binding reaction mixes were loaded onto a 4% polyacrylamide gel (acrylamide-bisacrylamide, 60:1) and electrophoresed at 20 V/cm in 0.25x TBE (22 mM Tris borate [pH 8.3], 0.5 mM EDTA). Gels were dried and exposed to X-ray film. The OTF-1- and OTF-2-shifted bands and the free DNA bands were cut from the gels by superimposing the corresponding autoradiogram, and radioactivity was quantitated by scintillation counting. Binding reactions for Fig. 5 were done essentially as
6205
B
A OTF-i OT F-I OTF -2
M
205-
-
97 -
--
66
00
M HeLa Nom
Nam
&OTF-1 OTF-I HeLo
Nam
OTF-2 Nam
O TF
I-*
64
_
]OTFr-2[
-58
..4
4 5-
2
3
4
5
2
3
FIG. 1. SDS-polyacrylamide gel electrophoresis of affinity-purified OTF-1 from HeLa and Namalwa cells and OTF-2. The sizes of the marker proteins (lanes M) are indicated (in kilodaltons). The arrows indicate the positions of OTF-ls and OTF-2 in the corresponding lanes. (A) Purified OTFs used for DNase I and MPE footprinting analysis. Lanes 1 and 2. Size markers. The polypeptide of 66 kDa in all purified preparations is bovine serum albumin. (B) Purified factors used in transcription assays. Lanes 3A and 1B. OTF-1 purified from HeLa cells. Lanes 4A and 2B, OTF-1 purified from Namalwa (Nam) cells. Lanes 5A and 3B, OTF-2 purified from Namalwa cells. The polypeptide of 48 kDa in lane 3 is an exogenous protein which contaminated the gel apparatus.
described above, except that an H2b octamer-containing double-stranded oligonucleotide (37) was used as the probe and protein fractions were serially diluted. Nonidet P-40 (0.03%) and bovine serum albumin (0.1 mg/ml) were also added to the reaction mixes, and the gels contained 0.03% Nonidet P-40 as well. Each OTF-retarded complex was excised from the gel, and radioactivity was counted by scintillation. One unit of binding activity is defined as the amount of protein sufficient to bind 25 fmol of probe. We estimated that there was 1 U of OTF-1 binding activity per ,ul of HeLa nuclear extract (20 ,ug of protein) and 1.25 U of OTF-1 and 0.6 U of OTF-2 binding activity per ,ul of Namalwa nuclear extract (10 ,ug of protein). Purification of OTFs. For the binding studies, OTF-2 and OTF-1 from Namalwa cells were prepared as described before (48), while OTF-1 from HeLa cells was purified as described by Murphy et al. (37) (method 1). For the in vitro transcription assays, OTF-2 was prepared as described by Scheidereit et al. (48). OTF-1 from Namalwa cells was purified essentially as reported by Scheidereit et al. (48), except that a wheat germ agglutinin affinity column was substituted for the nonspecific DNA column. OTF-1 from HeLa cells was purified by wheat germ agglutinin chromatography, followed by a specific binding-site affinity column essentially as described by Jackson and Tjian (19) (Pierani et al., unpublished data). DNase I and MPE protection analysis. The H2b and K probes were identical to those described for the gel retardation-competition assays; they were labeled at either end in order to detect interactions on both coding and noncoding strands. Binding reaction mixes (20 ,ul) contained 20 mM HEPES (pH 8.4), 60 mM KCI, 1 mM dithiothreitol, 2 mM MgCl,, 0.1 mg of bovine serum albumin per ml, 100 ng of poly(dI-dC) heteropolymer, 1 ng (7 fmol) of labeled probe. and, where indicated, 2 ,ul (-20 ng) of affinity-purified OTF proteins. The reaction mixtures were incubated for 20 min at 30°C. For DNase I footprinting analysis, 20 ,ug of DNase I per ml was added for 30 s at 30°C; the reaction was stopped by addition of 2 ,ul of 250 mM Tris hydrochloride (Tris-HCl)-
6206
PIERANI ET AL.
250 mM EDTA-0.4% sodium dodecyl sulfate (SDS), phenolchloroform extracted, ethanol precipitated, and loaded onto an 8% sequencing gel. For methidiumpropyl-EDTA (MPE) footprinting analysis, 0.2 nmol of MPE was added to the binding reaction mixtures and incubated for 4.5 min at 30°C. The cleavage reaction was stopped by addition of 3 ,u of 250 mM EDTA-3 M ammonium acetate, phenol-chloroform extracted, ethanol precipitated, and loaded onto an 8% sequencing gel. Depletion of nuclear extracts. Namalwa (2 ml, 20 mg of protein) or HeLa (40 mg of protein) nuclear extract was incubated in a rotatory shaker twice for 45 min each at 4°C with 200 ,ul of affinity matrix coupled with a double-stranded oligonucleotide containing the H2b octamer site (5'-CTTC ACCTTATTTGCATAAGCGAT). The supernatant after the second depletion was recovered by centrifugation and used for the transcription reactions. Proteins were eluted from the affinity matrix by rotating with 0.5 ml of BC buffer (20 mM Tris-HCl [pH 7.9], 0.5 mM EDTA, 20% glycerol) plus 1 M KCl for 30 min at 4°C. The bound proteins were recovered by centrifugation and dialyzed against BC buffer plus 100 mM KCI. Then, 2 ,u1 of all samples was analyzed by the gel retardation assay to confirm the depletion. In vitro transcription. Transcription reaction mixes (25 pI) for the immunoglobulin K and the H2b promoters contained 40 mM Tris-HCI (pH 8.0), 60 mM KCI, 0.3 mM EDTA, 0.3 mM dithiothreitol, 12% glycerol, 3 mM MgC12, 0.6 mM ribonucleoside triphosphates, 0.25 pug of supercoiled template DNA (pGT131 and pGTdcA as K templates, pEH2b2.5 and pEH2b2.50- as H2b templates), and 8 RI (80 pug of protein) of Namalwa or OTF-depleted Namalwa nuclear extract or 10 [lI of HeLa or HeLa OTF-depleted nuclear extract (200 pig of protein). Depleted extracts were supplemented with 5 pul of Namalwa or HeLa-bound fraction (crude octamer-containing fractions eluted from the affinity matrix used in the depletion procedure) or with different amounts of purified OTF proteins as specified in the figure legends. Reaction mixes were incubated at 30°C for 1 h and treated essentially as described by Poellinger et al. (42). In vitro-synthesized RNAs from both K and H2b templates were analyzed by Si nuclease protection (3). The probe used for mapping the K transcripts was a 96-base oligonucleotide containing sequences from -21 to +39 of the mouse T1 gene plus 36 nucleotides (nt) of the pGEM1 polylinker. The H2b probe was a 93-base oligonucleotide containing from -23 to +70 of the H2b gene. The protected transcripts for K were 75 nt long, and those for H2b were 70 nt. In vitro transcription of the immunoglobulin heavy-chain promoter (BCL1) was analyzed as described by Poellinger et al. (42) with some modifications. Transcription reaction mixes (25 RI) contained 40 mM HEPES (pH 8.4), 60 mM KCl, 12% glycerol, 3 mM MgCI2, 0.12 mM EDTA, 0.3 mM dithiothreitol, 0.16 mM phenylmethylsulfonyl fluoride, 0.6 mM each ribonucleoside triphosphates, 10 pug of supercoiled template DNA per ml, and 10 RI of nuclear extract or 10 pI of depleted Namalwa nuclear extract plus purified OTFs. Purified RNAs were mapped by Si analysis (3) with a 90-nt oligonucleotide containing sequences from -18 to +75 of the rabbit I-globin gene in the OVEC plasmid (61). The protected transcripts were 75 nt long. For each of the transcription assays, the S1 nucleaseresistant transcripts were excised from the gels, and radioactivity was quantitated by scintillation counting. Each value was determined in three to six independent experiments, with an experimental variation of 2 to 12%.
