JOURNAL OF VIROLOGY, JUlY 1992, p. 4117-4125 0022-538X/92/074117-09$02.00/0 Copyright © 1992, American Society for Microbiology

Vol. 66, No. 7

Recombinant Human Adenoviruses Containing Hybrid Adenovirus Type 5 (Ad5)/Adl2 ElA Genes: Characterization of Hybrid ElA Proteins and Analysis of Transforming Activity and Host Range TOMAS JELINEK' AND FRANK L. GRAHAM' 2*

Departments of Biology' and Pathology, 2 McMaster University, 1280 Main Street West, Hamilton, Ontario L8S 4KI, Canada Received 7 February 1992/Accepted 30 March 1992

Hybrid adenovirus type 12 (Adl2)/Ad5 ElA genes were constructed by homologous recombination in Escherichia coil, a technique which offers several advantages over conventional mutagenesis for genetic analysis of proteins. In particular, functional differences between the proteins can be mapped by correlating the replacement of specific sequences with the acquisition of new properties, and there is no requirement for common unique restriction sites or polymerase chain reaction strategies to construct the hybrids. Recombinant adenoviruses expressing these hybrid ElA proteins were capable of replicating efficiently in HeLa cells, with the exception of one construct which contained a hybrid transactivation domain. The transforming activity of the hybrid ElA constructs was assayed by DNA transfection of primary baby rat kidney cells. Plasmids containing Adl2 El were approximately 20-fold less efficient at transformation than those with El of Ad5, and it was found that two regions in exon 1 of ElA mediate this difference. No differences were found in the abilities of any hybrid EIA proteins to bind to cellular proteins previously determined to be important for transformation by ElA. Some human adenovirus (Ad) serotypes are able to induce tumors after being injected into newborn animals, and most if not all serotypes can transform nonpermissive rodent cells

60K protein has been identified as cyclin A (41), which complexes with p107 (14, 16), and p107 has been identified as a protein related to pRb-1 (15). The fact that ElA complexes with pRb-1, the product of a recessive oncogene, suggested that transformation by ElA could occur by the formation of complexes consisting of ElA and one or several repressors of cell proliferation, the primary consequence of which is inactivation or sequestration of the repressor (22). The efficiency with which plasmids containing the El region transform baby rat kidney (BRK) cells is a characteristic property of the serotype from which the El sequences are derived. In particular, Ad5 El plasmids are able to transform BRK cells much more efficiently than Adl2 El plasmids, and this effect is mediated by the first exon of the ElA protein (32). Since exon 1 of ElA contains all the regions implicated in its transforming function and those regions include sequences which bind cellular proteins, the possibility arises that the differences in transforming efficiency between Ad5 and Adl2 ElA are due to differential binding avidities for the transformation-associated cellular proteins. However, interactions between the Adl2 ElA protein and cellular proteins have not been studied to the same extent as those of Ad5 ElA. In this report we describe the construction and analysis of a series of hybrid Ad5/Adl2 ElA genes and their rescue into infectious virus. The technique used to generate hybrid ElA genes involves homologous recombination in Escherichia coli between tandem repeats on a single plasmid and requires only small segments of patch homology between the two genes to generate crossovers at multiple sites. Analysis of chimeric proteins offers certain advantages over conventional mutagenesis for the genetic analysis of differences between related proteins. It is possible to assay chimeras for a phenotype specific to one of the parent proteins and identify hybrids sharing that phenotype. Correlation of the relative sequence composition of hybrid proteins with their

