Plant Cell Reports

Plant Cell Reports (t995) 15:82-86

© Springer-Verlag1995

Agrobacterium mediated genetic transformation and plant regeneration via organogenesis and somatic embryogenesis from cotyledon leaves in eggplant (Solanum melongena L. cv. 'Kecskem ti lila') Miklts Ffiri, Istvfin Nagy, Mfirta Csfinyi, Judit Mityk6, and Andrfis Andrfisfalvy Agricultural Biotechnology Center, Institute for Plant Sciences, Laboratory for Cell Biology and Tissue Culture, Szent-Gytrgyi A. u. 4, H-2100 Gtdtl16, Hungary Received 19 September 1994/Revised version received 20 December 1994 - Communicated by H. L6rz

Summary. Novel and efficient protocols for plant regeneration and genetic transformation from longitudinally-halved cotyledons of in vitro raised seedlings in eggplant (Solanum melongena L.) are described. After co-cultivation with Agrobactefium vectors harboring neomycin phosphotransferase (nptll) as selectable marker, transgenic plantlets were regenerated on selective media containing 100 mg/I kanamycin. Transformants were recovered from embryogenic calli induced by 4 mg/I c(-naphthaleneacetic acid (NAA), and from organogenic calli induced by the addition of 2 mg/I zeatin plus 0.01 mg/I NAA. Nineteen independent transgenic lines were grown to maturity. The structural integrity, expression and sexual transmission of the introduced genes for neomycin phosphotransferase and I~-glucuronidase (gus) were investigated. INTRODUCTION Eggplant (Solanum melongena L.), an important nontuberous vegetable of the family Solanaceae, is native to South-America. It is widely cultivated in Asian countries, the Mediterranean region and Central- and South-Eastern Europe. The production of eggplant is threatened by numerous diseases, pests and viruses. Resistance genes have been found in different wild Solanum species. The introduction of these genes via intergeneric crossing or asymmetric protoplast fusion is, however, limited, due to sterility problems in the progeny (Ducreux et al. 1991). Genetic transformation seems to be the most promising strategy to introduce new resistance factors. Stable transformation using different Agrobactedum vectors has been achieved through leaf and cotyledon explants of in vitro plantlets (Guri and Sink 1988, Filippone and Lurquin 1989, Rotino and Gleddie 1990, Rotino et al. 1992). Genetic transformation through embryogenesis has failed (Filippone et al. 1992), although eggplant is an excellent example for studying somatic embryogenesis in the family Solanaceae (Gleddie et al. 1986). MATERIALS AND METHODS

Plant matedaL Seeds of Solanum melongena L. cv. 'Kecskemeti Ilia' were surface-sterilized and placed into 425 ml 'Plant Box' Correspondence to: M. F~ri

plastic containers (Kontaplant, Szentes, Hungary) containing 70 ml of TMS medium (described below). Germination occurred at 25+1 °C under 16/8 h photoperiod at a photon fluency rate of 35 pmol/m2/s from F-29 fluorescent tubes ('l'ungsram, Hungary). Cotyledons were harvested from 14-21 d old aseptic seedlings and halved longitudinallyalong the midvein.