MOL. CELL. BIOL.
RESULTS
OTF-ls and OTF-2 show identical DNA-protein contacts on H2b and IgK promoters. Previous studies with the immunoglobulin light-chain (IgK) promoter showed a much higher level of octamer-dependent transcription in Namalwa cell extracts than in HeLa cell extracts, in agreement with in vivo studies, whereas control genes (including H2b) were transcribed at comparable levels (33). To investigate the possibility that activation of B-cell-specific promoters is a consequence of differential recognition of the octamer sequence by OTF-1 and OTF-2, we compared their proteinDNA contacts. We have previously shown that a tissuespecific octamer-binding transcription factor (OTF-2) and a ubiquitous octamer-binding transcription factor (OTF-1), both isolated from human lymphoma cells, recognized identical sequences in the K promoter, as determined by methylation interference and DNase I footprinting analyses (48). In order to achieve greater resolution and to extend these analyses to the H2b promoter, we purified OTF-1 from both HeLa cells (11) and Namalwa (a human lymphoma) cells (48) and OTF-2 from Namalwa cells (48). OTF-1 was purified as described in Materials and Methods, and the purified proteins were analyzed on an SDS gel (Fig. 1A). We consistently observed a small difference in the sizes of the HeLa and the Namalwa OTF-1s, which we assume might be due to distinct covalent modifications (see also legend to Fig. 1). Specific interactions between OTF proteins and the histone H2b and K promoters were investigated by DNase I and MPE protection assays. Each OTF protein showed an identical DNase I footprinting pattern on the K promoter, extending from nt -54 to -75 on the coding strand and from -53 to -72 on the noncoding strand, as shown previously (48) (Fig. 2A and C). While DNase I digestion provides a general delineation of the DNA sequences involved in the interactions, MPE resolves more precisely the most significant protein-DNA contacts. In these analyses, the three OTFs showed identical protection against MPE cleavage, which was restricted to the octamer sequence itself (Fig. 3A and C). These data demonstrate that all three proteins bind the K promoter through indistinguishable DNA contacts and that the core of these interactions is centered over the conserved octamer sequence. DNase I footprinting analysis of OTFs on the H2b promoter revealed a more complex pattern of protection (Fig. 2B and C). Both the HeLa and the Namalwa OTF-1 and OTF-2 showed strong protection over the octamer site, extending from -35 to -55 on the coding strand and from -60 to -36 on the noncoding strand. In addition, we observed an area of weaker protection over the TATA box region, extending from -28 to -35 on the coding strand and from -22 to -36 on the noncoding strand. This protection was more marked for the OTF-1s, whereas OTF-2 protected this region only weakly (Fig. 2B and C). MPE protection assays revealed that the strongest contacts were centered over the octamer sequence itself, while weaker contacts extended over the five downstream adjacent nucleotides. Again, weak protection of the TATA box was observed, which was more pronounced for the OTF-1 proteins than for OTF-2 (Fig. 3B and C). OTF-ls and OTF-2 have equivalent affinities for the H2b and K T1 promoters. The relative binding affinities of OTF-1 and OTF-2 for the octamer site were determined by a gel retardation-competition assay. A heparin-agarose fraction of a B-cell extract which contained both OTF-1 and OTF-2 was incubated with a labeled DNA fragment derived from the K
IN VITRO FUNCTION OF OTF-1 AND OTF-2
VOL. 10, 1990
A t 4:
tk
46
B
4:ko
rt
6207
4: 4:t
t
4-w am
_s
_
--22
M.38
-a -75u
n
n
i=
-
-541 -7
_
--
2
-
no -coin
r-9 _
_
_--_ a,-___ coding _odin
-60 -
i=-
_
_-
28
4=
4m
_
c
no
-
-ci
coding
H2b promoter
K - light choin promoter
C m
I
AATAACTACCAATCAGACACAAGACT TCAACTCTTCACCTTAMGCATAAGCGATTCTATATAAAAGCGCCTTGTCATAC H2B t- -/ / /g /gS
1L
il
I
TGGGGACTTCTTCATATACCCGTCNACATG K
-90 -80 -70 -60 -50 -40 -30 -20 -10 FIG. 2. DNase 1 footprinting of the K and H2b promoters with affinity-purified OTFs. The protected sequences (nucleotides) are indicated by a bar, and the numbers correspond to the nucleotide positions in the promoters. Lanes G, Maxam-Gilbert G reaction; lanes 0, no protein added. (A) DNase I footprinting of HeLa OTF-1, Namalwa (Nam) OTF-1, and Namalwa OTF-2 on both strands of the K promoter. (B) DNase I footprinting analysis on both strands of the histone H2b promoter. Weak protections are indicated by a dashed line. (C) Summary of the DNase I protection patterns in the K and H2b promoter regions. Only the strongly protected regions are shown (shaded boxes), along with hypersensitive sites (arrows). Numbers correspond to nucleotide positions in both promoters. The CAAT box, conserved octanucleotide, and TATA boxes are boxed.