in culture. The region of the Ad genome which is both necessary and sufficient for transformation of primary cells in vitro is early region 1 (El), consisting of transcription units ElA and EBB (5, 8, 17). The ElA transcription unit produces two major spliced mRNA products with sedimentation coefficients of 12S and 13S (6, 7, 40). The 13S mRNA encodes a protein of 289 residues, containing 46 internal amino acids not present in the 243-residue protein encoded by the 12S mRNA. This unique region is responsible for the transcriptional activation of other viral genes and some cellular genes (3, 5, 18, 30, 37-39, 46). Stable expression of ElA proteins can immortalize cultured primary rodent cells (28, 47) and, in cooperation with ElB or other oncogenes such as ras, can induce oncogenic transformation (43). The regions of the ElA protein which appear to be essential for these functions are highly conserved between different Ad serotypes and are referred to as conserved regions 1, 2, and 3 (CR 1, CR 2, and CR 3) (33, 37, 51). CR 1 and CR 2 are both required for the transforming activity of the Ad type 5 (AdS) ElA protein (12, 31, 34, 38, 48, 55) and presumably for that of other serotypes as well. Recently, several cellular proteins whose physical interactions with AdS ElA are important for transforming activity have been shown to require regions CR 1 and CR 2 for those interactions. Specifically, a 300,000-molecular-weight protein (300K protein) interacts with the amino terminus and CR 1, while 60K, 105K, and 130K proteins interact with CR 1 and CR 2, and a 107K protein interacts with a segment of ElA contained completely within CR 2 (13, 19, 25, 56, 58). The identity of the 105K protein has been established as the product of the retinoblastoma susceptibility gene (pRb-1) (54), while the *

Corresponding author. 4117

4118

JELINEK AND GRAHAM

biological properties can map phenotypes of interest to the portions of the chimeric proteins derived from the parent which originally exhibited that phenotype. All hybrid ElA

genes were able to transform BRK cells and to support Ad5 viral replication in HeLa cells, with the exception of one construct in which a crossover occurred within the transactivation domain, CR 3. Transforming efficiency was influenced by the identity of sequences in two regions, the amino terminus plus CR 1, and the region consisting of CR 2 and adjacent amino-terminal sequences. We found no evidence to indicate that the differences in specific transforming efficiencies can be attributed to differential binding avidities to cellular proteins.

MATERIALS AND METHODS Cells. Primary BRK cells were prepared from 6-day-old hooded lister rats by mechanical disruption of kidneys and trypsinization. The resulting suspension was filtered through sterile cheesecloth, and the cells were pelleted and resuspended in cx-minimum essential medium (GIBCO) supplemented with antibiotics, 10% fetal bovine serum, and 5 mM BES (Sigma; pH 7.1) at a concentration of 108 cells per ml. BRK cells (250 pl) were electroporated in 0.4-cm-electrodegap cuvettes (Bio-Rad), at 220 V and 960 pLF (10, 53). Selection for transformed cells expressing ElA and EBB was effected by incubation in Joklik's medium (GIBCO) supplemented with antibiotics and 5% horse serum. After 2 to 3 weeks, cultures were fixed in 75% methanol-25% acetic acid and stained with Giemsa stain. Viruses. Recombinant viruses were constructed by cotransfection of 293 cells (20) with hybrid El plasmids and pJM17 (36). Plaque isolates were expanded in 60-mm dishes of 293 cells, and viral DNA was analyzed by restriction digestion and agarose gel electrophoresis. Recombinant viruses were plaque purified twice and grown to high titer on 90% confluent 150-mm plates of 293 cells. Titers of infectious virus were determined by plaque assays on 293 cells and, in some experiments, compared with titers on HeLa cells. Generation of hybrid El plasmids by homologous recombination in E. coli. A plasmid containing tandem repeats of Adl2 and AdS El sequences (pTJ 4 [Fig. 1]) was constructed in E. coli HMS 174 (recAl) and subsequently transferred to RecAl strain LE 392. DNA was extracted; linearized with BamHI, EcoRI, and XhoI at the junction between Adl2 and AdS sequences; and used to transform E. coli. Molecules susceptible to linearization included those which had not undergone recombination events such as those shown in Fig. 2B, resulting in deletion of the sequences containing the unique restriction sites. Transformation of bacteria with this digest enriched for recombined plasmids which remained circular (Fig. 2C). The products of this selection included plasmids of variable size, which were discarded, and plasmids of unit EB size, which were subjected to further characterization. Plasmids with putative hybrid ElA genes were screened by DNA dot-blot hybridization analysis with oligomer probes specific for AdS ElA sequences, DNA sequence analysis across the crossover site, and digestion with multicut enzymes followed by polyacrylamide gel electrophoresis to verify that all restriction fragments were of expected size. Analysis of hybrid ElA proteins. HeLa cells were infected at multiplicities of approximately 30 PFU per cell, labelled from 10 to 11 h postinfection with 0.25 mCi of 35S (Trans 35S-label; ICN Radiochemicals), and lysed in a buffer consisting of 50 mM N,N'-hydroxyethylpiperazine ethanesulfo-