Media. TM media were composed of MS micro- and macroelements (Murashige and Skoog 1962) and B5 vitamins (Gamborg et al. 1968), with either 2% sucrose (TMS) or 1.5% glucose (TMG) as carbon sources. TMRG medium contained half-strength MS macroelements, while its other components were identical to TMG. Bacterial strains and plasmids. The multifunctional T-DNA vector pGSGlucl (14.2 kb) contains chimaeric npUl and gus gene fusions are under the transcriptional control of the TRI' and TR2' promoters respectively. The plasmid pGSGlucl was mobilized from E. coil into the disarmed Agrobacterium tumefaciens strain C58C1 RifR containing pGV2260 (Deblaere et al. 1985) via triparental mating (Ditta et al. 1980). Plant regeneration and transformation. During the experiments, TMG-based induction media with three different growth regulator combinations were used: (a) 2 mg/I zeatin and 0.01 mg/I NAA (Rotino et al. 1992) to induce callus formation and indirect organogenesis ; (b) 2 mg/I kinetin (Mukherjee et al. 1991) to induce direct organogenesis without callus formation ; (c) 4 mg/I NAA (Gleddie et al. 1983) to induce somatic embryogenesis through callus formation. Explants were placed with the cut surface down on the medium and gently pushed into it. Shoot primordia and somatic embryos of 2-3 mm length were separated and subcultured on growth regulator-free TMG medium. When elongated (3-5 cm), the shoots were dissected and rooted on TMRG medium. In the transformation experiments the cotyledon explants were placed in Petri dishes with liquid induction medium and either immediately or after a preculture of 24 or 48 h inoculated with a fresh overnight Agrobactedum culture to an initial density of about 107 bacteria/ml. After co-culturing for 24 or 48 h under diffuse light, explants were rinsed with liquid regeneration medium several times, dried between sterile filter papers, and placed into 12 cm Petri-dishes containing solidified regeneration medium supplemented with 500 mg/I cefotaxime and 50-100 mg/I kanamycin. After 3 weeks of culture, yellowish-green embryogenic calli with somatic embryos and dark-green morphogenic calli with leaf primordia were dissected and further cultivated in liquid TMG medium containing 10 mg/I NAA with continuous shaking, and/or solidified TMG medium with 4 mg/I

83 NAA. Media in both cases were supplemented with 50 mg/I kanamycin and 500 mg/I cefotaxime. The cultures were subcultured twice at 3 week intervals and placed on growth regulator-free TMG agar medium for 3 weeks. From this step, all media contained 50 mg/I kanamycin and 250 mg/I cefotaxime. Advanced stage kanamycin-resistant embryos of 3-5 mm length and shoots were transferred into 100 ml Erlenmeyer flasks containing solidified TMRG medium for rooting, then the plantlets were potted and acclimatized to the greenhouse. Flowers of the primary transformants were selfed or pollinated with wild type pollen and seeds were harvested after maturation. Detection of the gus gene expression. GUS-activity was detected by the histochemical assay using 5-bromo-4-chloro-3-indolyl-i3-Dglucuronide (X-gluc) as substrate (Jefferson 1987). Free-hand sections from different organs of transformed plants were incubated in 100 mM phosphate buffer (pH 7.0) containing 1 mg/ml X-gluc for 1 h to overnight at room temperature. Detection of the nptll gene expression. Aseptic leaf explants of in vitro Ro plants and surface-sterilized seeds of R1 and Ro x wild type crosses were tested for callus induction and for growing on TMG medium with 4 mg/I NAA, and on growth regulator free TMRG medium respectively. The media contained 200 mg/I kanamycin in b o t h cases. Assays for neomycin phosphotransferase from the leaves of primary transformants were carried out by the method of Reiss et al. (1984). DNA isolation and Southern hybridization. DNA was isolated from lyophilized leaf powder after Thompson et al. (1983)with minor modifications. Purified DNA (10 #g) was digested overnight with BamHI and Hindlll, separated by electrophoresis and blotted onto nitrocellulose (Hybond-C extra, Amersham). A 1.9 kb long gelpurified Pstl fragment from the plasmid pFF19G (Timmermans et al. 1990), representing the gus coding sequence, was labeled by the random priming approach (Feinberg and Vogelstein 1982) using o~-[32p]-dCTP. Hybridization and autoradiography were carried out according to standard protocols (Sambrook et al. 1989) and instructions of the manufacturers. Analysis of transformants by polymerase chain reaction (PCR). For the amplification of the gus-homologous sequences, the following pair of 21 mer oligonucleotide primers was used: '(+)'-primer: GGTGGGAAAGCGCGTTACAAG, and '(-)'-primer: CGGTGATACATATCCAGCCATwith the positions 400 to 420 and 1900 to 1880 respectively (Jefferson et al. 1986). PCR was carried out in a Thermal Cycler (Perkin Elmer Cetus) in 50 pl reaction mixtures containing 200 ng of plant genomic DNA; 200 pM of each dNTPs; 0.4 pM of each primer; 2.5 units of Taqpolymerase (Amersham). Reactions were started with a denaturation at 94 °C for 4 min, followed by 35 cycles with the following parameters: 92 °C for 1 min, 60 °C for 1 min, 72 °C for 1.5 min. The program was terminated by an extension at 72 °C for 7 min. For detection of the amplified DNA bands, 10 #1 from the reaction mixtures were loaded on 1% agarose gels. Determination of ploidy level by flow cytometry. Nuclei suspensions were prepared from 10 mg fresh leaf material of in vitro regenerants or somatic embryos by rubbing tissues in LB01 buffer (Dole~el et al. 1989). Suspensions were filtered and incubated with 4',6-diamidino-2-phenylindole (DAPI). The ploidy level of the nuclei population was determined by a CA-II flow cytometer (Partec GmbH, Germany). From the different populations, 3-10 randomly collected samples were analyzed in parallel. RESULTS AND DISCUSSION

