Vaccine 33 (2015) 4526–4532

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Adjuvant potential of resiquimod with inactivated Newcastle disease vaccine and its mechanism of action in chicken Swati Sachan a,1 , Saravanan Ramakrishnan a,∗,1 , Arunsaravanakumar Annamalai a , Bal Krishan Sharma a , Hina Malik b , B.C. Saravanan c , Lata Jain d , Meeta Saxena e , Ajay Kumar e , Narayanan Krishnaswamy f a

Immunology Section, Indian Veterinary Research Institute (IVRI), Izatnagar, Bareilly, Uttar Pradesh 243122, India Division of Veterinary Public Health, IVRI, Izatnagar, Bareilly, Uttar Pradesh 243122, India c Division of Parasitology, IVRI, Izatnagar, Bareilly, Uttar Pradesh 243122, India d Division of Biological Standardisation, IVRI, Izatnagar, Bareilly, Uttar Pradesh 243122, India e Division of Animal Biochemistry, IVRI, Izatnagar, Bareilly, Uttar Pradesh 243122, India f Division of Animal Reproduction, IVRI, Izatnagar, Bareilly, Uttar Pradesh 243122, India b

a r t i c l e

i n f o

Article history: Received 27 March 2015 Received in revised form 20 June 2015 Accepted 7 July 2015 Available online 17 July 2015 Keywords: Chicken TLR agonist Resiquimod Adjuvant Newcastle disease Immune response genes Cytokines

a b s t r a c t Resiquimod (R-848), an imidazoquinoline compound, is a potent synthetic Toll-like receptor (TLR) 7 agonist. Although the solitary adjuvant potential of R-848 is well established in mammals, such reports are not available in avian species hitherto. Hence, the adjuvant potential of R-848 was tested in SPF chicken in this study. Two week old chicks were divided into four groups (10 birds/group) viz., control (A), inactivated Newcastle disease virus (NDV) vaccine prepared from velogenic strain (B), commercial oil adjuvanted inactivated NDV vaccine prepared from lentogenic strain (C) and inactivated NDV vaccine prepared from velogenic strain with R-848 (D). Booster was given two weeks post primary vaccination. Humoral immune response was assessed by haemagglutination inhibition (HI) test and ELISA while the cellular immune response was quantified by lymphocyte transformation test (LTT) and flow cytometry post-vaccination. Entire experiment was repeated twice to check the reproducibility. Highest HI titre was observed in group D at post booster weeks 1 and 2 that corresponds to mean log2 HI titre of 6.4 ± 0.16 and 6.8 ± 0.13, respectively. The response was significantly higher than that of group B or C (P < 0.01). LTT stimulation index (P ≤ 0.01) as well as CD4+ and CD8+ cells in flow cytometry (P < 0.05) were significantly high and maximum in group D. Group D conferred complete protection against virulent NDV challenge, while it was only 80% in group B and C. To understand the effects of R-848, the kinetics of immune response genes in spleen were analyzed using quantitative real-time PCR after R-848 administration (50 ␮g/bird, i.m. route). Resiquimod significantly up-regulated the expression of IFN-␣, IFN-␤, IFN-␥, IL-1␤, IL-4, iNOS and MHC-II genes (P < 0.01). In conclusion, the study demonstrated the adjuvant potential of R-848 when co-administered with inactivated NDV vaccine in SPF chicken which is likely due to the up-regulation of immune response genes. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Most, if not all, the current vaccines generate poor cell mediated immune response; hence, adjuvants are needed to augment the same. Mechanism of action of many adjuvants is complex and

∗ Corresponding author at: Avian Immunology Laboratory, Immunology Section, Indian Veterinary Research Institute (IVRI), Izatnagar, Bareilly, Uttar Pradesh 243122, India. Tel.: +91 9412463498; fax: +91 5812303284. E-mail address: [email protected] (S. Ramakrishnan). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.vaccine.2015.07.016 0264-410X/© 2015 Elsevier Ltd. All rights reserved.