J. VIROL.

nic acid (HEPES; pH 7.1), 250 mM NaCl, and 0.1% Nonidet P-40, as previously described (25). For coimmunoprecipitation of cellular proteins with BlA, cells were infected as described above, at multiplicities of 100 PFU per cell. ElA proteins were immunoprecipitated with a mouse monoclonal antibody (M73) specific for the carboxy-terminal region of the Ad2/Adl2 ElA protein (Oncogene Science, Inc.) (24), and simian virus 40 T-antigen-specific PAB 419 (23) was used as a negative control. For protein quantitation, dried gels were exposed to Cronex 4L film (Dupont; wide linear range) and scanned by microdensitometry. RESULTS Isolation of hybrids. To construct hybrid El plasmids by homologous recombination in E. coli, a plasmid containing the Adl2 and Ad5 El regions in tandem was constructed (Fig. 1 and accompanying legend). This plasmid, pTJ4, contains the leftmost 193 bp of AdS, encompassing the viral inverted terminal repetition (ITR) (50) joined to Adl2 sequences from nucleotide 147 through the Adl2 ElA coding region and terminating approximately halfway through the coding sequences of the Adl2 EBB 55K protein, at nucleotide 2551. A polylinker with XhoI, EcoRI, and BamHI sites separates Adl2 sequences from the Ad5 El region, present from nucleotide 548 to 5788. DNA was grown in E. coli LE 392, extracted, and digested with BamHI, EcoRI, and XhoI to linearize unrecombined plasmids. Bacteria were transformed with these digests to enrich for species which had remained circular (Fig. 2). Approximately 600 clones were analyzed by restriction analysis, and those of unit El size (approximately 100) were further analyzed. Additional restriction digests were carried out to identify clones with putative hybrid ElA genes. The majority of crossovers were in E1B, probably because the degree of homology between Ad5 and Adl2 EBB is higher than is seen in ElA. The precise locations of crossovers in 20 putative hybrid ElA plasmids were determined by DNA dot blot analysis involving hybridization with oligonucleotides specific for the Ad5 ElA coding region (Fig. 2C) and finally by sequence analysis. The leftmost sequences of the hybrid constructs encompassed the Ad5 ITR followed by the region corresponding to the Adl2 packaging signal; several attempts to rescue these hybrid El regions into infectious Ad5 virus were unsuccessful. We attribute this to the inability of the Adl2 packaging signal to function in the packaging of viral DNA into Ad5 capsids. To circumvent this problem, hybrid plasmids were cleaved at Adl2 nucleotide 290 with SspI, and the terminal fragments were replaced with the leftmost 353-bp SacII fragment of Ad5, which contains the ITR, the packaging signal, and the ElA enhancer (26). The final constructs, whose structures are shown in Fig. 3, were readily rescued into infectious virus. Sequence analysis (Fig. 3B) showed that as few as seven nucleotides of homology were sufficient to allow recombination, as seen with p1036 and p1461. This is consistent with results observed in previous work, when similar techniques were used to construct hybrid proteins (21, 52). No hybrid plasmid was isolated more than twice, suggesting that recombinational hot spots do not dictate the types of hybrids which can be isolated. Ad5 and Adl2 share additional regions of homology in ElA which are not represented in the series of hybrids isolated. Given the limited number of hybrids isolated with crossovers in BlA, it is not possible to predict whether a larger sample size would yield all possible hybrids. Plasmids p690, p753, p827, p975, p1036, and p1227 all encode chimeric