Somatic embryogenesis cotyledon explants

and

organogenesis

on

the

On the 10th to 12th d of culture, yellowish-green embryogenic calli were formed along the cutting surface of the longitudinally-halved cotyledons on TMG medium containing 4 mg/I NAA (Fig. 1A). Each explant produced 10-30, in some instances up to 50, embryo-like structures. Initial development of the embryos was bipolar (Fig. 1B), and the embryos were surrounded with an undifferentiated callus, and did not have direct contact with the cotyledon tissue. In most of the early torpedo-stage embryos, the radicula swelled and several secondary embryos formed on them. The embryogenic potential of the calli was maintained by regular subculturing at 3-4 week intervals in liquid or on solidified TMG medium with 4 mg/I NAA. After transferring to growth regulator-free medium, somatic embryos started to germinate. Isolated bipolar embryoids converted to plantlets with 80-90% efficiency on TMRG medium, and after acclimatization, w e r e transferred into the greenhouse. However, when the cotyledon explants were cultured on TMG medium supplemented with 2 mg/I kinetin, green organogenic centers were formed along the entire cutting surface (15-25 centers per explant). The non-friable centers were in direct contact with the cotyledon tissue, and no callus formation was observed around them (Fig. 1C). In addition, efficient organogenesis, but with more intense callus formation, was obtained when using TMG medium with the growth-regulator combination of 2 mg/I zeatin plus 0.01 mg/I NAA. After prolonged culture on the same medium, some of the morphogenic centers converted to shoot primordia, from which shoots were regenerated on growth regulator-free TMG medium. When reaching 3-5 cm, shoots were rooted and plantlets were transferred into the greenhouse. Improvements on the transformation and regeneration protocols

Different methods for inoculation and co-culture with Agrobacte#um tumefaciens were employed. When the results of nine independent experiments with more than 700 explants were summarized, the most efficient procedure included a 2 d long preculture followed by a 2 d long co-culture in liquid regeneration medium. The transformation efficiency (proportion of the kanamycin-resistant primary calli) decreased by half if two days co-culture without preculture was applied. No kanamycin-resistant primary calli were obtained after 24 h co-culture. About two times lower transformation efficiency was obtained if leaf segments from in vitro plantlets as explants were used instead of longitudinally-halved seedling cotyledons (data not shown). After co-culture, embryogenic primary callus could be induced on TMG medium with 4 mg/I NAA supplemented with 50 mg/I kanamycin and 500 mg/I cefotaxime. Calli obtained on the agar medium were further maintained in liquid TMG medium with 10 mg/I NAA supplemented with 100 mg/I kanamycin and 500 mg/I cefotaxime and subcultured at 3 week intervals. By the end of the third cycle, a dense suspension culture was obtained, containing primary and secondary embryos. To initiate regeneration from embryogenic suspension, cultures were plated on solidified TMG medium without growth regulators and supplemented with 100 mg/I kanamycin and 500 mg/I cefotaxime.

