Apoptosis DOI 10.1007/s10495-015-1145-x

ORIGINAL PAPER

LYG-202 exerts antitumor effect on PI3K/Akt signaling pathway in human breast cancer cells Yue Zhao1 • Xiaoping Wang1 • Yang Sun1 • Yuxin Zhou1 • Yuehan Yin1 Youxiang Ding1 • Zhiyu Li1 • Qinglong Guo1 • Na Lu1

•

Ó Springer Science+Business Media New York 2015

Abstract In this study, we aimed to investigate the antitumor effect of LYG-202, a newly synthesized piperazine-substituted derivative of flavonoid on human breast cancer cells and illustrate the potential mechanisms. LYG202 induced apoptosis in MCF-7, MDA-MB-231 and MDA-MB-435 cells. LYG-202 triggered the activation of mitochondrial apoptotic pathway through multiple steps: increasing Bax/Bcl-2 ratio, decreasing mitochondrial membrane potential (DWm), activating caspase-9 and caspase-3, inducing cleavage of poly(ADP-ribose) polymerase, cytochrome c release and apoptosis-inducing factor translocation. Furthermore, LYG-202 inhibited cell cycle progression at the G1/S transition via targeting Cyclin D, CDK4 and p21Waf1/Cip1. Additionally, LYG-202 increased the generation of intracellular ROS. N-Acetyl cysteine, an antioxidant, reversed LYG-202-induced apoptosis suggesting that LYG-202 induces apoptosis by accelerating ROS generation. Further, we found that LYG202 deactivated the PI3K/Akt pathway, activated Bad phosphorylation, increased Cyclin D and Bcl-xL expression, and inhibited NF-jB nuclear translocation. Activation of PI3K/Akt pathway by IGF-1 attenuated LYG-202-induced apoptosis and cell cycle arrest. Our in vivo study

showed that LYG-202 exhibited a potential antitumor effect in nude mice inoculated with MCF-7 tumor through similar mechanisms identified in cultured cells. In summary, our results demonstrated that LYG-202 induced apoptosis and cell cycle arrest via targeting PI3K/Akt pathway, indicating that LYG-202 is a potential anticancer agent for breast cancer. Keywords LYG-202  Apoptosis  Cell cycle arrest  PI3K/Akt  ROS Abbreviations ROS Reactive oxygen species DAPI 40 ,6-Diamidino-2-phenylindole DMSO Dimethylsulfoxide MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide PBS Phosphate buffered saline PI Propidium iodide PARP Poly(ADP-ribose) polymerase AIF Apoptosis-inducing factor CDK Cyclin-dependent kinase NAC N-Acetyl cysteine IGF-1 Insulin-like growth factor-1

Yue Zhao and Xiaoping Wang contributed equally to this work. & Qinglong Guo [email protected] & Na Lu [email protected] 1

State Key Laboratory of Natural Medicines, Jiangsu Key Laboratory of Carcinogenesis and Intervention, Jiangsu Key Laboratory of Drug Design and Optimization, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009, People’s Republic of China

Introduction Breast cancer is one of the most common types of cancer among women all around the world, 15–20 % of which could be prevented in the mid-1990s. Although some advances in diagnosis and treatment have been achieved recently, the mortality rates of breast cancer are still high

123

Apoptosis

[1]. Consequently, it is urgent and important to search for more advanced and effective new drugs for breast cancer. Apoptosis plays a crucial role in the evolution of the organism and homeostasis maintenance by eliminating redundant and abnormal cells. It has been reported that there are two major apoptosis pathways including the extrinsic and intrinsic (mitochondria-associated) pathway, both of which are found in the cytoplasm [2]. The genes and proteins controlling apoptosis have become potential drug targets for cancer since activating apoptotic programs can induce cancer cell death. Dissipation of the mitochondrial transmembrane potential is considered as one of the mitochondria-associated apoptosis processes [3]. Dysfunction in the mitochondrial respiratory chain leads to reactive oxygen species (ROS) accumulation [4]. ROS is the mediator of apoptotic signaling and also regulates the expression of the Bcl-2 family proteins [5], such as the anti-apoptotic Bcl-2 and Bcl-xL [6]. The Bcl-2 family proteins regulate apoptosis by controlling mitochondrial permeability. As a pivotal process, the cell cycle control system is a cyclically-operating biochemical mechanism consists of a set of interacting proteins that induce and coordinate proper progression through the cycle comprising of cyclins, cyclin-dependent kinases (CDK) and their inhibitors (CDKI) [7]. During the G1 to S phase transition, the association of CDK4 with D-type cyclins is critical for G1 phase progression while p21Waf1/Cip1 could block cells into S period. Besides, ROS accumulation induces G1/S phase cell cycle arrest by the activation of p21Waf1/Cip1 expression [8]. Thus, the dysfunction of these regulators may contribute to cancer growth and development. The PI3K/Akt signaling pathway is powerful in controlling apoptosis and cell cycle. It has been reported that this pathway is aberrantly activated in various types of cancers such as human breast cancer and lung cancer. PI3K could catalytically produce the lipid second messenger phosphatidylinositol-3,4,5-triphosphate (PIP3) at the cell membrane, which leads to recruiting and activating of the downstream targets, including the serine-threonine protein kinase Akt (also known as protein kinase B) [9]. Overactive PI3K/Akt pathway would mitigate the process of apoptosis and promote tumor cell cycle progression, which acts as an ‘‘on’’ or ‘‘off’’ switch [10]. Additionally, PI3K/ Akt pathway may manipulate the apoptotic Bcl-2 family proteins. Furthermore, Bad, a BH3 domain-containing protein inducing apoptosis by inactivating the anti-apoptotic proteins Bcl-2 and Bcl-xL may be phosphorylated at serine 136 by Akt kinase subsequently inhibiting its proapoptotic effects [11–13]. The PI3K/Akt pathway plays a significant role in the cell cycle arrest by correspondingly regulating CDK 4, Cyclin D and p21Waf1/Cip1, which could block cell cycle transition

123

from G1 to S phase. Furthermore, p-Akt can promote cell survival by indirectly activating the pro-survival transcription factor nuclear factor-jB (NF-jB) through the phosphorylation of I-jB kinase (IKK) [14, 15]. Afterwards, the activated NF-jB could regulate apoptosis and cell cycle progression by targeting transcription of Cyclin D and BclxL [16, 17]. Flavonoids are well-known for their physiological antiinflammatory and anti-allergic activities, which is a conventional herbal medicine widely used in traditional herbal preparations in China. Nowadays, several flavonoids have been found to inhibit the proliferation of several human cancer cells by inducing apoptosis [18, 19]. LYG-202, a newly synthesized flavonoid bearing a methyl piperazine side chain through a four-carbon linker (Fig. 1a), could induce apoptosis in some carcinoma cells [20] and cell cycle arrest in human colorectal carcinoma HCT-116 cells [21]. Accordingly, we tested the efficacy of LYG-202 in apoptosis and cell cycle arrest in breast cancer and illuminated the underlying mechanism by targeting PI3K/Akt pathway.