needs exploration for better utilization along with many vaccines. Both qualitative and quantitative alteration of immune response can be achieved by incorporating adjuvants in the vaccines. Tolllike receptor (TLR) agonists are potent immunostimulatory agents. Many natural and synthetic TLR agonists are potential targets for vaccine adjuvants. TLRs are evolutionarily conserved pattern recognition receptors (PRRs) present across various species from insects to mammals. In chicken, TLR1A and B, TLR2A and B, TLR3, TLR4, TLR5, TLR7, TLR15 and TLR21 have been identified. TLR15 is unique to chickens and TLR21 is a functional homologue of mammalian TLR9 which recognizes CpG ODN in chickens [1]. Recently CVCVA5 adjuvant composed of five components such as levamisole,

S. Sachan et al. / Vaccine 33 (2015) 4526–4532

polyriboinosinic polyribocytidylic (poly I:C), resiquimod, imiquimod and muramyl dipeptide (MDP) along with inactived avian influenza vaccine (H9-CVCVA5) was found to increase both humoral and cellular immune responses and reduce viral shedding after H9 subtype heterologous virus challenge in SPF chickens as well as field trial [2]. Newcastle disease is one of the most important avian infectious diseases caused by virulent strain of Newcastle disease virus (NDV) also called as avian paramyxovirus type1 (APMV-1) [3]. A major limitation of live NDV vaccine is the emergence of virulent NDV from virus of low virulence used in vaccine [4] that can be overcome by using inactivated as well as subunit vaccines. Thus, it is imperative to explore adjuvants to overcome the poor immunogenicity of such ND vaccine antigens. TLR agonists such as CpG ODN [5] and LPS [6] showed adjuvant potential with ND vaccine in chicken. TLR7 recognizes single stranded (ss) RNA containing poly-U or GU-rich sequences and activate the innate immune response. Resiquimod (R-848) that belongs to the family of imidazoquinolines is a potent TLR7 synthetic agonist. Although many studies on the immunostimulatory effects of R-848 are available in mice and human, studies on the use of R-848 as solitary immunoadjuvant with vaccine antigen in avian species is not available hitherto. Hence, the present study was conducted to evaluate the adjuvant potential of R-848 with inactivated NDV vaccine in SPF chicken. The effect of R-848 on antigen specific humoral and cellular immune responses and protective capacity against challenge with virulent NDV were analyzed. Further, to understand its mechanism of action, immune response genes induced by R-848 in chicken spleen were quantified using quantitative real time PCR. To the best of our knowledge, this is the first report that documents the adjuvant potential of TLR7 agonist in chicken model per se.

2. Materials and methods 2.1. Experimental birds and TLR ligand Day old White Leghorn (WL) chicks (n = 42) and SPF WL chicks (n = 40) were maintained following standard management practices. Birds were provided with feed and water ad libitum. All the experiments were approved by the Institute Animal Ethics Committee (IAEC). Commercially available R-848 (TLR7 agonist) was procured from InvivoGen (CA, USA).

2.2. Evaluation of R-848 induced immune response kinetics in White Leghorn chicken 2.2.1. Experimental design A total of 42 WL birds of two-week age were used in the experiment. R-848 was administered to the birds (n = 36) at the rate of 50 ␮g intramuscularly and the rest (n = 6) served as PBS injected mock control. Spleen was collected in RNAlater solution (Qiagen, CA, USA) from R-848 birds at 2, 4, 8, 12, 24 and 48 h post injection (h.p.i) (n = 6, at each interval) of TLR7 agonist or PBS injection (0 h) and stored at −80 ◦ C until use.

2.2.2. Isolation of total RNA from spleen tissue and preparation of cDNA Spleen tissues were processed for total RNA isolation using RibozolTM (Amresco, USA) as per the manufacturer’s protocol and the complementary DNA (cDNA) was synthesized from total RNA using RevertaidTM First Strand cDNA Synthesis Kit (Thermo Scientific, USA), following manufacturer’s instructions.