promoter region. Increasing amounts of DNA containing either no octamer site or a K- or H2b-derived octamer site were used as competitors in these reactions. To determine whether the sequences flanking the octamer-binding site in either promoter influence binding affinities, we used two sets of specific competitor DNAs: (i) restriction fragments approximately 200 bp long, containing the entire K or H2b promoter region and (ii) synthetic oligonucleotides (24 and 21 bp long) representing the K and H2b octamer sites and their flanking nucleotides, respectively. The shifted bands were excised and radioactivity was quantitated as described in Materials and Methods, and the data are presented in Fig. 4. We observed no differences in DNA affinity between OTF-1 and OTF-2, although both proteins bound more efficiently to the H2b octamer site than to the K site (Fig. 4A). This preference for the H2b sequence was lost when oligonucleotides were used as competitors (Fig. 4B). Interestingly, the H2b oligonucleotide did not contain the TATA box element, which was partially protected from DNase digestion by OTFs (Fig. 2B), and therefore may serve to
stabilize the protein-DNA interactions. We also note that despite the minor differences in DNase protection observed between OTF-1 and OTF-2 (Fig. 2B), the proteins showed no difference in DNA affinity. Therefore, we cannot explain tissue-specific expression of immunoglobulin promoters on the basis of differences in the intrinsic abilities of OTF-1 and OTF-2 to recognize and bind their cognate DNA sites. Both OTF-ls and OTF-2 stimulate transcription of the histone H2b gene in vitro. Although DNA binding is a prerequisite for the action of many activators, this parameter does not necessarily provide an indication of the functional capacity of the bound protein. To test these parameters as well as the potential significance of the observed DNAprotein interactions, the factors were assayed in a cell-free transcription system. This system consists of a nuclear extract specifically depleted of octamer proteins by affinity chromatography but retaining all of the general factors necessary for RNA polymerase II transcription initiation (31). We have previously used such extracts to demonstrate that OTF-2 stimulates transcription from the K promoter (48). Here we used both OTF-depleted HeLa and OTF-
6208
PIERANI ET AL.
..
A
r,~
A. ". J
*9:._ _MYwA.'
MOL. CELL. BIOL.
3-
0,
0D
~O
I*S
0
00.0 e$
;-51 -49
244
1 3v 1.ir i S.
R
=e
: #.:.1.
_
*-....
0.:-'.;t t_4g
I
2
:1WRs x
W .
5
lMi!t
as..R
X£ &
=.08:.,
w c.
..
_Y *
qon- coding K --
C
ligth? criain promoter
coding
non-coding
H,b
promoter
AATAACTACCrAATr'AGACACAAGACTTCAACTCTTCACCTTATTTGCATAAGCGATTCTATATAMAAAGCTTGTCATAI H28
,CrAGCAATAACTGGTITrCCCAATGATTTGCATGCTCTCACTTCACTGCCTTGGGGACTTCTTCATArACCCGTCACACATG K -90
-40 -t3 -60 -50 -30 -10 -20 FIG. 3. MPE protection of the K and H2b promoters by OTFs. (A) MPE protection pattern of HeLa OTF-1, Namalwa (Nam) OTF-1, and Namalwa OTF-2 on both strands of the K promoter. The protected nucleotides are indicated by a bar; numbers represent nucleotide positions. (B) MPE protection pattern of OTFs on both strands of the H2b promoter. Strongly protected nucleotides are indicated by the thick bar, weakly protected ones by the thin bar: numbers represent nucleotide positions. (C) Summary of MPE-protected sequences in the K and H2b promoter regions. Strong interactions are indicated by thick bars, and weak interactions are signaled by thin bars. The numbers represent nucleotide positions on both promoters. The CAAT box, octamer sequences and TATA box are boxed. -8C
depleted Namalwa extracts to transcribe the ubiquitously expressed H2b and the B-cell-specific K promoters in the presence of added HeLa OTF-1, Namalwa OTF-1, or Namalwa OTF-2. The OTF factors used for these assays were purified by a new procedure, which includes a wheat germ agglutinin affinity chromatography step (Materials and Methods), and are shown in Fig. lB. To determine the specific activity of each OTF preparation used in our experiments, both nuclear extracts and purified OTFs were tested for octamer binding activity in a gel retardation assay (Fig. 5). Subsequent experiments were performed with equal amounts of binding activity of each protein on both templates to facilitate comparisons between the various OTFs (both purified and in the unfractionated extracts). Previous experiments carried out in our laboratory have demonstrated that OTF-1 purified from HeLa cells is capable of stimulating transcription from the histone H2b promoter in vitro (11). We therefore wished to determine whether H2b transcription could also be stimulated by OTF-2. An H2b promoter construct containing sequences to position -59 and including either a wild-type (WT) or mutated (O-)
octamer site was transcribed in OTF-depleted HeLa and Namalwa extracts. Core promoter activity was monitored by using the 0- promoter construct. Octamer-dependent transcriptional stimulation was determined by addition of OTF-1 and OTF-2 purified from HeLa and Namalwa cells. As shown in Fig. 6, transcription from the H2b promoter containing a WT octamer motif was six- to eightfold more efficient than that from the 0- template in either HeLa or Namalwa nuclear extracts (Fig. 6A and B, lanes 1 to 4). In contrast, both templates were transcribed with equal but reduced efficiencies in the OTF-depleted extracts (Fig. 6A and B, lanes 5 and 6). Addition of any of the three purified OTFs restored full transcription activity of the octamercontaining H2b template but had no effect on the 0template (Fig. 6A and B, lanes 7 to 24). Furthermore, the observed stimulation per binding unit was comparable for each of the three OTF proteins in either OTF-depleted extract, and 15 U of purified OTFs was sufficient to recover the activity obtained with nuclear extracts containing 10 OTF-binding units of HeLa and 15 U of Namalwa extract. Identical results were obtained with an H2b template containing sequences to position -162, thus ruling out the
IN VITRO FUNCTION OF OTF-1 AND OTF-2
VOL. 10, 1990
H eLa N E
100
HeLa ITr--
NJuri r. E
NornOTF-I
6209
NamOTF-2
PUC 12
50
OTF-2-
4.
0 MOLAR EXCESS COMPETITOR (-'v2OO BP FRAGMENT)
0
z
2 34 5 6 7 8 9 1011121314151617181920 FIG. 5. Titration of OTF binding activity in nuclear extracts and purified preparations. Gel retardation assays were performed with an H2b octamer-containing oligonucleotide as the probe and incubation with serial dilutions of the proteins. Lanes 1 to 4, HeLa nuclear extract (NE). Lanes 5 to 8, HeLa purified OTF-1. Lanes 9 to 12, Namalwa (Nam) nuclear extract (NE). Lanes 13 to 16, Namalwa purified OTF-1. Lanes 17 to 20, Namalwa purified OTF-2. Amounts of nuclear extract: lanes 1 and 9, 0.1 ,ul; lanes 2 and 10, 0.05 ,ul; lanes 3 and 11, 0.025 ,ul; lanes 4 and 12, 0.0125 p.l. Amounts of purified OTF: lanes 5, 13, and 17, 0.02 ,ul; lanes 6, 14, and 18, 0.01 ,u1; lanes 7, 15, and 19, 0.005 ,ul; lanes 8, 16, and 20, 0.0025 ,u1. The arrows indicate the positions of the OTF-1 and OTF-2 complexes.