Materials and methods Reagents LYG-202 (purity [ 98 %), obtained from Dr. Zhiyu Li (China Pharmaceutical University, China), was dissolved in dimethylsulfoxide (DMSO) and stored at -20 °C until needed. Wogonin was dissolved in DMSO as a stock solution, stored at -20 °C until needed. The final concentration of DMSO did not exceed 0.1 % throughout the study. Insulin-like Growth Factor-I (IGF-1) was from ebioscience (USA), Wortmannin was from Beyotime Institute of Biotechnology (Shanghai, China). N-Acetyl-Lcysteine (NAC) was purchased from Sigma Aldrich (USA) was dissolved in sterile water. 3-(4,5-Dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) and diamidino-phenyl-indole (DAPI) were from Sigma (St. Louis, Missouri). Bovine serum albumin (BSA) was purchased from Roche (Mannheim, Germany). Antibodies Antibodies to Bax, Bcl-2, Caspase 9, cytochrome c (Cyt c), CDK4, Akt, p-Akt (Ser473), NF-jB, b-actin were from Santa Cruz Biotechnology (Santa Cruz, California). Antibody to p21Waf1/Cip1 was from Upstate Biotechnology (Lake Placid, New York). Antibodies to PI3K, Bcl-xL, Histone H3, Lamin A were from Bioworld (Bioworld, Minnesota). Antibodies to Cyclin D, poly(ADP-ribose) polymerase (PARP), COX IV, apoptosis-inducing factor

Apoptosis

Fig. 1 LYG-202 inhibits the viability in human breast cancer cells. a LYG-202 molecular structure (C25H30N2O5, MW 438.52). b Effect of LYG-202 on the cell viability in MCF-7, MDA-MB-231 and MDA-MB-435 cells. c Effect of Wogonin on the cell viability in MCF-7, MDA-MB-231 and MDA-MB-435 cells at 12 h. MTT assay

was used to detect cell viability after treatment of different concentrations of LYG-202 for 12, 24 and 48 h or Wogonin for 12 h, respectively. The data shown are the mean from three parallel experiments. d MCF-7 cells were treated with 4, 8, 12 lM LYG-202 for 12 h then observed under an inverted light microscope (9200)

(AIF), Bad, p-Bad were from Cell Signaling Technology (Danvers, Massachusetts) and antibody to b-actin was from Boster Biological Technology (Wuhan, China). Insulin-like

Growth Factor-I was from ebioscience (USA), Wortmannin was from Beyotime Institute of Biotechnology (Shanghai, China), IRDyeTM800 conjugated secondary antibodies

123

Apoptosis

were from Rockland Inc. (Philadelphia, PA) and diluted at the ratio of 1:15,000.

were analyzed using a FACScan laser flow cytometer (BD Biosciences, Franklin Lakes, NJ).

Cell culture

Mitochondrial transmembrane potential (DWm) assessment

Human breast cancer cell line MCF-7 cells, MDA-MB-435 and MDA-MB-231 were cultured in Dulbecco’s modified Eagle’s medium (Gibco, USA) and L-15 medium (Gibco, USA) supplemented with 10 % fetal bovine serum (Gibco, USA), 100 U/ml penicillin and 100 U/ml streptomycin, cells were cultured in a humidified CO2 (5 %) incubator (Thermo Forma, Waltham, Massachusetts) at 37 °C. MTT assay Experiments were done in triplicate in a parallel manner for each concentration of LYG-202 and Wogonin used and the results are presented as mean ± SEM. Control cells were given culture media containing 0.1 % DMSO. After incubation for 12, 24, or 48 h, 20 ll of 5 mg/ml MTT was added to cells, and cells were incubated at 37 °C for another 4 h. The absorbance (A) was measured at 570 nm using an ELx800 automated microplate reader (BioTek Instruments, Inc.). The inhibitory ratio (%) was calculated using the following equation: inhibitory ratio = (1 average absorbance of treated group/average absorbance of control group) 9 100. IC50 was taken as the concentration that caused 50 % inhibition of cell viability and was calculated by the Logit method. Annexin V/PI staining Cells were harvested, washed and resuspended in PBS after LYG-202 treatment, then stained with the Annexin V/PI Cell Apoptosis Detection Kit (KeyGen Biotech, Nanjing, China) according to the manufacturer’s instructions. Data acquisition and analysis were performed with a Becton– Dickinson FACS Calibur flow cytometer using Cell-Quest software (BD Biosciences, Franklin Lakes, NJ). The cells in early stages of apoptosis were Annexin V positive and PI negative, whereas the cells in the late stages of apoptosis were both Annexin V and PI positive. Cell cycle analysis Cells were starved in serum-free medium for 24 h and then treated with LYG-202 in medium supplemented with normal serum for the indicated time periods. After that, cells were collected and fixed in 70 % ethanol overnight at 4 °C. Fixed cells were washed with PBS and resuspended in hypotonic PI staining solution (0.1 % (w/v) sodium citrate, 0.1 % (v/v) Triton X-100, 0.05 mg/ml PI, and 0.01 mg/ml RNase) for 15 min at 37 °C in the dark. The stained cells

123

The electrical potential difference across inner DWm was monitored using the DWm-specific fluorescent probe JC-1 (Beyotime Institute of Biotechnology, China) [22]. The DWm-specific fluorescent probe JC-1 (Beyotime Institute of Biotechnology, China) exists as a monomer with an emission at 530 nm (green fluorescence) at low membrane potential but forms J-aggregates with an emission at 590 nm (red fluorescence) at higher potentials. Cells were treated with LYG-202 for 12 h. Cells were harvested and incubated with JC-1 for 30 min at 37 °C in the dark. Relative fluorescence intensities were monitored using the flow cytometry (FACSCalibur, Becton–Dickinson) with settings of FL1 (green) at 530 nm and FL2 (red) 585 nm. Measurement of reactive oxygen species formation (ROS) The level of ROS was detected using fluorescent dye 2,7dichlorofluorescein-diacetate (DCFHDA, Beyotime Institute of Biotechnology, China) [23]. Levels of ROS was detected using fluorescent dye 2,7-dichlorofluorescein-diacetate (DCFHDA, Beyotime Institute of Biotechnology, China). Cells were pretreated with LYG-202 for 12 h. The cells were collected and incubated with DCFH-DA for 30 min at 37 °C in the dark. The fluorescence intensity was measured using flow cytometry (FACSCalibur, Becton– Dickinson). Preparation of whole cell lysates and cytosolic and nuclear extracts Cells were treated with LYG-202 at indicated concentrations for 12 h. The whole cell lysates was prepared as described [24]. Nuclear and cytosolic protein extracts were prepared using a Nuclear/Cytosol Fractionation Kit (BioVision, Mountain View, CA) according to the manufacturer’s protocol. The cytosolic and nuclear fractions was reserved for immunoblot analysis. Final detection was performed with western blots. Mitochondrial fractionation Mitochondrial fractionation kit (KeyGen Biotech, China) was used to get mitochondrial according to the following protocol. The cells were treated with different concentrations of LYG-202 for 12 h and incubated 3.5 9 107 cells per 1 ml ice-cold mitochondrial lyses Buffer, then