VOL. 66, 1992

HYBRID Ad5/Adl2 ElA GENES

4119

I II

'm AsuJ

--MI

B

Hind III

EiB

E1B H

Smn rarnn

Large

Fmgren

PHAB 6

II A. J | | Asu Asu II |

Ru 1,

Ci& 1

PXC 38

t

E1

Linker

XholI Eoo Rl Xhol1

II diReeH AH i ina 1tBon

pXH 1

Asu I1 Inactivate 1

Asu l

Asu

Ri BCh RI

12

ind

Eon

RI

pXHL ECORi Bern Hi

Adl2~~~~~~EORIB

Hinc IIBenH

I cia ElA

ElB Om 04 dlE

E1A Adi1EBA H~~~~~~'U~Bern HI, Lawg Bern HI Lare ?rlBen

hia I

Ad 5

Fepmcet

pTJ3S)

(hi.~ AdiEAd 1dEi

FIG. 1. Construction of a plasmid containing a part of the Adl2 El region as a direct tandem repeat with the Ad5 El region. pHAB6, containing the Adl2 El region (EcoRI C fragment) from the Huie strain of Adl2 in the BamHI site of pBR 322 (35), was digested with BssHII, the ends were made blunt with E. coli DNA polymerase large fragment (Klenow), and the plasmid was further digested with ClaI, excising the terminal 147 bp of the viral genome plus 328 bp of vector sequences. In place of these sequences, the terminal 193 bp of the Ad5 genome, from the RsaI site of pXC38 (3) to the pBR322 ClaI site, were inserted. The resulting plasmid, pXH1, was digested with AsuII at Adl2 nucleotide positions 2551 and 3648, removing a large part of the ElB coding sequences, and a linker was inserted at this location, which eliminated the Asull site and introduced an EcoRI site flanked by two XhoI sites. All Ad sequences in this plasmid were excised by digestion with BamHI and ClaI, and the resulting fragment was inserted into pXCO548dE (pXC38 with a BamHI linker insertion at Ad5 position 548 [3], which had been digested with EcoRI, made blunt, and religated to remove the pBR322-derived EcoRI site) also digested with BamHI and ClaI. This plasmid, pTJ3, was reduced in size by digestion with EcoRI and religation, resulting in the elimination of non-El Adl2 sequences

(pTJ4).

4120

J. VIROL.

JELINEK AND GRAHAM Eco RI BiLm HI

28, 12 12 ElA

pTj

Ad 5 El

4

Ad 5 EIIB

W.

B

FIG. 2. Generation of hybrid Adl2/Ad5 ElA regions. (A) pTJ4 (Fig. 1) was grown in E. coli LE 392, which is RecA'. (B) In these bacteria, plasmids are able to undergo intramolecular recombination between sequences of partial homology aligned as direct repeats, resulting in the formation of two topologically distinct closed circles and the loss of sequences distal to the antibiotic resistance marker and origin of replication. (C) The resulting plasmid contains a crossover in a region of homology between the two parental sequences and lacks the restriction sites and other sequences originally present between the crossover sites. In a crossover which creates a hybrid El region, the deletion spans the unique XhoI, EcoRI, and BamHI sites. Digestion of plasmid DNA extracted from these bacteria with XhoI, EcoRI, and BamHI results in the linearization of unrecombined parental species (A), but not of species which lack the restriction sites. Transformation of E. coli DH5 with this digest enriched for plasmids which remained circular, predominantly ones which had undergone recombination. Clones were established in this way, and following an initial screening step by restriction analysis, the clones were further analyzed by DNA dot-blot hybridization with oligonucleotides specific for Ad5 sequences spaced throughout the ElA coding sequences. The oligonucleotide closest to the crossover site which still gave a positive signal (*) was subsequently used to prime dideoxynucleotide DNA sequence analysis.