4527

Table 1 Primers used in the quantitative real time PCR. Target gene

Primer sequence (5 –3 )

Product size (bp)

Reference

INF-␣

F: GACATGGCTCCCACACTACC R: AGGCGCTGTAATCGTTGTCT F: TGAGCCAGATTGTTTCGATG R: CTTGGCCAGGTCCATGATA F: GCTCACCTCAGCATCAACAA R: GGGTGTTGAGACGTTTGGAT F: GGATTCTGAGCACACCACAGT R: TCTGGTTGATGTCGAAGATGTC F: AGGCCAAACATCCTGGAGGTC R: TCATAGAGACGCTGCTGCCAG F: TATGTGCAAGGCCGGTTTC R: TGTCTTTCTGGCCCATACCAA F: GGAGAGCATCCGGATAGTGA R: TGACGCATGTTGAGGAAGAG F: AGAGACTGGCTTCCAGGACA R: CAGCTGAACATACCGGGACT F: CCACGGACGTGATGCAGAAC R: ACCGCGCAGGAACACGAAGA

348

[7]

152

[7]

187

[7]

272

[7]

371

[8]

110

[9]

186

[7]

219

[7]

288

[10]

IFN-␥ IFN-␤ IL-1␤ iNOS ␤-Actin IL-4 TLR7 MHC-II

2.2.3. Real-time PCR quantification Expression levels of mRNA of IFN-␣, IFN-␤, IFN-␥, IL-4, IL-1␤, MHC-II and iNOS were analyzed by real-time PCR using the QuantiTect SYBR Green qPCR kit (Qiagen, CA, USA) on CFX96 real time system (Bio-Rad, CA, USA) using published gene specific primers (Table 1). ␤-Actin was used as the reference gene. Real-time PCR was performed in triplicate according to a previously published protocol [11]. Expression levels of the target genes were calculated relative to the expression of the ␤-Actin gene and expressed as n-fold increase or decrease relative to the control [12].

2.3. Evaluation of adjuvant potential of R-848 in SPF chicken 2.3.1. Preparation of inactivated Newcastle disease virus vaccine Velogenic strain of Newcastle disease virus (NDV) procured from Division of Biological Standardization, IVRI, Izatnagar was used for vaccine preparation. It was propagated in bulk by inoculating into 9–11 d old embryonated SPF chicken eggs through intra-allantoic route and titrated following Reed and Muench method [13]. Virulent NDV was inactivated with 0.5% formaldehyde by incubating at 4 ◦ C for 24 h and was checked for residual infectivity in embryonated eggs. One dose of in-house prepared inactivated vaccine contained ≥107 ELD50 of NDV in 1 ml. 2.3.2. Experimental design A total of 40 SPF chickens of two-week old were allotted to one of the following four experimental groups (n = 10/group): Group A: PBS control; Group B: inactivated NDV vaccine; Group C: commercial oil adjuvanted inactivated NDV vaccine prepared from lentogenic strain and Group D: combination of inactivated NDV vaccine and R-848 (50 ␮g/bird). Vaccine or PBS was administered by intramuscular route in the thigh muscle. The dose of R-848 was chosen based on our previous studies [14]. A booster dose was given 14-day post immunization (d.p.i). Two weeks post-booster, experimental SPF birds were challenged with velogenic strain of NDV (105 ELD50 per bird) intramuscularly. Clinical signs and mortality were observed daily till 14 day post-challenge (d.p.c). Cloacal swabs (n = 6/group) were collected from the birds on day 0, 4, 7 and 14 post-challenge and inoculated into 10-day old embryonated chicken eggs (n = 3 eggs/sample) through intra-allantoic route. Three day post-inoculation, the allantoic fluid was checked for the NDV growth by spot haemagglutination using 10% chicken RBC.