Apoptosis

suspended and ground the cells with tight pestle on ice. The homogenate was subjected to centrifuging at 8009g for 5 min at 4 °C to remove nuclei and unbroken cells, and then added 0.5 ml supernatant above the 0.5 ml Medium Buffer in the new 1.5 ml tube gently. After centrifugation at 15,0009g for 10 min at 4 °C, the supernatant was carefully removed and collected as the cytosolic fraction and the remaining mitochondrial pellet was resuspended in the mitochondrial extraction buffer. Western blot analysis The whole cell lysates, cytosolic extracts, nuclear extracts and mitochondrial extracts were prepared as described above. Western blot analysis was prepared as described previously [25]. Protein samples were separated by 10 % SDS-PAGE and transferred to onto nitrocellulose membranes. The membranes were blocked with 1 % BSA at 37 °C for 1 h and incubated with indicated antibodies overnight at 4 °C, followed by IRDye800 conjugated secondary antibody for 1 h at 37 °C. Immunoreactive protein was detected with an Odyssey Scanning System (LI-COR Inc., Lincoln, Nebraska). Electrophoretic mobility shift assays (EMSA) Preparation of nuclear extracts and electrophoretic mobility shift assay were conducted according to the manufacturer’s instructions (Beyotime EMSA Kit, NanJing, China [26]). MCF-7 cells were treated with 4, 8, 12 lM LYG-202 for 12 h. Nuclear extract preparation is described below. After 3 times washes with PBS, cells were lysed with buffer A (10 mM Hepes–KOH (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.5 % Nonidet P-40, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride), incubated on ice for 15 min and then centrifuged at 14,0009g for 15 min at 4 °C. The nuclear pellets were washed three times with buffer A and resuspended of the crude nuclei in high-salt buffer (20 mM Hepes, 0.5 M KCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, pH 7.9) for 30 min on ice and then centrifuged at 12,000 rpm for 15 min at 4 °C. The electrophoretic mobility shift assay was performed according to the manufacturer’s protocol (Beyotime Institute of Biotechnology, Haimen, China). 8 lg of nuclear extract protein and 1 lg of the NF-jB (50 AGTTGAGGGGACTTTCCCAGGC 30 and 30 0 TCAACTCCCCTGAAAGGGTCCG 5) consensus oligonucleotide (0.2 lL) probe labeled with biotin and terminal deoxynucleotidyl transferase was incubated in a total volume of 20 ll with binding buffer for 30 min at 25 °C. The DNA–protein complexes were resolved on a 6 % non-denaturing polyacrylamide gel in a 0.59 Tris– borate–EDTA buffer at 380 mA for 1 h and then

transferred to nylon membrane. The biotin-labeled DNA was detected by chemiluminescence using the Chemiluminescent EMSA Kit (Beyotime, China) and exposed to X-ray film. Immunofluorescence microscopy MCF-7 cells were pretreated with LYG-202 (12 lM), IGF1 (50 lM) and Wortmannin (50 nM) for 12 h and then harvested. Cells were fixed with 4 % paraformaldehyde in PBS, permeabilized with 0.5 % Triton X-100, and blocked with 3 % BSA for 1 h. Samples was incubated with primary antibodies (diluted 1:50) against NF-jB was done overnight at 4 °C. After washed, cells were exposed to FITC-conjugated secondary antibodies (1:1000, Invitrogen, Carlsbad, CA, USA, M30101, L42001). Samples were observed and captured with a confocal laser scanning microscope (Olympus Corp., Tokyo, Japan). Antitumor effects in nude mice Female BALB/c nude mice, 35–40 days old and weighing 18–22 g, were supplied by Shanghai Laboratory Animal Limited Company. The mice were maintained in a pathogen-free environment (23 ± 2 °C and 55 ± 5 % humidity) on a 12 h light–12 h dark cycle with food and water supplied ad libitum throughout the experimental period. Mice were subcutaneously inoculated with injections of 5 9 106 MCF-7 cells/nude mice. After 12–14 days, tumor sizes were determined using micrometer calipers, then nude mice with similar tumor volume (eliminate mice with tumors that are too large or too small) were randomly divided them into four groups (with 6 nude mice/group): one saline tumor control group; (i.v.) Wogonin 60 mg/kg/ 2 days group; (i.v.) LYG-202 20 mg/kg/2 days group; (i.v.) LYG-202 10 mg/kg/2 days group. At the end of 3 weeks, the nude mice was sacrificed, and the tumor xenografts were removed and measured. MCF-7 cells were described to be non-tumorigenic in nude mice unless exogenous estrogen is provided to the mice [27, 28]. All mice were intramuscular injected with exogenous estrogen one time 3 days before subcutaneously inoculation with dosage of 0.3 mg/kg and then were provided once per week until the end of experiment. Tumor volume (TV) was calculated using the following formula: TV (mm3) = d2 9 D/2, where d and D are the shortest and the longest diameters, respectively. This study was approved in SPF Animal Laboratory of China Pharmaceutical University. Relative tumor volume (RTV) was calculated according to the equation: RTV = Vt/V0, where V0 is the tumor volume at day 0 and Vt is the tumor volume at day t. And the evaluation index for inhibition was of relative tumor growth ratio T/C = TRTV/CRTV 9 100 %, where TRTV