84 In another set of transformation experiments, 75% of the halved cotyledon explants produced a non-friable, green primary callus on solidified TMG medium containing 2 mg/I zeatin+0.01 mg/I NAA, 100 mg/I kanamycin and 500 mg/I cefotaxime. After 10-14 d, the explants were transferred onto TMG medium containing 4 mg/I NAA, kanamycin and cefotaxime as above. Callus induction started on different parts of the cut surface, mostly on the petiole of the cotyledon. By the 21st day of incubation, calli enlarged to 0.5-1 cm, turned dark-green and became strongly segmented. About 10% of these calli proved to be morphogenic, showing organogenic centers and leaf primordia; 90% of the calli were non-morphogenic and became vitrified. By prolonged culture on the same medium, both somatic embryos and shoot primordia formed from morphogenic calli. Shoot primordia, which formed between the regeneration periods originated either from the initial primary calli or from the somatic embryos by thickening, proliferating and finally shaped a shoot axis. The non-morphogenic primary calli failed to regenerate during subsequent subcultures. Rooted regenerants were recovered by both types of morphogenic primary calli, although with different efficiency: 0.8% of the explants produced embryogenic calli and plants on TMG medium supplemented with 4 mg/I NAA, while 7.5% of the explants produced organogenic calli and plants on TMG medium containing 2 mg/I zeatin + 0.01 mg/I NAA. Fig. 1. (A-C). Somatic embryogenesis and organogenesis from longitudinally-halved cotyledon explants of Solanum melongena L. cv. Kecskemeti lila. (A)Embryogenic callus formation along the explant cultured on TGM medium supplemented with 4 m/I NAA. Bar = 5 mm. (B Bipolar somatic embryo of late torpedo stage raised on TMG medium supplemented with 4 mg/I NAA. Bar = 0.5 mm. (C) Shoot primordium regenerated from the halved cotyledon. explant cultured on TGM medium supplemented with 2 mg/I kinetin. Bar = 0.5 mm

Analysis of the transformants and progenies During the first round of transformation experiments, 19 fertile transgenic plants were recovered. Seven transformants of embryogenic origin, designated as KLT1 to KLT7, were randomly chosen for further analysis. The histochemical localization of the GUS-activity in the transformants (Fig. 2A-D) revealed the typical expression pattern characteristic of the TR2' (mas 2"~ promoter, also shown previously by other workers using a similar construction (Saito et al. 1991, Sangwan et al. 1991).

Fig. 2. (A-D). Histochemical Iocalisation of the GUS-activity in different transgenic eggplant tissues. (Dark spots indicate the blue coloration after incubation with X-gluc.) (A) GUS expression in embryogenic callus tissue. Bar = 0.6 mm. (B) GUS expression in a young somatic embryo. Bar = 0.6 mm. (C) GUS expression in the anther and pollen grains and characteristic of the TRy' promoter. Bar = 0.2 mm. (D) Cross-section of a stem of a transgenic eggplant showing high level of gus-gene expression in the phloem. Bar = 0.6 mm.

85 In mature greenhouse plants, a strong cell-type preference of the gus-expression was observed in the phloem tissues and in the veins, whereas the mesophyll and epidermis cells showed little activity (Figure 2 D). In agreement with other investigations on related promoters (Langridge et al. 1989, Guevara-Garcia et al. 1993), we found that in the vegetative tissues the GUS-activity gradually decreased from the base toward the top of the plants, and almost no activity could be detected in the leaves of the newest nodes. On the other hand, a surprisingly high level of GUS activity could be localized in the anthers and pollen grains (Fig. 2C).

The presence and integrity of the relevant T-DNA sequence was confirmed in all transgenic lines by Southern hybridization: after digestion of the genomic DNA with Hindlll and BamHI, DNA fragments hybridized in all cases at the predicted 4.3 kb position with the labeled gus probe (Figure 3). Likewise, PCR with gus specific primers resulted in a strong amplification of a 1.5 kb long sequence in the case of the transformants, whereas no gus-specific sequence amplification could be detected in the case of non-transformed control plants (Fig. 4). ~-

-.I

..J

..J

.-I

.-I

.-I

-.I

bp 21226 5148 3530

2027 1904 1584 1375 2,22|

qSJ73 11lTI

947

-

831

-

2lJ~? ,ll4

564

Fig. 3. Genomic Southern analysis of the transformants. WT: untransformed wild type plant, KLT1-KLT7: transgenic eggplant (cv. Kecskemeti Ilia) lines.