EIA proteins with various amounts of Adl2 ElA from the amino terminus to the crossover site, the precise location of which is indicated in Fig. 3B, with protein sequences shown in Fig. 3C. The crossovers in p690 and p753 are in CR 1, while p827 has a crossover in a region of patch homology located in the generally nonconserved stretch between CR 1 and CR 2. Hybrid plasmid p975 contains Adl2 ElA sequences (through CR 2) up to the region between CR 2 and CR 3. Since the 12S splice donor sites of Ad5 and Adl2 ElA do not align exactly (6, 7, 40, 49) and are located on either side of the crossover in p975, this construct contains neither

the AdS nor the Adl2 splice donor sequence and is therefore not expected to make the 12S mRNA. p1036 has a crossover in CR 3 of ElA, creating a hybrid transactivation domain. All of the first exon, as well as the intron of Adl2 ElA, is contained in p1227, which has a crossover at the splice acceptor site common to Ad5 and Adl2 ElA. p1227 thus encodes exon 1 of Adl2 ElA and exon 2 of AdS ElA. p1461 encodes Adl2 ElA and a redundancy of the noncoding region between ElA and ElB, followed by Ad5 EBB, this hybrid having arisen from a crossover between two stretches of fortuitous homology. In two instances, duplicates of a hybrid plasmid were isolated, although it is not clear whether they represent separate recombination events or clonal redundancy. Characterization of recombinant viruses. Plaque assays of recombinant viral stocks were carried out on 293 cells in parallel with HeLa cells to determine whether the El proteins expressed by recombinant viruses could facilitate viral replication in a noncomplementing cell line. Previous work has indicated that Adl2 ElA is capable of functionally substituting for Ad5 ElA for replication of the Ad5 genome (42, 44, 57), and this assay would confirm that the recombinant viruses make stable and functional proteins. The results shown in Fig. 4 indicate that all viruses except T1036 with a hybrid transactivation domain (CR 3) were competent for replication in HeLa cells. To determine the levels at which the recombinant viruses expressed hybrid ElA proteins, HeLa cells were infected with each virus with the exception of T1461 (containing the entire Adl2 ElA coding sequence) at a multiplicity of 30 PFU per cell, labelled with [35S]methionine, and immunoprecipitated with the M73 monoclonal antibody (24) specific for the carboxy-terminal region of the Adl2/Ad5 ElA protein. Since all the hybrid ElA proteins contained at least the second exon of AdS ElA, they were all expected to be immunoprecipitable with M73. The results (Fig. 5) show that all the hybrid constructs produced protein products, although the amounts produced by T1036 were reduced. In light of the host-range phenotype of this virus, it is probable that the decreased amounts of protein were a consequence of the failure to transactivate early viral gene expression,

including ElA.

Transformation assays. The transforming efficiency of hybrid El plasmids was quantitated on primary BRK cells by electroporation. Dose-response curves were plotted, and the linear portion of the curve was used to determine the efficiency of colony formation (Fig. 6). pXCl (Ad5 El plasmid) gave rise to transformed colonies at an efficiency of approximately 280 colonies per ,ug of transfected plasmid, with the first transformed colonies appearing at 6 days posttransfection. Hybrids with crossovers to the left of CR 2 (p690, p753, and p827) transformed BRK cells at efficiencies ranging between 50 and 100 colonies per ,ug, with colonies typically appearing between 10 and 14 days posttransfection. In contrast, hybrids p975, p1227, and p1461, as well as Adl2 El, transformed BRK cells at efficiencies not exceeding 15 colonies per ,ug, with colonies appearing after a time similar to that seen with amino-terminal crossovers (Fig. 6). These results suggest that the differential transforming efficiency of AdS and Adl2 ElA is influenced by two regions of ElA, the first located in the amino terminus, and the second within a region spanning the sequences between CR 1 and CR 2, including CR 2 itself. The time of appearance of transformed colonies appeared to be dictated primarily by the aminoterminal region of the ElA protein. No transformed colonies were observed with p1036, but since the virus T1036 be-

VOL. 66, 1992

HYBRID Ad5 Ad12 ElA GENES

,12-S / 13-S

A

Start//

r-)

CRI

4121

B p692

Stop

\

GTCTCTTTACGAACTGTATGATCTTGATGTG TACCCTTCACGAACTGTATGATTTAGACGT G

CR2

Ad 12 Ad 5

6921 692 p753

6261690 NA~~~-1p75

353/290

GGCGGTGAATGAGTTTTTTCCCGAATCGCTT

GGCC2GTTTCGCAGATTTTTCCCGACTCT3TA

Ad 12 Ad 5

753

4, 1 1 I

200 kla-

04-

100 kl)a97 kD)a-

0