123

Apoptosis

and CRTV represented RTV of treated and control groups, respectively. TUNEL assay Apoptosis induction in the tissue specimen was analyzed by TUNEL assay. It was performed as per instructions given in situ cell death kit. The slides were photographed with a confocal laser scanning microscope (Fluoview FV1000, Olympus, Tokyo, Japan). Immunohistochemistry The expression of Bax, Bcl-2, Cyclin D, p-Akt of the tissues of control and LYG-202 (20 mg/kg) groups was assessed by SP immunohistochemical method using a rabbit-anti-human monoclonal antibody and an Ultra-Sensitive SP kit (kit 9710 MAIXIN, Fuzhou, Fujian). Tissue Sections (4 mm thick) were placed onto treated slides (Vectabond, Vector Laboratories, Burlingame, CA). Sections were heat fixed, deparaffinized and rehydrated through graded alcohols (100, 95, 85, 75 %) to distilled water. Tissue sections were boiled in citrate buffer at high temperature for antigen retrieval, and treated with 3 % hydrogen peroxide to block endogenous peroxidase activity. The slides were incubated with a protein-blocking agent (kit 9710 MAIXIN, Fuzhou, Fujian) prior to the application of the primary antibody, and then incubated with the primary antibody at 4 °C overnight. The tissues were then incubated with the secondary biotinylated antispecies antibody and labeled using a modification of the avidin–biotin complex immunoperoxidase staining procedure according to the UltraSensitive SP kit manual. Counterstaining was done with Harris hematoxylin. All reagents were supplied by MaixinBio Co. (Fuzhou, China). Statistical analysis All data in different experimental groups were expressed as mean ± SEM. Data shown in the study were obtained from at least three independent experiments. Statistical analyses were performed using an unpaired, two-tailed Student’s t test. All comparisons were made relative to untreated controls and significance of difference is indicated as *p \ 0.05 and **p \ 0.01.

Results LYG-202 inhibited cells viability in human breast cancer cells In vitro, we examined the effect of LYG-202 on cell viability at different concentrations and different time. At 12,

123

24 and 48 h after treatment of LYG-202 with increasing concentrations at each time point, cell viability was assessed using MCF-7, MDA-MB-231 and MDA-MB-435 cells. The IC50 (the concentration of drug inhibiting 50 % of cells) values of 12 h were 10.75 ± 0.95, 14.17 ± 0.84, 17.69 ± 0.54 lM, respectively (Fig. 1b). Among these breast cancer cells, MCF-7 cells were more susceptible to LYG-202. Therefore, we performed the following experiments mainly with MCF-7 cells. We chose LYG-202 treatment concentrations at 4, 8, 12 lM for 12 h in our following studies. Significantly, LYG-202 had higher inhibitory rate on MCF-7 cells than Wogonin at the same concentration (Fig. 1b, c). As shown in Fig. 1d, MCF-7 cells became round and broke into fragments after treatment with various concentrations of LYG-202. The degree of sloughing of cells was positively correlated with drug concentrations. LYG-202 induced apoptosis in human breast cancer cells To test if LYG-202 induces apoptosis in MCF-7 cells, DAPI staining assay were used. LYG-202-treated cells presented morphological features of early apoptosis, such as bright nuclear condensation and DNA-fragmentation. It appeared more frequently with increasing concentrations of LYG-202 (Fig. 2a). Subsequently, Annexin V/PI staining assay was used to confirm these findings. As shown in Fig. 2b, after treatment with 4, 8, and 12 lM LYG-202 for 12 h, the percentage of apoptotic cells increased from 3.29 to 9.14, 34.84 and 58.81 %, respectively in MCF-7 cells. Additionally, in MDA-MB-231 and MDA-MB-435 cells the percentage of apoptotic cells increased after treatment with 4, 8 and 12 lM LYG-202 for 12 h (Fig. 2b). These findings indicated that LYG-202 might exhibit the antitumor activity by inducing apoptosis. To confirm the LYG-202-induced apoptosis, the apoptosis related proteins such as Bax, Bcl-2, Bcl-xL, Caspase-9, Caspase-8, Caspase-3 and PARP were investigated by western blots (Fig. 2c). After treatment with LYG-202 for 12 h, the expression of the proapoptotic protein Bax increased while the anti-apoptotic proteins Bcl-2 and Bcl-xL decreased in a concentrationdependent manner. Thus, the ratio of Bax/Bcl-2, which was crucial for the activation of the mitochondrial apoptotic pathway, was increased with different concentrations of LYG-202 (Fig. 2d). Furthermore, LYG-202 treatment activated Caspase-9, Caspase-3 and PARP cleavage. However, pro-caspase-8 protein did not change after LYG-202 treatment (Fig. 2c). All these data demonstrated that LYG-202 induced breast cancer cells apoptosis in vitro probably through the mitochondrial apoptotic pathway.

Apoptosis Fig. 2 Effects of LYG-202 on apoptosis and the apoptotic relating-proteins in human breast cancer cells. a MCF-7 cells were exposed to LYG-202 (4, 8 and 12 lM) for 12 h. DAPI (9400) staining was used to detect the apoptosis. b The pro-apoptotic effects of LYG202 in MCF-7, MDA-MB-231 and MDA-MB-435 cells were measured by Annexin-V/PI double-staining assay. c, d The levels of apoptosis-related proteins, including Bax, Bcl-2, Bcl-2, caspase 9, pro-caspase 8, caspase 3 and PARP, in MCF-7, MDA-MB-231 and MDA-MB435 cells were detected by western blot assay. *p \ 0.05 and **p \ 0.01 compared with control, n = 3

123

Apoptosis

LYG-202 induced the mitochondrial dysfunction in human breast cancer cells To elucidate the mechanisms of LYG-202 on apoptosis, we further investigated the effect of LYG-202 on mitochondrial function which was essential for cell survival. The change of mitochondrial membrane potential is a marker for mitochondrial dysfunction in early stage of apoptosis. Consequently, we used a fluorogenic probe JC-1 to detect the decline of mitochondrial membrane potential of human breast cancer cells after LYG-202 treatment. As shown in Fig. 3a, LYG-202 decreased JC-1 polymer and increased JC-1 monomer in a concentration-dependent manner (Fig. 3a). In addition, LYG-202 induced release of Cyt c from the mitochondria to the cytosol in a concentrationdependent manner (Fig. 3b). In the process of apoptosis induction, AIF translocation from mitochondria to the nucleus may lead to DNA fragmentation and chromatin condensation [29]. As shown in Fig. 3b, LYG-202 modulated the translocation of AIF from mitochondria to the nucleus. It provided further evidence that LYG-202 induced apoptosis in human breast cancer cells by facilitating mitochondrial dysfunction. ROS were involved in cellular apoptosis induced by LYG-202 It has been reported that oxidative stress is an important factor causing mitochondrial dysfunction, which leads to excessive generation of ROS and the imbalance of oxidation system and antioxidation system [30]. To elucidate the underlying mechanisms of LYG-202 on mitochondrial dysfunction in MCF-7 cells, we examined the effect of LYG-202 on ROS generation. Our results showed that the generation of ROS increased rapidly in MCF-7, MDA-MB231 and MDA-MB-435 cells after exposure to LYG-202 (Fig. 4a–c). In the presence of 10 mM of NAC, an antioxidant inhibiting ROS generation, the proportion of apoptotic cells after LYG-202 treatment was changed from 48.91 to 8.86 % in MCF-7 cells (Fig. 4d, e). These results suggest that excessive generation of ROS might play an important role in LYG-202-induced apoptosis. LYG-202 induced G1/S phase cell cycle arrest in human breast cancer cells In addition to apoptosis, cell cycle arrest can also inhibit tumor growth [31]. To examine whether the growth inhibitory effect of LYG-202 on human breast cancer cells was due to cell cycle arrest, we performed cell cycle analysis by PI staining. As shown in Fig. 5a–c, treatment with LYG202 induced G1/S cell cycle arrest in MCF-7, MDA-MB231 and MDA-MB-435 cells in a concentration-dependent