WT

KLT 1

KLT 2

KLT 3

K L T q.

KLT 5

KLT 6

Fig. 4. PCR analysis. Amplification of a 1500 bp long gus specific DNA segment in the transgenic eggplant lines. (Abbreviations as in Fig. 3.)

KLT 7

==.o

..-!.,

....

o

,

~.

.........

Nuclear DNA content (channel number)

Fig. 5. NPTII test. High level of NPTII activity in the leaf extracts of five-week old in vitro transgenic eggplant lines. (Abbreviations as in Fig. 3).

Fig. 6. Normal diploid (2n=24) DNA-histograms of the nuclei analyzed by flow cytometry from untransformed (A) and transformed (B) 'Kecskemeti lila' plants.

A high level of NPTII activity was detectable in leaf extracts of the transgenic plants (Fig. 5). Intensive embryogenic callus induction and somatic embryo production started on the leaf-disks from the primary transformants when cultured on induction medium

containing 200 mg/I kanamycin. After growing the R 0 populations, 4 self-pollinated R 1 and populations from different Ro x wild type crosses were analyzed by germinating seeds on growth regulator-free agar medium containing 200 mg/l kanamycin. The nptll gene was in

86 each case stably integrated in the recipient genome. Progenies from selfed primary transformants in all cases showed a typical 3:1 (KmR:Km s) Mendelian phenotypic segregation when seeds were germinated on agar containing 200 mg/I kanamycin (data not shown). In a set of experiments, 71 plantlets from a transgenic x wild type cross were also analyzed. The progeny showed a 36:35 KmR:Km s segregation, also indicating a monogenic dominant fashion for the transmission of the nptll gene. All R 0 and R 1 transgenic plants showed a normal phenotype and no morphological abnormalities were observed. According to the flow cytometry analysis each mature transgenic plant proved to be a true diploid (2n=24, Fig. 6), whereas regenerating calli and young somatic embryos often showed an unbalanced ploidy.

Con~usions In this paper we present highly effective protocols for the regeneration and genetic transformation of eggplant cotyledons through organogenesis as well as somatic embryogenesis. We found that halved 'Kecskemeti Ilia' eggplant cotyledons from 13-14 d old in vitro seedlings had very good embryogenic and organogenic potential, and were superior to leaf segments in regeneration and transformation experiments. From these explants, 20-30 somatic embryos and, subsequently, plants could be derived using 4 mg/I NAA. In parallel experiments, we induced organogenesis on halved cotyledon explants with 2 mg/l kinetin and 1.5% glucose and recovered 10-20 plantlets per explant. The combination of zeatin (2 mg/I) and NAA (0.01 mg/I) also proved to be effective for callus induction, where 75% of the halved cotyledon explants produced primary calli resistant to kanamycin after cocultivation with A. tumefaciens harboring nptl/. About 10% of the kanamycin resistant calli were organogenic and produced plantlets. With the use of 4 mg/I NAA, transgenic plants could be recovered via somatic embryogenesis, where 0.8 % of the halved cotyledon explants produced embryogenic calli resistant to kanamycin. Scanning electron microscopy investigations revealed that both primary and secondary embryogenesis occurred. This is the first report on the genetic transformation of a Solanum species through somatic embryogenesis proved by scanning electron microscopic investigation. In earlier experimental systems, transformation was achieved only through organogenesis (Filippone and Lurquin 1989) and the induction frequency of primary calli were found between 13.8 and 48% with low plant regeneration efficiency (Guri and Sink 1988, Rotino and Gleddie 1990; Rotino et al. 1992). Similar to the observations of others (Filippone and Lurquin 1989, Rotino and Gleddie 1990; Filippone et al. 1992, Leone et al. 1993), we concluded that the regeneration methods which could be applied successfully in untransformed cultures, were not applicable without modifications, or were much less effective during the transformation experiments. The improved transformation protocols presented here are likely to be applicable to introduce economically valuable genes into the eggplant genome.