0
._=-15
100
FOS
OTF-2 -0.- OTF- I
K
50
H28
0
4 10 20 50 100 MOLAR EXCESS COMPETITOR (30 BP OLIGONUCLEOTI DE) FIG. 4. Relative affinities of OTF-1 and OTF-2 for the lightchain gene promoter region. Octamer-containing heparin-agarose fractions from Namalwa nuclear extracts were incubated with a 212-bp K probe in the presence of competitor restriction fragments (A) or competitor oligonucleotides (B). Complexes were separated by a gel electrophoresis retardation assay. The amount of radioactive K probe bound to either OTF-1 or OTF-2 in the absence of competitor DNA was taken as 100%o. Symbols: 0, binding to OTF-1; 0, binding to OTF-2. (A) Competitor DNA fragments were a nonspecific pUC12 AvaIl-AvaIl restriction fragment, an H2b promoter fragment, and the same K fragment used as the probe, as indicated. (B) Competitor oligonucleotides were a nonspecific fos sequence, an H2b octamer-containing oligonucleotide, and a K octamer-containing oligonucleotide, as indicated. K
possibility that the specificity of the -59 template for OTF-1 versus OTF-2 was lost as a result of deletion of the upstream sequences (data not shown). Full transcriptional activity of B-cell-specific promoters requires OTFs and an additional lymphoid-specific factor. To determine whether OTF-1 and OTF-2 could function interchangeably on a B-cell-specific promoter, we compared OTF-1 and OTF-2 function on the light chain promoter. Transcription of K promoter constructs containing either a WT or double point mutant (O-) octamer motif in Namalwa nuclear extract demonstrated a clear (four- to fivefold) octamer-dependent stimulation of transcription (Fig. 7, lanes 3 and 4; Fig. 8, lanes 1 and 2). In contrast, transcription of the same templates in HeLa cell nuclear extract showed a low but noticeable (1.0- to 1.5-fold) octamer dependence (Fig. 7, lanes 1 and 2; Fig. 8, lanes 3 and 4). The four- to fivefold-higher transcriptional activity of the WT template relative to the 0- template in the B-cell extract was eliminated following depletion of OTF proteins (Fig. 7, lanes 5 K
and 6). However, transcription of the WT template was restored when purified OTFs from either HeLa or Namalwa cells were added to an OTF-depleted Namalwa nuclear extract (Fig. 7, lanes 7 to 24). As was shown above for the H2b promoter, each of the three OTFs appeared to have the same intrinsic capacity to stimulate transcription from the K light-chain promoter. Whereas some preparations of Namalwa OTF-1 were slightly contaminated with OTF-2 (
Vol. 10, No. 12
Activation of Octamer-Containing Promoters by Either OctamerBinding Transcription Factor 1 (OTF-1) or OTF-2 and Requirement of an Additional B-Cell-Specific Component for Optimal Transcription of Immunoglobulin Promoters ALESSANDRA PIERANI, ADRIANA HEGUY,t HIROSHI FUJII, AND ROBERT G. ROEDER*
Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, New York 10021 Received 29 June 1990/Accepted 30 August 1990
Several distinct octamer-binding transcription factors (OTFs) interact with the sequence ATTTGCAT (the octamer motif), which acts as a transcription regulatory element for a variety of differentially controlled genes. The ubiquitous OTF-1 plays a role in expression of the cell cycle-regulated histone H2b gene as well as several other genes, while the tissue-specific OTF-2 has been implicated in the tissue-specific expression of immunoglobulin genes. In an attempt to understand the apparent transcriptional selectivity of these factors, we have investigated the physical and functional characteristics of OTF-l purified from HeLa cells and both OTF-1 and OTF-2 purified from B cells. High-resolution footprinting and mobility shift-competition assays indicated that these factors were virtually indistinguishable in binding affinities and DNA-protein contacts on either the H2b or an immunoglobulin light-chain (K) promoter. In addition, each of the purified factors showed an equivalent intrinsic capacity to activate transcription from either immunoglobulin promoters (K and heavy chain) or the H2b promoter in OTF-depleted HeLa and B-cell extracts. However, with OTF-depleted HeLa extracts, neither factor could restore immunoglobulin gene transcription to the relatively high level observed in unfractionated B-cell extracts. Restoration of full immunoglobulin gene activity appears to require an additional B-cell regulatory component which interacts with the OTFs. The additional B-cell factor could act either by facilitating interaction of OTF activation domains with components of the general transcriptional machinery or by contributing
a
novel activation domain.
The promoters of class II genes are composed of discrete DNA elements that are necessary for accurate initiation, basal transcriptional activity, and temporal, spatial, or inducible regulation of gene expression. These DNA elements serve to mediate the action of transcription factors (for review, see references 21, 29, 32, and 44), which bind directly or indirectly to them. Interestingly, genes that have very different patterns of expression nevertheless possess common DNA regulatory elements that interact with the same or similar activator proteins. Among the most versatile of these regulatory elements is the octamer motif, which is a primary determinant of the B-cell-specific activity of immunoglobulin promoters and enhancers (2, 10, 13, 17, 30, 33, 41, 62; for reviews, see references 4, 22, and 46), the cell cycle regulation of the human histone H2b gene (11, 25, 52), and the ubiquitous transcription of both the 7SK and the U6 RNA genes by RNA polymerase III (35-37) and the Ul and U2 small nuclear RNAs by RNA polymerase II (7). Thus far, one ubiquitous and several cell type-specific octamer-binding transcription factors (OTFs) have been identified (26, 50, 53, 54; reviewed in reference 22). The ubiquitous OTF-1 (also called NFA1, OBP100, NFIII, and oct-1) is a 97-kDa protein involved in both the cell cycle regulation of a histone H2b gene (11, 25) and the constitutive expression of the small nuclear RNA genes. OTF-1 is also functionally equivalent to NFIII and mediates adenovirus DNA replication (40, 43, 45, 60). The tissue-specific OTF-2 is composed of three polypeptides of approximately 60 kDa
(48; see also reference 49), which have been shown to activate immunoglobulin promoters in vitro (48) and which are presumed to mediate tissue-specific expression. Cloning and sequence comparisons of OTF-1 and OTF-2 (5, 23, 34, 47, 56) showed a very high amino acid sequence conservation in a region (POU domain) implicated in DNA binding (18, 57), with little external sequence conservation. This explains the similar binding specificity of these proteins and, given the separation of DNA-binding and activation domains in other regulatory proteins (44), could provide a molecular basis for the differential function of these proteins. The mechanisms involved in differential promoter activation by related factors that bind to common DNA control elements in noncoordinately regulated genes remain unknown and constitute one of the most interesting problems in transcription. Recent studies (27) reported that both OTF-1 and OTF-2 are able to stimulate transcription of an immunoglobulin heavy-chain (IgH) promoter in vitro and suggested that B-cell-specific transcription is due simply to a quantitative difference in OTF abundance. However, no direct correlation has been found between levels of immunoglobulin heavy-chain gene transcription and OTF-2 expression in vivo (6, 20), and other studies have shown markedly higher levels of heavy- and light-chain gene transcription in extracts from lymphoid cells whose levels of OTFs approximate those found in nonlymphoid cell extracts (33, 42, 48). How then can B-cell-specific transcription occur in an octamer-dependent manner? To address this question, we compared OTF-1 and OTF-2 with respect to both their site-specific DNA-binding properties and their capacities for octamer-dependent stimulation of transcription from the
* Corresponding author. t Present address: Centro Ricerche, Sclavo, Via Fiorentina 1, Siena 53100, Italy.