123

manner. To explore the potential mechanism of G1/S cell arrest induced by LYG-202, we analyzed the cell cycle regulatory proteins by western blots. As shown in Fig. 5d–f, the levels of Cyclin D, CDK4 were markedly decreased by varying degrees and the expression of p21Waf1/Cip1 was dramatically elevated after LYG-202 treatment. These data suggest that LYG-202 might inhibit cell viability of MCF7, MDA-MB-231 and MDA-MB-435 cells via inducing G1 phase cell arrest. LYG-202 regulated PI3K/Akt signaling pathway in breast cancer cells Since PI3K/Akt signaling pathway plays a crucial role in cancer progression, we investigated whether PI3K/Akt signaling pathway is implicated in the antitumor mechanism of LYG-202. Western blot analysis showed that in MCF-7, MDA-MB-231 and MDA-MB-435 cells, PI3K and phosphorylated Akt decreased after LYG-202 treatment for 12 h. However, the Akt protein remained constant during the course of LYG-202 treatment (Fig. 6a). Our results indicated that LYG-202 could regulate PI3K/Akt signaling pathway. As a pro-apoptotic factor, the Bcl-2 related protein Bad has been shown to dimerize with the anti-apoptotic proteins Bcl-2 and Bcl-xL. Previous studies suggested that phosphorylated Akt phosphorylates Bad and blocks the Badinduced apoptosis [32]. Accordingly, we further investigated the pro-apoptotic effect of LYG-202 on p-Bad expression in human breast cancer cells. The results showed that LYG-202 decreased p-Bad expression in a concentration-dependent manner (Fig. 6b), suggesting that LYG-202 exerts a pro-apoptotic effect on MCF-7, MDAMB-231 and MDA-MB-435 cells by inhibiting p-Bad expression. Early studies have shown that NF-jB is activated by PI3K/Akt signaling pathway, and the activated NF-jB promotes Cyclin D and Bcl-xL expression [16, 17]. Here we investigated the activation of NF-jB in human breast cancer cells after LYG-202 treatment. The results showed that LYG-202 could decrease the nuclear expression of NFjB in a concentration-dependent manner (Fig. 6c). Additionally, LYG-202 suppressed NF-jB DNA-binding activity (Fig. 6d). According to these data, we hypothesized that LYG-202 might exert its pro-apoptotic effect on MCF-7, MDA-MB-231 and MDA-MB-435 cells by suppressing PI3K/Akt signaling pathway. LYG-202-induced apoptosis and cell cycle arrest via modulating PI3K/Akt signaling pathway To determine whether LYG-202-induced apoptosis and cell cycle arrest were related to PI3K/Akt signaling pathway,

Apoptosis

Fig. 3 Effects of LYG-202 on the mitochondrial function in human breast cancer cells. MCF-7, MDA-MB-231 and MDA-MB-435 cells were exposed to LYG-202 (4, 8 and 12 lM) for 12 h. The change of DWm was detected by confocal laser scanning microscope. The green fluorescence represented JC-1 monomer and red fluorescence

represented JC-1J-aggregates. a The percentage of DWm decreased cells using flow cytometric analysis. b The release of Cyt c from mitochondria into cytoplasm and the translocation of AIF from mitochondria to nuclei were measured by western blot assay (Color figure online)

123

Apoptosis Fig. 4 Generation of ROS was involved in cellular apoptosis induced by LYG-202 in human breast cancer cells. Intracellular ROS levels was measured by flow cytometry after treatment of 4, 8, 12 lM LYG-202 for 12 h in MCF-7 (a), MDA-MB231 (b) and MDA-MB-435 (c) cells. d, e Cellular apoptosis was determined in the presence of 10 mM NAC. **p \ 0.01 compared with control, ## p \ 0.01 compared with LYG-202 (12 lM) treated group, n = 3

123

Apoptosis

Fig. 5 Effects of LYG-202 on cell cycle arrest and the arrest relatingproteins in human breast cancer cells. Cell cycle distribution was monitored by flow cytometry. PI staining assay were measured after treatment with 4, 8, 12 lM LYG-202 for 12 h in MCF-7 (a), MDA-

MB-231 (b) and MDA-MB-435 (c) cells. Expression of cell cycle arrest-related proteins Cyclin D, CDK 4 and p21Waf1/Cip1 in MCF-7 (d), MDA-MB-231 (e) and MDA-MB-435 (f) cells treated with LYG202 were detected by western blots

the effect of IGF-1, a PI3K activator was evaluated in MCF-7 cells. It has been documented that IGF-1 contributes to cardiac hypertrophy via activation of PI3K/Akt signaling [33]. As shown in Fig. 7a, b, treatment of 12 lM LYG-202 decreased the expression of PI3K and p-Akt. The effect of LYG-202 was reversed by the treatment with 50 lM IGF-1. Furthermore, immunofluorescence analysis

showed that 12 lM LYG-202 prevented nuclear translocation of NF-jB, while this effect was also withdrawn by IGF-1 (Fig. 7c). Flow cytometry analysis showed that the combination treatment of LYG-202 and IGF-1 inhibited the pro-apoptotic effect of LYG-202 (Fig. 7d). There was also an obviously antagonistic action of IGF-1 against LYG-202 on the G1 cell cycle arrest (Fig. 7e). To further

123

Apoptosis

Fig. 6 Effects of LYG-202 on PI3K/Akt signaling pathway and the relating-proteins in human breast cancer cells. a The levels of PI3K/ Akt signaling pathway related proteins including PI3K, Akt, p-Akt in MCF-7, MDA-MB-231 and MDA-MB-435 cells after 4, 8 and 12 lM LYG-202 treatment for 12 h were assessed by western blot. b Western blot analyzed Bad and p-Bad levels in MCF-7, MDAMB-231 and MDA-MB-435 cells after 4, 8 and 12 lM LYG-202