4528

S. Sachan et al. / Vaccine 33 (2015) 4526–4532

2.3.3. Evaluation of humoral immune response Blood was collected (n = 6/group) at weekly intervals after vaccination and challenge. Serum was separated and stored at −20 ◦ C until use. Serum samples were analyzed by haemagglutination inhibition (HI) test using 1% chicken red blood cells (RBCs) according to the OIE recommended protocol [15]. The HI titre was determined as the highest dilution of serum sample that inhibited NDV agglutination of chicken RBCs. Viral specific total antibodies to NDV were also measured in the above collected serum samples on 28 d.p.i and 14 d.p.c using the commercially available Newcastle disease virus antibody test kit (IDEXX Laboratories, USA). 2.3.4. Evaluation of cellular immune response 2.3.4.1. Lymphocyte transformation test. Blood samples (n = 6/group) were collected from jugular vein with anticoagulant on 14, 21 and 28 d.p.i. Chicken PBMCs were isolated as previously described [16] and analyzed for antigen specific cellular proliferation at each time point. The cells were suspended in RPMI 1640 complete medium containing 10% foetal calf serum and 100 IU/ml penicillin, and 100 ␮g/ml streptomycin. Cell viability was determined by trypan blue dye exclusion method and concentration was adjusted to 1 × 107 cells/ml. The cells (100 ␮l) were plated in 96-well sterile tissue culture plates. RPMI 1640 medium (100 ␮l) with or without ConA (10 ␮g/ml), NDV (10 ␮g/well) was added to the wells in triplicate. The plates were incubated at 37 ◦ C with 5% CO2 for 72 h in humidified chamber. At the end of incubation, 20 ␮l of MTT [3-(4,5-dimethylthiazol-2-yl-2,5diphenyl-tetrazolium bromide; Sigma] was added from the stock (5 mg/ml). The plates were re-incubated at the same condition for 4 h. Then, 100 ␮l of culture supernatant was discarded from each well. The formazan crystals formed were dissolved by the addition of dimethyl sulfoxide (Amresco, USA), 100 ␮l to each well and reading was taken at A570 optical density (OD) on a microplate ELISA reader (Biorad, USA). Blastogenic response was calculated by dividing the mean OD of the stimulated cultures by the mean OD of unstimulated control [17,18] and expressed as the mean stimulation index (SI). 2.3.4.2. Flow cytometry. The PBMCs as collected above from all the groups (n = 6/group) were analyzed 14 and 21 d.p.i for CD4+ and CD8+ population by flow cytometry. For analysis, 2 × 105 cells were incubated with R-phycoerythrin (RPE) labelled mouse anti-chicken CD4+ :RPE or CD8+ a:RPE monoclonal antibodies (AbD Serotec Ltd., Oxford, United Kingdom) for 30 min in the dark. Subsequently, the cells were washed twice with PBS containing 2% foetal bovine serum and an aliquot of 1 × 104 cells per sample was analyzed quantitatively in a BD FACS Calibur flow cytometer using CELLquest software (BD BioSciences, UK). Unstained cells were used as negative control to remove the background signals. 2.4. Data analysis Each experiment was repeated twice and representative data from an experiment was used for analysis except for survival wherein pooled data from both the experiments were used. One way analysis of variance (ANOVA) was done; when the F ratio was significant, Duncan’s multiple range test was used as post hoc test. Alpha was set at 95%. Data were analyzed using the statistical software SPSSTM 20.0 (IBM, Corp. USA). The 2X2 contingency table on survival and viral shedding post-challenge were analyzed by Chisquare test corrected for Yate’s correction as some cell frequencies were 0.05). However, the odds of protection against virulent NDV challenge in R-848 usage along with inactivated NDV vaccine was 11.18 times as compared to vaccine alone in SPF chicken (95% CI: 0.56–223.1). Survived birds were apparently healthy and were active with normal feed and water intake. In addition, no NDV shedding was recorded in group D birds on any of the day tested. In contrast, group B and C showed viral shedding at every time point except day 0 (Table 6). There was significant difference in NDV shedding between group D and group B or C on day 4 and 7 post-challenge (P = 0.0039). The odds of protection against viral shedding in R-848 usage along with inactivated NDV vaccine was 169 times as compared to vaccine alone in SPF chicken (95% CI: 2.89–9885) at day 4 and 7 post-challenge. 4. Discussion In chicken, prophylactic capacity of TLR7 agonist, loxoribine is demonstrated for avian influenza virus and Salmonella spp. [19,20]. Table 6 Virus shedding from cloacal swabs of experimental SPF chicken following challenge with virulent Newcastle disease virus expressed in percent. Groupa (n = 6/group)

A B C D

Day post-challenge 4

7

14

Died 100 (6)b 100 (6)b 0 (0)a

Died 100 (6)b 100 (6)b 0 (0)a

Died 66.7 (4)a 100 (6)b 0 (0)a

Values in the parenthesis indicate the number of positive observation for six birds tested. Different superscripts in the same column indicate statistically significant difference (P = 0.0039). a Group A: PBS control; Group B: inactivated ND vaccine; Group C: commercial inactivated ND vaccine and Group D: combination of R-848 (50 ␮g/bird) and inactivated ND vaccine.