6204
IN VITRO FUNCTION OF OTF-1 AND OTF-2
VOL. 10, 1990
ubiquitous H2b and two B-cell-specific promoters. Our studies suggest that the preferential transcription of immunoglobulin promoters in lymphoid cells (and derived extracts) does not reflect intrinsic differences in the DNAbinding and transcriptional activation properties of purified OTF-1 and OTF-2 and lead us to invoke the involvement of an additional lymphoid-specific component(s). MATERIALS AND METHODS Plasmid construction. pl-12-28 contains the human histone H2b sequences from -100 to +28 cloned into the HinclI site of pUC12 (52). pGT131 contains the HaeIII-AvaII fragment of the mouse T1 (a K light chain) gene (10) cloned into the pGEM1 vector (33). pGT131dcA is a double point mutant of pGT131 in which the octamer sequence ATTTGCAT (-66 to -59) has been mutated to ATGTGCAG. pEH2b2.5 contains the human histone H2b sequences from -59 to +229 (52) cloned into the HindIlI-EcoRI sites of pEMBL19 (8). pEH2b2.50- is an octamer mutant of pEH2b2.5, in which the sequence ATTTGCAT (-49 to -42) was mutated to CGGGTACG. H+O+ is a wild-type immunoglobulin heavychain BCL1 promoter linked to the OVEC vector (61), and H+O- is an octamer mutant of it (42). Cell culture and extract preparation. HeLa cells were grown in spinner flasks in Joklik medium supplemented with 5% bovine calf serum. Namalwa cells were grown in spinner flasks in RPMI 1640 medium supplemented with nonessential amino acids, glutamine, and 10% fetal bovine serum (48). Nuclear extracts were prepared as described by Dignam et al. (9). Gel retardation-competition analysis. Binding reaction mixes (20 ,ul) contained 4% Ficoll, 20 mM HEPES (N-2hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 8.4), 60 mM KCI, 1 ,ug of poly(dI-dC) heteropolymer (Pharmacia), 1 ng of end-labeled probe, and 3 ,ul of a Namalwa heparinagarose low-salt fraction (150 mM) containing the OTF-1 and OTF-2 binding activities (48). This fraction was used to avoid the formation of overlapping complexes between proteins present in the heparin-agarose high-salt fractions or in crude Namalwa extracts and the K promoter probe (48). The K probe was prepared by end-labeling an EcoRI-HindIII 212-bp fragment from pGT131 containing the K promoter region from -131 to +36. The H2b probe was an end-labeled BamHI-HindIlI 170-bp fragment from pl-12-28, containing the H2b promoter region from -100 to +28. These fragments were also used as unlabeled specific competitor DNAs in the gel shift reactions in increasing molar excess with respect to the probe, as shown in Fig. 1A. A 222-bp AvaIl fragment from pUC12 was used as nonspecific competitor DNA. Competitor oligonucleotides were a 21-bp double-stranded specific oligonucleotide (5'-CT TCACCTTATTTGCATAAGC) containing the H2b octamer site and flanking sequences, a 24-bp double-stranded K-specific oligonucleotide (5'-TTCCCAATGATTTGCATGCTC TCA), and a nonspecific double-stranded oligonucleotide containing fos promoter sequences (a gift of Ron Prywes). After incubation for 20 min at 30°C, the binding reaction mixes were loaded onto a 4% polyacrylamide gel (acrylamide-bisacrylamide, 60:1) and electrophoresed at 20 V/cm in 0.25x TBE (22 mM Tris borate [pH 8.3], 0.5 mM EDTA). Gels were dried and exposed to X-ray film. The OTF-1- and OTF-2-shifted bands and the free DNA bands were cut from the gels by superimposing the corresponding autoradiogram, and radioactivity was quantitated by scintillation counting. Binding reactions for Fig. 5 were done essentially as
6205
B
A OTF-i OT F-I OTF -2
M
205-
-
97 -
--
66
00
M HeLa Nom
Nam
&OTF-1 OTF-I HeLo
Nam
OTF-2 Nam
O TF
I-*
64
_
]OTFr-2[
-58
..4
4 5-
2
3
4
5
2
3
FIG. 1. SDS-polyacrylamide gel electrophoresis of affinity-purified OTF-1 from HeLa and Namalwa cells and OTF-2. The sizes of the marker proteins (lanes M) are indicated (in kilodaltons). The arrows indicate the positions of OTF-ls and OTF-2 in the corresponding lanes. (A) Purified OTFs used for DNase I and MPE footprinting analysis. Lanes 1 and 2. Size markers. The polypeptide of 66 kDa in all purified preparations is bovine serum albumin. (B) Purified factors used in transcription assays. Lanes 3A and 1B. OTF-1 purified from HeLa cells. Lanes 4A and 2B, OTF-1 purified from Namalwa (Nam) cells. Lanes 5A and 3B, OTF-2 purified from Namalwa cells. The polypeptide of 48 kDa in lane 3 is an exogenous protein which contaminated the gel apparatus.