123

treatment for 12 h. c The translocation of NF-jB from cytoplasm to nuclei in MCF-7, MDA-MB-231 and MDA-MB-435 cells after 4, 8 and 12 lM LYG-202 treatment for 12 h was detected by western blot assay. d NF-jB DNA binding activity was detected by EMSA assay in MCF-7, MDA-MB-231 and MDA-MB-435 cells treated with 4, 8 and 12 lM LYG-202 for 12 h

Apoptosis

Fig. 7 PI3K/Akt signaling pathway was involved in apoptosis and cell cycle arrest induced by LYG-202. a, b PI3K, Akt, p-Akt were detected by western blot, pretreated with 50 lM IGF-1, 12 lM LYG202, 50 nM Wortmannin for 12 h. c The nuclear translocation of NFjB, treated with 50 lM IGF-1, 12 lM LYG-202, 50 nM Wortmannin, was detected by Immunofluorescence staining (Image magnification: 9400). d Annexin-V/PI staining assay and e PI staining assay were measured by flow cytometry after treatment with 50 lM IGF-1,

12 lM LYG-202 for 12 h. f, g Levels of Cyclin D, Bcl-xL, Bax, Bcl2 were assessed by western blot assay after 50 lM IGF-1, 12 lM LYG-202, 50 nM Wortmannin treatment for 12 h. h, i Annexin-V/PI staining assay was measured by flow cytometry after treatment with 12 lM LYG-202, 50 lM z-LEHD-fmk, 50 lM z-IETD-fmk, 50 lM z-DEVD-fmk and 50 nM Wortmannin for 12 h. *p \ 0.05 and **p \ 0.01 compared with control, #p \ 0.05 and ##p \ 0.01 compared with LYG-202 (12 lM) treated group, n = 3

confirm whether PI3K/Akt signaling pathway was involved in regulating apoptosis and cell cycle arrest after LYG-202 treatment, we examined the effect of IGF-1 on the Cyclin D, Bcl-xL, Bax and Bcl-2 expression. Our results showed that the protein expression of Cyclin D, Bcl-xL, Bax and Bcl-2 were regulated by LYG-202 correspondingly. After treatment with 50 lM IGF-1, these effects from LYG-202 were reversed (Fig. 7f, g). Furthermore, we added caspase inhibitor to study if LYG-202-mediated apoptosis was dependent on caspases. As shown in Fig. 7h, 50 lM

z-LEHD-fmk and 50 lM z-DEVD-fmk can reverse LYG202-mediated apoptosis. These results indicate that LYG202 induced apoptosis was dependent on caspase-9 and caspase-3. The flow cytometry analysis showed that the combination treatment of LYG-202 and Wortmannin, a PI3K/Akt signaling pathway inhibitor, could not further enhance the apoptotic effect of LYG-202 (Fig. 7i). In conclusion, PI3K/Akt pathway may participate in the regulation of LYG-202-induced apoptosis and cell cycle arrest.

123

Apoptosis

LYG-202 inhibited tumor growth in xenograft mice bearing MCF-7 tumor A xenograft model transplanted with MCF-7 tumor was used to evaluate the antitumor effect of LYG-202 in vivo. The tumor volume measurement further confirmed the significant inhibitory effect of LYG-202 on tumor growth. After 21 days treatment, LYG-202 (10 and 20 mg/kg) showed dramatically inhibitory effects on the tumor growth of inoculated MCF-7 in nude mice and was much better than Wogonin-treated group (Fig. 8a). Moreover, the tumor weight of LYG-202-treated mice was smaller than the control group (Fig. 8b). The inhibitory rates of treatment groups (Wogonin, 10 and 20 mg/kg LYG-202) were 52.33, 56.81 and 64.16 %, correspondingly (Table 1). The tumor size was also visually smaller in treatment group (Fig. 8c). TUNEL assay performed to detect apoptotic cells in tumor tissues showed that LYG-202 induced DNA damage of tumor tissues. Moreover, immunohistochemical analysis revealed that Bcl-2, Cyclin D and p-Akt expression was decreased and Bax expression was increased after LYG-202 treatment (Fig. 8d–f). Finally, we recorded and evaluated body weights of mice in all groups. We found that there was no significant difference in the average body weight of LYG-202 treated mice compared with the control group (Fig. 8g). Collectively, all these results suggest that LYG-202 exerts its anti-tumor effect via apoptosis induction in vivo.

Discussion As a considerably valuable source for novel chemotherapeutic agents, the traditional Chinese medicine products remain one of the best reservoirs of new molecules [34, 35]. LYG-202, a new flavonoid with a piperazine substitution, which shares the structural similarity with Wogonin, has an antitumor activity in a dose-dependent manner in vivo [36, 37]. In the present study, we demonstrated that LYG-202 exerts the antitumor effect by inducing apoptosis and G1/S cell cycle arrest in human breast cancer cells. Mechanistically, LYG-202 induced apoptosis in MCF-7, MDA-MB-231 and MDA-MB-435 cells mainly through the mitochondrial apoptotic pathway, releasing Cyt c, reducing the mitochondrial membrane potential and the excessive generation of intracellular ROS. However, accumulation of ROS does not kill cells directly, it triggers an apoptotic signaling programme that leads to cell death [38]. It has been reported that excessive generation of ROS could oxidize the mitochondrial pores and disrupt the mitochondrial membrane potential leading to cytochrome c release [39]. Moreover, the pro-apoptotic member of the Bcl-2 family, Bax can directly cause mitochondria to

123

Fig. 8 Effects of LYG-202 on the tumorigenicity of MCF-7 cells c in vivo. a Tumor volume of control, Wogonin, LYG-202 treatment groups were measured and calculated once every 3 days. b Weight of tumor in control, Wogonin, LYG-202 treatment groups. *p \ 0.05 and **p \ 0.01 compared with control, n = 3. c Excised human breast tumor images from the experimental. d–f DNA damage and Bax, Bcl-2, Cyclin D, p-Akt expression were detected by TUNEL assay (9200) and immunohistochemistry (940) in tumor xenograft tissues. g Body weight was measured every 3 days