To the best of our knowledge, the individual adjuvant potential of TLR7 agonist is not available in chicken, whereas in mammals adjuvant effect of R-848 is well documented [21–23]. Further, the adjuvant activity of TLR agonists for each poultry vaccine needs to be explored case-by-case. Earlier workers used PAMPs such as CpG ODN [5] and LPS [6] as adjuvant with ND vaccine. Accordingly, we studied the co-administration of R-848 with inactivated ND vaccine that showed more protective immunity than the vaccine alone against virulent NDV challenge in SPF chicken. Antibodies confer resistance to NDV infection through virus neutralization by complement activation or opsonization. Antibody titre was significantly elevated in group D (R-848 + inactivated ND vaccine) than vaccine alone groups (group B or C) by both HI (Table 2) and ELISA (Table 3). This indicates the immunoenhancing effect of R-848 on humoral immune response when used with NDV antigen. In contrast, previous report [24] failed to demonstrate enhanced antibody response against HBsAg in the mice even at the highest dose of R-848 which might be imputed to the species difference. Though the neutralizing antibodies protect the birds against ND, it cannot prevent the viral shedding and the spread of infection [25]. Hence, the cellular immune response was also ascertained in this study. Antigen specific proliferation of PBMCs in vitro was significantly higher in group D than that of group B or C (Fig. 2). The observation is supported by flow cytometry which showed significantly high levels of CD4+ as well as CD8+ cells in group D (Table 4) indicating the effect of R-848 on the cellular immune response. Similar result was observed in the mice when R-848 was used with DNA vaccine [26]. The use of R-848 potentiated the protective immune response of inactivated NDV vaccine to a level of 100% in group D while it was only 80% in group B and C (Table 5) against challenge with virulent NDV. Further, R-848 in combination with inactivated NDV vaccine (group D) conferred complete protection from virus shedding in the excreta after virulent NDV challenge (Table 6). The use of R-848 with inactivated NDV vaccine can prevent the transmission of virus, which is an important goal in the control of ND. Type 1 interferons (IFNs), IFN-␣ and IFN-␤, have direct and indirect anti-viral effects [27] and delay the onset as well as severity of viral diseases in the chicken [28,29]. Significant elevation of IFN␣ and IFN-␤ transcripts in the spleen was observed as early as 8–12 h.p.i with R-848 in the chicken (Fig. 1A and B). This is in concurrence with earlier findings in the spleen of chicken after oral administration [30] and in vitro stimulation with TLR7 agonists [31,32]. Further, up-regulation of IFN-␣ in duck splenocytes treated with imiquimod [33] supports our result. The findings highlight the direct and indirect roles of R-848 in anti-viral response in the chicken. In contrast, TLR7 agonists in chicken splenocytes caused no significant up-regulation of type 1 IFN transcripts in vitro [34]. Although the molecular basis for non-responsiveness of chicken spleen to TLR7 agonist in in vitro condition is unclear, it could be due to the lack of essential transcription factors which are