described above, except that an H2b octamer-containing double-stranded oligonucleotide (37) was used as the probe and protein fractions were serially diluted. Nonidet P-40 (0.03%) and bovine serum albumin (0.1 mg/ml) were also added to the reaction mixes, and the gels contained 0.03% Nonidet P-40 as well. Each OTF-retarded complex was excised from the gel, and radioactivity was counted by scintillation. One unit of binding activity is defined as the amount of protein sufficient to bind 25 fmol of probe. We estimated that there was 1 U of OTF-1 binding activity per ,ul of HeLa nuclear extract (20 ,ug of protein) and 1.25 U of OTF-1 and 0.6 U of OTF-2 binding activity per ,ul of Namalwa nuclear extract (10 ,ug of protein). Purification of OTFs. For the binding studies, OTF-2 and OTF-1 from Namalwa cells were prepared as described before (48), while OTF-1 from HeLa cells was purified as described by Murphy et al. (37) (method 1). For the in vitro transcription assays, OTF-2 was prepared as described by Scheidereit et al. (48). OTF-1 from Namalwa cells was purified essentially as reported by Scheidereit et al. (48), except that a wheat germ agglutinin affinity column was substituted for the nonspecific DNA column. OTF-1 from HeLa cells was purified by wheat germ agglutinin chromatography, followed by a specific binding-site affinity column essentially as described by Jackson and Tjian (19) (Pierani et al., unpublished data). DNase I and MPE protection analysis. The H2b and K probes were identical to those described for the gel retardation-competition assays; they were labeled at either end in order to detect interactions on both coding and noncoding strands. Binding reaction mixes (20 ,ul) contained 20 mM HEPES (pH 8.4), 60 mM KCI, 1 mM dithiothreitol, 2 mM MgCl,, 0.1 mg of bovine serum albumin per ml, 100 ng of poly(dI-dC) heteropolymer, 1 ng (7 fmol) of labeled probe. and, where indicated, 2 ,ul (-20 ng) of affinity-purified OTF proteins. The reaction mixtures were incubated for 20 min at 30°C. For DNase I footprinting analysis, 20 ,ug of DNase I per ml was added for 30 s at 30°C; the reaction was stopped by addition of 2 ,ul of 250 mM Tris hydrochloride (Tris-HCl)-
6206
PIERANI ET AL.
250 mM EDTA-0.4% sodium dodecyl sulfate (SDS), phenolchloroform extracted, ethanol precipitated, and loaded onto an 8% sequencing gel. For methidiumpropyl-EDTA (MPE) footprinting analysis, 0.2 nmol of MPE was added to the binding reaction mixtures and incubated for 4.5 min at 30°C. The cleavage reaction was stopped by addition of 3 ,u of 250 mM EDTA-3 M ammonium acetate, phenol-chloroform extracted, ethanol precipitated, and loaded onto an 8% sequencing gel. Depletion of nuclear extracts. Namalwa (2 ml, 20 mg of protein) or HeLa (40 mg of protein) nuclear extract was incubated in a rotatory shaker twice for 45 min each at 4°C with 200 ,ul of affinity matrix coupled with a double-stranded oligonucleotide containing the H2b octamer site (5'-CTTC ACCTTATTTGCATAAGCGAT). The supernatant after the second depletion was recovered by centrifugation and used for the transcription reactions. Proteins were eluted from the affinity matrix by rotating with 0.5 ml of BC buffer (20 mM Tris-HCl [pH 7.9], 0.5 mM EDTA, 20% glycerol) plus 1 M KCl for 30 min at 4°C. The bound proteins were recovered by centrifugation and dialyzed against BC buffer plus 100 mM KCI. Then, 2 ,u1 of all samples was analyzed by the gel retardation assay to confirm the depletion. In vitro transcription. Transcription reaction mixes (25 pI) for the immunoglobulin K and the H2b promoters contained 40 mM Tris-HCI (pH 8.0), 60 mM KCI, 0.3 mM EDTA, 0.3 mM dithiothreitol, 12% glycerol, 3 mM MgC12, 0.6 mM ribonucleoside triphosphates, 0.25 pug of supercoiled template DNA (pGT131 and pGTdcA as K templates, pEH2b2.5 and pEH2b2.50- as H2b templates), and 8 RI (80 pug of protein) of Namalwa or OTF-depleted Namalwa nuclear extract or 10 [lI of HeLa or HeLa OTF-depleted nuclear extract (200 pig of protein). Depleted extracts were supplemented with 5 pul of Namalwa or HeLa-bound fraction (crude octamer-containing fractions eluted from the affinity matrix used in the depletion procedure) or with different amounts of purified OTF proteins as specified in the figure legends. Reaction mixes were incubated at 30°C for 1 h and treated essentially as described by Poellinger et al. (42). In vitro-synthesized RNAs from both K and H2b templates were analyzed by Si nuclease protection (3). The probe used for mapping the K transcripts was a 96-base oligonucleotide containing sequences from -21 to +39 of the mouse T1 gene plus 36 nucleotides (nt) of the pGEM1 polylinker. The H2b probe was a 93-base oligonucleotide containing from -23 to +70 of the H2b gene. The protected transcripts for K were 75 nt long, and those for H2b were 70 nt. In vitro transcription of the immunoglobulin heavy-chain promoter (BCL1) was analyzed as described by Poellinger et al. (42) with some modifications. Transcription reaction mixes (25 RI) contained 40 mM HEPES (pH 8.4), 60 mM KCl, 12% glycerol, 3 mM MgCI2, 0.12 mM EDTA, 0.3 mM dithiothreitol, 0.16 mM phenylmethylsulfonyl fluoride, 0.6 mM each ribonucleoside triphosphates, 10 pug of supercoiled template DNA per ml, and 10 RI of nuclear extract or 10 pI of depleted Namalwa nuclear extract plus purified OTFs. Purified RNAs were mapped by Si analysis (3) with a 90-nt oligonucleotide containing sequences from -18 to +75 of the rabbit I-globin gene in the OVEC plasmid (61). The protected transcripts were 75 nt long. For each of the transcription assays, the S1 nucleaseresistant transcripts were excised from the gels, and radioactivity was quantitated by scintillation counting. Each value was determined in three to six independent experiments, with an experimental variation of 2 to 12%.
MOL. CELL. BIOL.