release cytochrome c for its ability to form ion channels indicating that it can open pores in the outer mitochondrial membrane, allowing the exit of cytochrome c [40]. Subsequently, release of cytochrome c activates caspase-9 and caspase-3 then triggers cleavage of PARP, which finally induced apoptosis [41, 42]. In this case, our study documented that ROS was involved in cellular apoptosis induced by LYG-202, whereas addition of NAC improved the cell viability, which indicated that LYG-202 might induce apoptosis in a ROS-dependent manner (Fig. 4d, e). Nowadays, cell cycle arrest in cancer cells has become a major indicator of anticancer effects [43]. Consequently, cell cycle progression is mostly targeted for novel therapies. Cell cycle is regulated by a family of protein kinase complexes, including CDKs and cyclins, in eukaryotic cells [44, 45]. The previous study has reported that the reduced activities of CDK 4 and Cyclin D are the hallmarks of cell cycle arrest at the G1/S phase [46]. In this study, we found that LYG-202 exerts a strong antitumor activity on the G1/S phase cell cycle arrest, by down-regulating CDK 4, Cyclin D expression and up-regulation the cyclin dependent kinase inhibitors p21Waf1/Cip1 (Fig. 5). Previous studies have suggested that accumulation of ROS promotes p21Waf1/Cip1 expression [47]. Therefore, our findings suggest that LYG-202 may induce G1/S phase cell cycle arrest via excessive generation of ROS. Breast cancer is one of the estrogen-dependent malignant tumors, the proliferation of which is regulated by estrogen through PI3K/Akt signaling pathway [48]. Therefore, PI3K/Akt pathway is frequently over-activated in human breast cancer cells and is believed to contribute to their aggressive phenotype and resistance to chemotherapy [49]. p-Akt phosphorylates a pro-apoptotic protein Bad at serine 136 sequestering it from its effector molecules and p21Waf1/Cip1 to enhance cell proliferation [32, 50]. On the other hand, p-Akt indirectly activates NFjB to promote anti-apoptotic protein Bcl-xL and cell cycle progression regulatory protein Cyclin D via the phosphorylation of IKK [14]. Our previous data suggested that generation of ROS seemed to be the main mechanism of apoptosis and G1/S phase cell cycle arrest induced by LYG-202. In the following study, we found that LYG-202 reduced the protein expression of p-Akt in MCF-7, MDA-

Apoptosis

123

Apoptosis Table 1 Inhibitory activity of LYG-202 against MCF-7 breast cancer xenograft tumor Groups

Dose (mg/ml)

Inhibitory rate (%)

Wogonin

60

52.33**

LYG-202

10

56.81**

20

64.16**

Each data point represents the mean SD of six mice ** P \ 0.01 versus control group

MB-231 and MDA-MB-435 cells in a concentration-dependent manner, while the total Akt protein levels remained constant (Fig. 6a). In agreement, our findings showed that p-Bad expression was decreased after LYG202 treatment (Fig. 6b). Thus, Akt might also be implicated in LYG-202-induced apoptosis and G1/S phase cell cycle arrest. Additionally, LYG-202 prevented NF-jB translocation into the nucleus and suppressed NF-jB DNAbinding activity (Fig. 6c, d). Nevertheless, the antitumor effect of LYG-202 was antagonistic after the addition of IGF-1, a PI3K activator (Fig. 7). These results illustrated that LYG-202 may exert its antitumor effect via modulating PI3K/Akt pathway. Consistent with the results in vitro, LYG-202 also induced tumor apoptosis in vivo based on TUNEL and Immunohistochemical analysis (Fig. 8d–f). In summary, the current study demonstrates that LYG202 exerts strong antitumor activity both in vitro and in vivo based on the potential molecular mechanisms of apoptosis induction and cell cycle arrest through PI3K/Akt pathway. Therefore, our study indicates that LYG-202 might be a promising therapeutic agent against human breast cancer. Acknowledgments This work was supported by the Fundamental Research Funds for the Central Universities (No. JKY2011051), the National Natural Science Foundation of China (No. 21072232), the Project Program of State Key Laboratory of Natural Medicines, China Pharmaceutical University (No. JKGZ201101), the National Science & Technology Major Project (No. 2012ZX09304-001) and Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT-IRT1193). Conflict of interests peting interests.

The authors declare that they have no com-

References 1. Luo M, Guan JL (2010) Focal adhesion kinase: a prominent determinant in breast cancer initiation, progression and metastasis. Cancer Lett 289:127–139 2. Lin CC, Kuo CL, Lee MH et al (2011) Wogonin triggers apoptosis in human osteosarcoma U-2 OS cells through the endoplasmic reticulum stress, mitochondrial dysfunction and caspase3-dependent signaling pathways. Int J Oncol 39:217–224

123

3. Crompton M, Virji S, Doyle V, Johnson N, Ward JM (1999) The mitochondrial permeability transition pore. Biochem Soc Symp 66:167–179 4. Fleury C, Mignotte B, Vayssiere JL (2002) Mitochondrial reactive oxygen species in cell death signaling. Biochimie 84:131–141 5. Thannickal VJ, Fanburg BL (2000) Reactive oxygen species in cell signaling. Am J Physiol Lung Cell Mol Physiol 279:L1005–L1028 6. Cory S, Huang DC, Adams JM (2003) The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22:8590–8607 7. Johansson M, Persson JL (2008) Cancer therapy: targeting cell cycle regulators. Anti-Cancer Agents Med Chem 8:723–731 8. Boonstra J, Post JA (2004) Molecular events associated with reactive oxygen species and cell cycle progression in mammalian cells. Gene 337:1–13 9. Sheppard K, Kinross KM, Solomon B, Pearson RB, Phillips WA (2012) Targeting PI3 kinase/AKT/mTOR signaling in cancer. Crit Rev Oncol 17:69–95 10. Vivanco I, Sawyers CL (2002) The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer 2:489–501 11. Yang E, Zha J, Jockel J, Boise LH, Thompson CB, Korsmeyer SJ (1995) Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80:285–291 12. Datta SR, Dudek H, Tao X et al (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231–241 13. Datta SR, Katsov A, Hu L et al (2000) 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell 6:41–51 14. Ozes ON, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer LM, Donner DB (1999) NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 401:82–85 15. Romashkova JA, Makarov SS (1999) NF-kappaB is a target of AKT in anti-apoptotic PDGF signalling. Nature 401:86–90 16. Karin M (2006) Nuclear factor-kappaB in cancer development and progression. Nature 441:431–436 17. Karin M, Greten FR (2005) NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol 5:749–759 18. Yang L, Wang Q, Li D et al (2013) Wogonin enhances antitumor activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo through ROS-mediated downregulation of cFLIPL and IAP proteins. Apoptosis 18:618–626 19. Lucas CD, Allen KC, Dorward DA et al (2013) Flavones induce neutrophil apoptosis by down-regulation of Mcl-1 via a proteasomal-dependent pathway. FASEB J 27:1084–1094 20. Zeng S, Liu W, Nie FF et al (2009) LYG-202, a new flavonoid with a piperazine substitution, shows antitumor effects in vivo and in vitro. Biochem Biophys Res Commun 385:551–556 21. Liu W, Dai Q, Lu N et al (2011) LYG-202 inhibits the proliferation of human colorectal carcinoma HCT-116 cells through induction of G1/S cell cycle arrest and apoptosis via p53 and p21(WAF1/Cip1) expression. Biochem Cell Biol 89:287–298 22. Tao L, Fu R, Wang X et al (2014) LL-202, a newly synthesized flavonoid, inhibits tumor growth via inducing G(2)/M phase arrest and cell apoptosis in MCF-7 human breast cancer cells in vitro and in vivo. Toxicol Lett 228:1–12 23. Pan D, Li W, Miao H et al (2014) LW-214, a newly synthesized flavonoid, induces intrinsic apoptosis pathway by down-regulating Trx-1 in MCF-7 human breast cells. Biochem Pharmacol 87:598–610 24. Qiang L, Yang Y, You QD et al (2008) Inhibition of glioblastoma growth and angiogenesis by gambogic acid: an in vitro and in vivo study. Biochem Pharmacol 75:1083–1092 25. Chen Y, Lu N, Ling Y et al (2010) LYG-202, a newly synthesized flavonoid, exhibits potent anti-angiogenic activity in vitro and in vivo. J Pharm Sci 112:37–45