S. Sachan et al. / Vaccine 33 (2015) 4526–4532

present under in vivo conditions. This is strengthened by the lack of type 1 IFN induction in chicken fibroblasts and macrophage cell line by TLR7 agonist while its induction in primary macrophages [30]. We also found R-848 induced up-regulation of type 2 IFN, IFN␥ in the spleen of chicken. Similar to mammals [35], chicken IFN-␥ has pleiotropic effects on immune cells viz. antiviral activity [36,37], stimulation of macrophages and natural killer cells [38], and increased expression of major histocompatibility antigens [37,39]. Thus, induction of IFN-␥ by R-848 (Fig. 1C) suggests that it can enhance the ability of immune system to combat various intracellular pathogens in chicken. Increased cell mediated immune response to NDV was also reported when IFN-␥ was coadministered with ND DNA vaccine [40]. R-848 significantly up-regulated both IL-4 and MHC II transcripts in the spleen of chicken (Fig. 1E and F). IL-4 enhances the expression of MHC II and IL-4 receptors on B lymphocytes. MHC II is required to present exogenous antigens processed by endocytic pathway and promote TH 2 mediated immunity [41,42]. Earlier studies reported increased antibody response to NDV when coadministered with IL-4 [40]. Th1 cells typically produce IFN-␥, while Th2 cells typically produce IL-4, IL-5, IL-9 and IL-13. Thus, the findings of this study suggest that R-848 can induce a balanced Th1 and Th2 response, which is vital to protect host against various infectious organisms. Further, our earlier report of induction of Th1 as well as Th2 responses in chicken PBMC ex vivo following administration of R-848 supports the findings of the present study [14]. Mixture of the type I and type II Ch-IFNs showed synergistic response on nitric oxide secretion and antiviral effects [43]. In this study, both type 1 and 2 IFNs along with iNOS (Fig. 1G) were found to be maximum at 24 h.p.i of R-848 which is in accordance with the synergistic action of both the types of IFNs [43]. Along with iNOS, R-848 significantly up-regulated the expression of classical proinflammatory cytokine IL-1␤ in the chicken spleen (Fig. 1D). Similar results were also reported when HD11 TLR7+ chicken macrophage like cell line was stimulated with R-848 and loxoribine [34]. The biological activity of chicken IL-1␤ resembles that of their mammalian orthologs [44] and promotes production of reactive oxygen intermediates (ROI) by activating NF-␬B [45]. Kogut et al. reported that stimulation with loxoribine induced degranulation and oxidative burst responses by heterophils [46]. The cytokine and iNOS responses observed in the chicken spleen in vivo is in accordance with our previous response obtained in chicken PBMCs in vitro when treated with R-848 [11]. Up-regulation of immune response genes might be the mechanism behind the favourable adjuvant effect of R-848 with inactivated NDV. In conclusion, administration of R-848 with inactivated ND vaccine enhanced both antigen specific humoral and cellular immune responses and also potentiated the protective capacity against virulent NDV challenge in SPF chicken. The adjuvant potential of R-848 might be due to the up-regulated expression of IFN-␣, IFN-␤, IFN-␥, IL-1␤, IL-4, iNOS and MHC-II genes.

Conflict of interest The authors declare that there is no conflict of interest with respect to the content of the manuscript.

Acknowledgment The authors are thankful to the Director, Indian Veterinary Research Institute for providing the facilities to carry out the work.