RESULTS
OTF-ls and OTF-2 show identical DNA-protein contacts on H2b and IgK promoters. Previous studies with the immunoglobulin light-chain (IgK) promoter showed a much higher level of octamer-dependent transcription in Namalwa cell extracts than in HeLa cell extracts, in agreement with in vivo studies, whereas control genes (including H2b) were transcribed at comparable levels (33). To investigate the possibility that activation of B-cell-specific promoters is a consequence of differential recognition of the octamer sequence by OTF-1 and OTF-2, we compared their proteinDNA contacts. We have previously shown that a tissuespecific octamer-binding transcription factor (OTF-2) and a ubiquitous octamer-binding transcription factor (OTF-1), both isolated from human lymphoma cells, recognized identical sequences in the K promoter, as determined by methylation interference and DNase I footprinting analyses (48). In order to achieve greater resolution and to extend these analyses to the H2b promoter, we purified OTF-1 from both HeLa cells (11) and Namalwa (a human lymphoma) cells (48) and OTF-2 from Namalwa cells (48). OTF-1 was purified as described in Materials and Methods, and the purified proteins were analyzed on an SDS gel (Fig. 1A). We consistently observed a small difference in the sizes of the HeLa and the Namalwa OTF-1s, which we assume might be due to distinct covalent modifications (see also legend to Fig. 1). Specific interactions between OTF proteins and the histone H2b and K promoters were investigated by DNase I and MPE protection assays. Each OTF protein showed an identical DNase I footprinting pattern on the K promoter, extending from nt -54 to -75 on the coding strand and from -53 to -72 on the noncoding strand, as shown previously (48) (Fig. 2A and C). While DNase I digestion provides a general delineation of the DNA sequences involved in the interactions, MPE resolves more precisely the most significant protein-DNA contacts. In these analyses, the three OTFs showed identical protection against MPE cleavage, which was restricted to the octamer sequence itself (Fig. 3A and C). These data demonstrate that all three proteins bind the K promoter through indistinguishable DNA contacts and that the core of these interactions is centered over the conserved octamer sequence. DNase I footprinting analysis of OTFs on the H2b promoter revealed a more complex pattern of protection (Fig. 2B and C). Both the HeLa and the Namalwa OTF-1 and OTF-2 showed strong protection over the octamer site, extending from -35 to -55 on the coding strand and from -60 to -36 on the noncoding strand. In addition, we observed an area of weaker protection over the TATA box region, extending from -28 to -35 on the coding strand and from -22 to -36 on the noncoding strand. This protection was more marked for the OTF-1s, whereas OTF-2 protected this region only weakly (Fig. 2B and C). MPE protection assays revealed that the strongest contacts were centered over the octamer sequence itself, while weaker contacts extended over the five downstream adjacent nucleotides. Again, weak protection of the TATA box was observed, which was more pronounced for the OTF-1 proteins than for OTF-2 (Fig. 3B and C). OTF-ls and OTF-2 have equivalent affinities for the H2b and K T1 promoters. The relative binding affinities of OTF-1 and OTF-2 for the octamer site were determined by a gel retardation-competition assay. A heparin-agarose fraction of a B-cell extract which contained both OTF-1 and OTF-2 was incubated with a labeled DNA fragment derived from the K
IN VITRO FUNCTION OF OTF-1 AND OTF-2
VOL. 10, 1990
A t 4:
tk
46
B
4:ko
rt
6207
4: 4:t
t
4-w am
_s
_
--22
M.38
-a -75u
n
n
i=
-
-541 -7
_
--
2
-
no -coin
r-9 _
_
_--_ a,-___ coding _odin
-60 -
i=-
_
_-
28
4=
4m
_
c
no
-
-ci
coding
H2b promoter
K - light choin promoter
C m
I
AATAACTACCAATCAGACACAAGACT TCAACTCTTCACCTTAMGCATAAGCGATTCTATATAAAAGCGCCTTGTCATAC H2B t- -/ / /g /gS
1L
il
I
TGGGGACTTCTTCATATACCCGTCNACATG K
-90 -80 -70 -60 -50 -40 -30 -20 -10 FIG. 2. DNase 1 footprinting of the K and H2b promoters with affinity-purified OTFs. The protected sequences (nucleotides) are indicated by a bar, and the numbers correspond to the nucleotide positions in the promoters. Lanes G, Maxam-Gilbert G reaction; lanes 0, no protein added. (A) DNase I footprinting of HeLa OTF-1, Namalwa (Nam) OTF-1, and Namalwa OTF-2 on both strands of the K promoter. (B) DNase I footprinting analysis on both strands of the histone H2b promoter. Weak protections are indicated by a dashed line. (C) Summary of the DNase I protection patterns in the K and H2b promoter regions. Only the strongly protected regions are shown (shaded boxes), along with hypersensitive sites (arrows). Numbers correspond to nucleotide positions in both promoters. The CAAT box, conserved octanucleotide, and TATA boxes are boxed.
promoter region. Increasing amounts of DNA containing either no octamer site or a K- or H2b-derived octamer site were used as competitors in these reactions. To determine whether the sequences flanking the octamer-binding site in either promoter influence binding affinities, we used two sets of specific competitor DNAs: (i) restriction fragments approximately 200 bp long, containing the entire K or H2b promoter region and (ii) synthetic oligonucleotides (24 and 21 bp long) representing the K and H2b octamer sites and their flanking nucleotides, respectively. The shifted bands were excised and radioactivity was quantitated as described in Materials and Methods, and the data are presented in Fig. 4. We observed no differences in DNA affinity between OTF-1 and OTF-2, although both proteins bound more efficiently to the H2b octamer site than to the K site (Fig. 4A). This preference for the H2b sequence was lost when oligonucleotides were used as competitors (Fig. 4B). Interestingly, the H2b oligonucleotide did not contain the TATA box element, which was partially protected from DNase digestion by OTFs (Fig. 2B), and therefore may serve to
stabilize the protein-DNA interactions. We also note that despite the minor differences in DNase protection observed between OTF-1 and OTF-2 (Fig. 2B), the proteins showed no difference in DNA affinity. Therefore, we cannot explain tissue-specific expression of immunoglobulin promoters on the basis of differences in the intrinsic abilities of OTF-1 and OTF-2 to recognize and bind their cognate DNA sites. Both OTF-ls and OTF-2 stimulate transcription of the histone H2b gene in vitro. Although DNA binding is a prerequisite for the action of many activators, this parameter does not necessarily provide an indication of the functional capacity of the bound protein. To test these parameters as well as the potential significance of the observed DNAprotein interactions, the factors were assayed in a cell-free transcription system. This system consists of a nuclear extract specifically depleted of octamer proteins by affinity chromatography but retaining all of the general factors necessary for RNA polymerase II transcription initiation (31). We have previously used such extracts to demonstrate that OTF-2 stimulates transcription from the K promoter (48). Here we used both OTF-depleted HeLa and OTF-
6208
PIERANI ET AL.
..
A
r,~
A. ". J
*9:._ _MYwA.'
MOL. CELL. BIOL.
3-
0,
0D
~O
I*S
0
00.0 e$
;-51 -49
244
1 3v 1.ir i S.
R
=e
: #.:.1.
_
*-....
0.:-'.;t t_4g
I
2
:1WRs x
W .
5
lMi!t
as..R
X£ &
=.08:.,
w c.
..