Apoptosis 26. Huang C, Cao J, Huang KJ et al (2006) Inhibition of STAT3 activity with AG490 decreases the invasion of human pancreatic cancer cells in vitro. Cancer Sci 97:1417–1423 27. Clarke R, Dickson RB, Brunner N (1990) The process of malignant progression in human breast cancer. Ann Oncol 1:401–407 28. Soule HD, McGrath CM (1980) Estrogen responsive proliferation of clonal human breast carcinoma cells in athymic mice. Cancer Lett 10:177–189 29. Zhang X, Chen J, Graham SH et al (2002) Intranuclear localization of apoptosis-inducing factor (AIF) and large scale DNA fragmentation after traumatic brain injury in rats and in neuronal cultures exposed to peroxynitrite. J Neurochem 82:181–191 30. Das A, Gopalakrishnan B, Voss OH, Doseff AI, Villamena FA (2012) Inhibition of ROS-induced apoptosis in endothelial cells by nitrone spin traps via induction of phase II enzymes and suppression of mitochondria-dependent pro-apoptotic signaling. Biochem Pharmacol 84:486–497 31. Qiu P, Guan H, Dong P et al (2011) The p53-, Bax- and p21dependent inhibition of colon cancer cell growth by 5-hydroxy polymethoxyflavones. Mol Nutr Food Res 55:613–622 32. She QB, Solit DB, Ye Q, O’Reilly KE, Lobo J, Rosen N (2005) The BAD protein integrates survival signaling by EGFR/MAPK and PI3K/Akt kinase pathways in PTEN-deficient tumor cells. Cancer Cell 8:287–297 33. Millis RM, Alvin ZV, Zhao A, Haddad GE (2012) Effects of IGF1 on I(K) and I(K1) channels via PI3K/Akt signaling in neonatal cardiac myocytes. Int J Cell Biol 2012:712153 34. Gottlob K, Majewski N, Kennedy S, Kandel E, Robey RB, Hay N (2001) Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev 15:1406–1418 35. Yun J, Lv YG, Yao Q, Wang L, Li YP, Yi J (2012) Wortmannin inhibits proliferation and induces apoptosis of MCF-7 breast cancer cells. Eur J Gynaecol Oncol 33:367–369 36. Chen CY, Hsu YL, Chen YY, Hung JY, Huang MS, Kuo PL (2007) Isokotomolide A, a new butanolide extracted from the leaves of Cinnamomum kotoense, arrests cell cycle progression and induces apoptosis through the induction of p53/p21 and the initiation of mitochondrial system in human non-small cell lung cancer A549 cells. Eur J Pharmacol 574:94–102 37. Newman DJ, Cragg GM, Snader KM (2003) Natural products as sources of new drugs over the period 1981–2002. J Nat Prod 66:1022–1037

38. Gabai VL, Meriin AB, Yaglom JA, Volloch VZ, Sherman MY (1998) Role of Hsp70 in regulation of stress-kinase JNK: implications in apoptosis and aging. FEBS Lett 438:1–4 39. Zamzami N, Marchetti P, Castedo M et al (1995) Sequential reduction of mitochondrial transmembrane potential and generation of reactive oxygen species in early programmed cell death. J Exp Med 182:367–377 40. Antonsson B, Conti F, Ciavatta A et al (1997) Inhibition of Bax channel-forming activity by Bcl-2. Science 277:370–372 41. Indran IR, Tufo G, Pervaiz S, Brenner C (2011) Recent advances in apoptosis, mitochondria and drug resistance in cancer cells. Biochim Biophys Acta 1807:735–745 42. Stridh H, Kimland M, Jones DP, Orrenius S, Hampton MB (1998) Cytochrome c release and caspase activation in hydrogen peroxide- and tributyltin-induced apoptosis. FEBS Lett 429:351–355 43. Yang L, Zhang HW, Hu R et al (2009) Wogonin induces G1 phase arrest through inhibiting Cdk4 and cyclin D1 concomitant with an elevation in p21Cip1 in human cervical carcinoma HeLa cells. Biochem Cell Biol 87:933–942 44. Gupta S (2001) Molecular steps of death receptor and mitochondrial pathways of apoptosis. Life Sci 69:2957–2964 45. Malumbres M (2005) Revisiting the ‘‘Cdk-centric’’ view of the mammalian cell cycle. Cell Cycle 4:206–210 46. Liu DX, Greene LA (2001) Neuronal apoptosis at the G1/S cell cycle checkpoint. Cell Tissue Res 305:217–228 47. Yu SM, Kim SJ (2014) Withaferin A-caused production of intracellular reactive oxygen species modulates apoptosis via PI3K/Akt and JNKinase in rabbit articular chondrocytes. J Korean Med Sci 29:1042–1053 48. Kaufmann M, Jonat W, Hilfrich J et al (2007) Improved overall survival in postmenopausal women with early breast cancer after anastrozole initiated after treatment with tamoxifen compared with continued tamoxifen: the ARNO 95 Study. J Clin Oncol 25:2664–2670 49. Staal SP (1987) Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKT1 in a primary human gastric adenocarcinoma. Proc Natl Acad Sci USA 84:5034–5037 50. Zhou BP, Hung MC (2002) Novel targets of Akt, p21(Cipl/ WAF1), and MDM2. Semin Oncol 29:62–70

123