4531

References [1] Paul MS, Brisbin JT, Abdul-Careem MF, Sharif S. Immunostimulatory properties of Toll-like receptor ligands in chickens. Vet Immunol Immunopathol 2013;152(3):191–9. [2] Tang Y, Lu J, Wu P, Liu Z, Tian Z, Zha G, et al. Inactivated vaccine with adjuvants consisting of pattern recognition receptor agonists confers protection against avian influenza viruses in chickens. Vet Microbiol 2014;172(1): 120–8. [3] Aldous EW, Mynn JK, Banks J, Alexander DJ. A molecular epidemiological study of avian paramyxovirus type 1 (Newcastle disease virus) isolates by phylogenetic analysis of a partial nucleotide sequence of the fusion protein gene. Avian Pathol 2003;32(3):239–57. [4] Gould AR, Kattenbelt JA, Selleck P, Hansson E, Della-Porta A, Westbury HA. Virulent Newcastle disease in Australia: molecular epidemiological analysis of viruses isolated prior to and during the outbreaks of 1998–2000. Virus Res 2001;77(1):51–60. [5] Linghua Z, Xingshan T, Fengzhen Z. Vaccination with Newcastle disease vaccine and CpG oligodeoxynucleotides induces specific immunity and protection against Newcastle disease virus in SPF chicken. Vet Immunol Immunopathol 2007;115(3):216–22. [6] Tseng LP, Chiou CJ, Chen CC, Deng MC, Chung TW, Huang YY, et al. Effect of lipopolysaccharide on intranasal administration of liposomal Newcastle disease virus vaccine to SPF chickens. Vet Immunol Immunopathol 2009;131(3):285–9. [7] Nang NT, Lee JS, Song BM, Kang YM, Kim HS, Seo SH. Induction of inflammatory cytokines and toll-like receptors in chickens infected with avian H9N2 influenza virus. Vet Res 2011;42(64): 10–186. [8] Sundaresan NR, Ahmed KA, Saxena VK, Sastry KVH, Saxena M, Pramod AB, et al. Differential expression of inducible nitric oxide synthase and cytokine mRNA in chicken lines divergent for cutaneous hypersensitivity response. Vet Immunol Immunopathol 2005;108(3):373–85. [9] Fan YF, Hou ZC, Yi GQ, Xu GY, Yang N. The sodium channel gene family is specifically expressed in hen uterus and associated with eggshell quality traits. BMC Genetics 2013;14(1):90. [10] Thanthrige-Don N, Read LR, Abdul-Careem MF, Mohammadi H, Mallick AI, Sharif S. Marek’s disease virus influences the expression of genes associated with IFN-gamma-inducible MHC class II expression. Viral Immunol 2010;23:227–32. [11] Ramakrishnan S, Annamalai A, Sachan S, Kumar A, Sharma BK, Govindaraj E, et al. Synergy of lipopolysaccharide and resiquimod on type I interferon, pro-inflammatory cytokine, Th1 and Th2 response in chicken peripheral blood mononuclear cells. Mol Immunol 2015;64(1):177–82. [12] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29(9):e45. [13] Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Epidemiol 1938;27(3):493–7. [14] Annamalai A, Ramakrishnan S, Sachan S, Sharma BK, Kumar BS, Kumar V, et al. Administration of TLR7 agonist, resiquimod, in different types of chicken induces a mixed Th1 and Th2 response in the peripheral blood mononuclear cells. Res Vet Sci 2015;100:105–8. [15] OIE. Manual of diagnostic tests and vaccines for terrestrial animals: mammals, birds and bees, biological standards commission. 7th ed. Paris, France: World Organization for Animal Health (OIE); 2012. [16] He H, Crippen TL, Farnell MB, Kogut MH. Identification of CpG oligodeoxynucleotide motifs that stimulate nitric oxide and cytokine production in avian macrophage and peripheral blood mononuclear cells. Dev Comp Immunol 2003;27(6):621–7. [17] Mosman T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Meth 1983;65(1):55–63. [18] Denizot F, Lang R. Rapid colorimetric assay for cell growth and survival: modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 1986;89(2):271–7. [19] Stewart CR, Bagnaud-Baule A, Karpala AJ, Lowther S, Mohr PG, Wise TG, et al. Toll-like receptor 7 ligands inhibit influenza A infection in chickens. J Interferon Cytokine Res 2012;32(1):46–51. [20] Swaggerty CL, He H, Genovese KJ, Duke SE, Kogut MH. Loxoribine pretreatment reduces Salmonella Enteritidis organ invasion in 1-day-old chickens. Poult Sci 2012;91(4):1038–42. [21] Vasilakos JP, Smith R, Gibson SJ, Lindh JM, Pederson LK, Reiter MJ, et al. Adjuvant activities of immune response modifier R-848: comparison with CpG ODN. Cell Immunol 2000;204(1):64–74. [22] Rajagopal D, Paturel C, Morel Y, Uematsu S, Akira S, Diebold SS. Plasmacytoid dendritic cell-derived type I interferon is crucial for the adjuvant activity of Toll-like receptor 7 agonists. Blood 2010;115(10):1949–57. [23] Ma R, Du JL, Huang J, Wu CY. Additive effects of CpG ODN and R-848 as adjuvants on augmenting immune responses to HBsAg vaccination. Biochem Biophys Res Commun 2007;361(2):537–42. [24] Weeratna RD, Makinen SR, McCluskie MJ, Davis HL. TLR agonists as vaccine adjuvants: comparison of CpG ODN and resiquimod (R-848). Vaccine 2005;23(45):5263–70. [25] Reynolds DL, Maraqa AD. Protective immunity against Newcastle disease: the role of antibodies specific to Newcastle disease virus polypeptides. Avian Dis 2000;48:138–44.