Acknowledgements. The authors are indebted to Plant Genetic Systems (Gent, Belgium) for providing the plasmid pGSGlucl, to the late Dr. Frantisek Nov~k and to Dr. Michael Van Duren for the opportunity to carry out flow cytometry at the Seibersdorf

Laboratory of IAEA, to Mrs. Anik6 Csillag (Horticultural University, Budapest) for the scanning electron microscopy and to Prof. Gregory C. Phillips (New Mexico State University) for the critical reading of the of the manuscript. The excellent photographic work of Gabor Takacs and the linguistic help of Mark Davies are also gratefully acknowledged.

REFERENCES Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, Leemans J (1985) Nucl Acids Res 13:4777-4788 Ditta G, Stanfield S, Cobbin D, Helinski DR (1980) Proc Natl Acad Sci USA 77:7347-7351 Dole~.el J, Binarova P, Lucretti S (1989) Biol Plant 31:113-120 Ducreux G, Rossignol L, Sihachakr D (1991)Acta Hort 289:65-75 Feinberg AP, Vogelstein B (1982) Anal Biochem 132:6-13 Filippone E, Lurquin PF (1989) Plant Cell Reports 8:370-373 Filippone E, Penza R, Romano R (1992) Capsicum Newsletter Special Issue. Proc Vlllth Internat Meeting EUCARPIA Working Group on Genetics and Breeding of Capsicum and Eggplant, pp 260-265 Gamborg OL, Miller RA, Ojima K (1968) Exp Cell Res 50:151-158 Gleddie S, Keller WA, Setterfield G (1983) Can J Bot 61:656-666 Gleddie S, Keller WA, Setterfield G (1986) Can J Bot 64:355-361 Guevara-Garcia A, Mosqueda-Cano G, Arg0ello-Astorga G, Simpson J, Herrera-Estrella L (1993) Plant J 4:495-505 Guri A, Sink KC (1988) J Plant Physio1133:52-55 Jefferson RA, Burgess SM, Hirsch D (1986) Proc Natl Acad Sci USA 83:8447-8451 Jefferson RA (1987) Plant Molec Biol Rep 5:387-405 Langridge W, Fitzgerald K, Koncz C, Schell J, Szalay A (1989) Proc Natl Acad Sci USA 86:3219-3223 Leone M, Filippone E, Lurquin PF (1993) Transformation in Solanum melongena L. (eggplant). Biotechnology in Agriculture and Forestry (YPS Bajaj ed) Vol. 22, pp 320-328. Springer, New York, Heidelberg Mukherjee SK, Rathinasabapathi B, Gupta N (1991) Plant Cell Tiss Org Cult 25:13-16 Murashige T, Skoog F (1962) Physiol Plant 15:473-497 Reiss B Sprengel R, Will H, Schaller H (1984) Gene 30:217-223 Rotino GL, Gleddie S (1990) Plant Cell Reports 9:26-29 Rotino GL, Arpaia S, lannacone R, lannamico V, Mennela G, Onofaro V, Perrone D, Sunseri F, Xike Q, Sponga S (1992) Capsicum Newsletter Special Issue. Proc Vlllth Internat Meeting EUCARPIA Working Group on Genetics and Breeding of Capsicum and Eggplant, pp 295-300 Saito K, Yamazaki M, Kaneko H, Murakoshi I, Fukuda Y, Van Montagu M (1991) Planta 184:40-46 Sambrook J, Fritsch EF Maniatis T (1989) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor Sangwan RS, Burgeois Y, Sangwan-Norreel BS (1991) Mol Gen Genet 230:475-485 Timmermans MCP, Maliga P, Viera J, Messing J, (1990) J Biotechno114:333-344 Thompson RD, Bartels D, Harberd NP, Flavell RB (1983) Theor Appl Genet 67:87-96 Vervliet G, HolstersM, Teuchy H, Van Montagu M, Schell J (1975) J Gen Virol 26:33-48