_Y *
qon- coding K --
C
ligth? criain promoter
coding
non-coding
H,b
promoter
AATAACTACCrAATr'AGACACAAGACTTCAACTCTTCACCTTATTTGCATAAGCGATTCTATATAMAAAGCTTGTCATAI H28
,CrAGCAATAACTGGTITrCCCAATGATTTGCATGCTCTCACTTCACTGCCTTGGGGACTTCTTCATArACCCGTCACACATG K -90
-40 -t3 -60 -50 -30 -10 -20 FIG. 3. MPE protection of the K and H2b promoters by OTFs. (A) MPE protection pattern of HeLa OTF-1, Namalwa (Nam) OTF-1, and Namalwa OTF-2 on both strands of the K promoter. The protected nucleotides are indicated by a bar; numbers represent nucleotide positions. (B) MPE protection pattern of OTFs on both strands of the H2b promoter. Strongly protected nucleotides are indicated by the thick bar, weakly protected ones by the thin bar: numbers represent nucleotide positions. (C) Summary of MPE-protected sequences in the K and H2b promoter regions. Strong interactions are indicated by thick bars, and weak interactions are signaled by thin bars. The numbers represent nucleotide positions on both promoters. The CAAT box, octamer sequences and TATA box are boxed. -8C
depleted Namalwa extracts to transcribe the ubiquitously expressed H2b and the B-cell-specific K promoters in the presence of added HeLa OTF-1, Namalwa OTF-1, or Namalwa OTF-2. The OTF factors used for these assays were purified by a new procedure, which includes a wheat germ agglutinin affinity chromatography step (Materials and Methods), and are shown in Fig. lB. To determine the specific activity of each OTF preparation used in our experiments, both nuclear extracts and purified OTFs were tested for octamer binding activity in a gel retardation assay (Fig. 5). Subsequent experiments were performed with equal amounts of binding activity of each protein on both templates to facilitate comparisons between the various OTFs (both purified and in the unfractionated extracts). Previous experiments carried out in our laboratory have demonstrated that OTF-1 purified from HeLa cells is capable of stimulating transcription from the histone H2b promoter in vitro (11). We therefore wished to determine whether H2b transcription could also be stimulated by OTF-2. An H2b promoter construct containing sequences to position -59 and including either a wild-type (WT) or mutated (O-)
octamer site was transcribed in OTF-depleted HeLa and Namalwa extracts. Core promoter activity was monitored by using the 0- promoter construct. Octamer-dependent transcriptional stimulation was determined by addition of OTF-1 and OTF-2 purified from HeLa and Namalwa cells. As shown in Fig. 6, transcription from the H2b promoter containing a WT octamer motif was six- to eightfold more efficient than that from the 0- template in either HeLa or Namalwa nuclear extracts (Fig. 6A and B, lanes 1 to 4). In contrast, both templates were transcribed with equal but reduced efficiencies in the OTF-depleted extracts (Fig. 6A and B, lanes 5 and 6). Addition of any of the three purified OTFs restored full transcription activity of the octamercontaining H2b template but had no effect on the 0template (Fig. 6A and B, lanes 7 to 24). Furthermore, the observed stimulation per binding unit was comparable for each of the three OTF proteins in either OTF-depleted extract, and 15 U of purified OTFs was sufficient to recover the activity obtained with nuclear extracts containing 10 OTF-binding units of HeLa and 15 U of Namalwa extract. Identical results were obtained with an H2b template containing sequences to position -162, thus ruling out the
IN VITRO FUNCTION OF OTF-1 AND OTF-2
VOL. 10, 1990
H eLa N E
100
HeLa ITr--
NJuri r. E
NornOTF-I
6209
NamOTF-2
PUC 12
50
OTF-2-
4.
0 MOLAR EXCESS COMPETITOR (-'v2OO BP FRAGMENT)
0
z
2 34 5 6 7 8 9 1011121314151617181920 FIG. 5. Titration of OTF binding activity in nuclear extracts and purified preparations. Gel retardation assays were performed with an H2b octamer-containing oligonucleotide as the probe and incubation with serial dilutions of the proteins. Lanes 1 to 4, HeLa nuclear extract (NE). Lanes 5 to 8, HeLa purified OTF-1. Lanes 9 to 12, Namalwa (Nam) nuclear extract (NE). Lanes 13 to 16, Namalwa purified OTF-1. Lanes 17 to 20, Namalwa purified OTF-2. Amounts of nuclear extract: lanes 1 and 9, 0.1 ,ul; lanes 2 and 10, 0.05 ,ul; lanes 3 and 11, 0.025 ,ul; lanes 4 and 12, 0.0125 p.l. Amounts of purified OTF: lanes 5, 13, and 17, 0.02 ,ul; lanes 6, 14, and 18, 0.01 ,u1; lanes 7, 15, and 19, 0.005 ,ul; lanes 8, 16, and 20, 0.0025 ,u1. The arrows indicate the positions of the OTF-1 and OTF-2 complexes.
0
._=-15
100
FOS
OTF-2 -0.- OTF- I
K
50
H28
0
4 10 20 50 100 MOLAR EXCESS COMPETITOR (30 BP OLIGONUCLEOTI DE) FIG. 4. Relative affinities of OTF-1 and OTF-2 for the lightchain gene promoter region. Octamer-containing heparin-agarose fractions from Namalwa nuclear extracts were incubated with a 212-bp K probe in the presence of competitor restriction fragments (A) or competitor oligonucleotides (B). Complexes were separated by a gel electrophoresis retardation assay. The amount of radioactive K probe bound to either OTF-1 or OTF-2 in the absence of competitor DNA was taken as 100%o. Symbols: 0, binding to OTF-1; 0, binding to OTF-2. (A) Competitor DNA fragments were a nonspecific pUC12 AvaIl-AvaIl restriction fragment, an H2b promoter fragment, and the same K fragment used as the probe, as indicated. (B) Competitor oligonucleotides were a nonspecific fos sequence, an H2b octamer-containing oligonucleotide, and a K octamer-containing oligonucleotide, as indicated. K
possibility that the specificity of the -59 template for OTF-1 versus OTF-2 was lost as a result of deletion of the upstream sequences (data not shown). Full transcriptional activity of B-cell-specific promoters requires OTFs and an additional lymphoid-specific factor. To determine whether OTF-1 and OTF-2 could function interchangeably on a B-cell-specific promoter, we compared OTF-1 and OTF-2 function on the light chain promoter. Transcription of K promoter constructs containing either a WT or double point mutant (O-) octamer motif in Namalwa nuclear extract demonstrated a clear (four- to fivefold) octamer-dependent stimulation of transcription (Fig. 7, lanes 3 and 4; Fig. 8, lanes 1 and 2). In contrast, transcription of the same templates in HeLa cell nuclear extract showed a low but noticeable (1.0- to 1.5-fold) octamer dependence (Fig. 7, lanes 1 and 2; Fig. 8, lanes 3 and 4). The four- to fivefold-higher transcriptional activity of the WT template relative to the 0- template in the B-cell extract was eliminated following depletion of OTF proteins (Fig. 7, lanes 5 K
and 6). However, transcription of the WT template was restored when purified OTFs from either HeLa or Namalwa cells were added to an OTF-depleted Namalwa nuclear extract (Fig. 7, lanes 7 to 24). As was shown above for the H2b promoter, each of the three OTFs appeared to have the same intrinsic capacity to stimulate transcription from the K light-chain promoter. Whereas some preparations of Namalwa OTF-1 were slightly contaminated with OTF-2 (