4532

S. Sachan et al. / Vaccine 33 (2015) 4526–4532

[26] Thomsen LL, Topley P, Daly MG, Brett SJ, Tite JP. Imiquimod and resiquimod in a mouse model: adjuvants for DNA vaccination by particle-mediated immunotherapeutic delivery. Vaccine 2004;22(13):1799–809. [27] Palmer KJ, Harries M, Gore ME, Collins MKL. Interferon-alpha (IFN-␣) stimulates anti-melanoma cytotoxic T lymphocyte (CTL) generation in mixed lymphocyte tumour cultures (MLTC). Clin Exp Immunol 2000;119(3):412–8. [28] Marcus PI, Heide LVD, Sekellick MJ. Interferon action on avian viruses. I. Oral administration of chicken interferon-alpha ameliorates Newcastle disease. J Interferon Cytokine Res 1999;19(8):881–5. [29] Pei J, Sekellick MJ, Marcus PI, Choi IS, Collisson EW. Chicken interferon type I inhibits infectious bronchitis virus replication and associated respiratory illness. J Interferon Cytokine Res 2001;21(12):1071–7. [30] Sick C, Schultz U, Münster U, Meier J, Kaspers B, Staeheli P. Promoter structures and differential responses to viral and non viral inducers of chicken type I interferon genes. J Biol Chem 1998;273(16):9749–54. [31] Schwarz H, Schneider K, Ohnemus A, Lavric M, Kothlow S, Bauer S, et al. Chicken toll-like receptor 3 recognizes its cognate ligand when ectopically expressed in human cells. J Interferon Cytokine Res 2007;27(2):97–102. [32] Jenkins KA, Lowenthal JW, Kimpton W, Bean AG. The in vitro and in ovo responses of chickens to TLR9 subfamily ligands. Dev Comp Immunol 2009;33(5):660–7. [33] MacDonald MR, Xia J, Smith AL, Magor KE. The duck toll like receptor 7: genomic organization, expression and function. Mol Immunol 2008;45(7):2055–61. [34] Philbin VJ, Iqbal M, Boyd Y, Goodchild MJ, Beal RK, Bumstead N, et al. Identification and characterization of a functional, alternatively spliced Toll-like receptor 7 (TLR7) and genomic disruption of TLR8 in chickens. Immunology 2005;114(4):507–21. [35] Huang SI, Hendriks W, Althage A, Hemmi S, Bluethmann H, Kamijo R, et al. Immune response in mice that lack the interferon-gamma receptor. Science 1993;259(5102):1742–5. [36] Digby MR, Lowenthal JW. Cloning and expression of the chicken interferon-␥ gene. J Interferon Cytokine Res 1995;15(11):939–45.

[37] Song KD, Lillehoj HS, Choi KD, Zarlenga D, Han JY. Expression and functional characterization of recombinant chicken interferon-gamma. Vet Immunol Immunopathol 1997;58(3):321–33. [38] Lowenthal JW, York JJ, O’Neil JJ, Rhodes S, Prowse SJ, Strom DG, et al. In vivo effects of chicken interferon-␥ during infection with Eimeria. J Interferon Cytokine Res 1997;17:551–8. [39] Weining KC, Schultz U, Mtinster U, Kaspers B, Staeheli P. Biological properties of recombinant chicken interferon-␥. Eur J Immunol 1996;26(10): 2440–7. [40] Sawant PM, Verma PC, Subudhi PK, Chaturvedi U, Singh M, Kumar R, et al. Immunomodulation of bivalent Newcastle disease DNA vaccine induced immune response by co-delivery of chicken IFN-␥ and IL-4 genes. Vet Immunol Immunopathol 2011;144(1):36–44. [41] Perrigoue JG, Saenz SA, Siracusa MC, Allenspach EJ, Taylor BC, Giacomin PR, et al. MHC class II-dependent basophil-CD4+ T cell interactions promote TH2 cytokine-dependent immunity. Nat Immunol 2009;10(7):697–705. [42] Turley SJ, Inaba K, Garrett WS, Ebersold M, Unternaehrer J, Steinman RM, et al. Transport of peptide-MHC class II complexes in developing dendritic cells. Science 2000;288(5465):522–7. [43] Sekellick MJ, Lowenthal JW, O’Neil TE, Marcus PI. Chicken interferon types I and II enhance synergistically the antiviral state and nitric oxide secretion. J Interferon Cytokine Res 1998;18(6):407–14. [44] Weining KC, Sick C, Kaspers B, Staeheli P. A chicken homolog of mammalian interleukin-1␤: cDNA cloning and purification of active recombinant protein. Eur J Biochem 1998;258(3):994–1000. [45] Bonizzi G, Piette J, Merville MP, Bours V. Distinct signal transduction pathways mediate nuclear factor-kappaB induction by IL-1beta in epithelial and lymphoid cells. J Immunol 1997;159(11):5264–72. [46] Kogut MH, Swaggerty C, He H, Pevzner I, Kaiser P. Toll-like receptor agonists stimulate differential functional activation and cytokine and chemokine gene expression in heterophils isolated from chickens with differential innate responses. Microb Infect 2006;8(7):1866–74.