Plant Molecular Biology 16: 999-1007, 1991. © 1991 Kluwer Academic Publishers. Printed in Belgium.

999

Alfalfa heat shock genes are differentially expressed during somatic embryogenesis Jfinos GyOrgyey ~, Anton Gartner 2, Kinga N6meth 1, Zoltfin Magyar ~, Heribert Hirt 2, Erwin Heberle-Bors 2 and D6nes Dudits ~* Institute of Plant Physiology, Institute of Genetics, Biological Research Center, Hungarian Academy of Sciences, 6701 Szeged, P.O. Box 521, Hungary (* author for correspondence); 2Institute of Microbiology and Genetics, University of Vienna, Althanstrasse 14, A-1090 Vienna, Austria Received 6 November 1990; accepted in revised form 8 February 1991

Key words: Medicago sativa L., stress response, tissue culture, somatic embryogenesis, heat shock protein (HSP)

Abstract We have isolated two cDNA clones (Mshspl8-1; Mshspl8-2) from alfalfa (Medicago sativa L.) which encode for small heat shock proteins (HSPs) belonging to the hspl7 subfamily. The predicted amino acid sequences of the two alfalfa proteins are 92 ~o identical and a similar degree of homology (90 ~o) can be detected between Mshspl8-2 and the pea hspl7. In comparison to various members of small HSPs from soybean amino acid sequence similarities of 80-86~o were identified. The alfalfa HSPs share a homologous stretch of amino acids in the carboxy terminal region with hsp22, 23, 26 from Drosophila. This region contains the GVLTV motif which is characteristic of several members of small HSPs. At room temperature alfalfa hspl8 mRNAs were not detectable in root and leaf tissues but northern analysis showed a low level of expression in microcallus suspension (MCS). The transcription of Mshsp 18 genes is induced by elevated temperature, CdCI 2 treatment and osmotic shock in cultured cells. In alfalfa somatic embryos derived from MCS a considerable amount ofhspl8 mRNA can be detected during the early embryogenic stages under normal culture conditions. The differential expression of these genes during embryo development suggests a specific functional role for HSPs in plant cells at the time of the developmental switch in vitro.

Introduction All organisms including higher plants possess a set of stress-responsive genes that code for proteins with protective functions against damages imposed by various types of environmental stress such as elevated temperature. Synthesis of heatshock proteins (HSPs) ranging in size from 15 to 110 kDa has been shown in tissues from various plant species [25]. Several members of various

plant heat shock gene families have been cloned and structurally characterized [20]. Sequence analysis indicated conservation of genes encoding the high-molecular-weight hsp70 polypeptides from plants and other eukaryotes [29]. Furthermore, multigene families are responsible for the synthesis of the relatively high abundance and distinct variants of low-molecular-weight HSPs

[ 17, 19]. An increasing amount of evidence suggests that

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers X58710 and X58711.

1000 in addition to the defense function during thermal shock, the HSPs have an important function in cell proliferation and differentiation (for review see [3]). Both the expression of HSPs in the absence of heat shock and the altered response to high temperature at different developmental stages indicate a possible involvement of H SPs in normal development. The mRNAs for hsp83, hsp28 and hsp26 were found in mature ovaries and in embryos of Drosophila melanogaster [30]. Furthermore, these studies showed that the hsp26, hsp23 and hsp22 mRNAs were present in unshocked early embryos. HSP23 was detected in imaginal wing discs and in larvae at the late third-instar stage of development [5]. Mason et al. [18] also reported the expression of hsp26 and hsp27 mRNAs in Drosophila non-heatshocked embryos. In Xenopus oocytes, the transcript of the hsp70 gene is similarly abundant and appears without heatshock [2]. At the early twocell stage of post-fertilization development of mouse embryos accumulation of HSP68 and HSP70 was observed [ 1]. During nitrogen deprivation induced sporulation of yeast, the expression of hsp26 and hsp84 is induced specifically [15]. Although the heat-shock response has been characterized extensively in different plants, only limited information is available concerning the possible role of HSPs in plant differentiation. Howarth [12] showed the synthesis of HSP72 and HSP83 during the first 24 hours after imbibition of germinating sorghum seeds at normal temperature. An altered heat-shock response was also observed in carrot cell suspension cultures during formation of somatic embryos [21, 31 ]. In this report we present the nucleotide and predicted amino acid sequence analysis of two alfalfa cDNA clones (Mshspl8-1, Mshspl8-2) related to the gene family that codes for proteins belonging to the hsp20 group. In addition to a typical stress induction by heat or CdC12 in treated cells we show the expression of Mshspl8 genes at various stages of somatic embryogenesis under normal culture conditions.

Material and methods

Plant tissue culture techniques Callus cultures were initiated from petioles of vegetatively propagated Medicago sativa plants of genotype RA3 [27] on agar-solidified SH medium [23] supplemented with 25/~M ~-naphthaleneacetic acid (NAA) and 10 #M kinetin (KIN) and transferred monthly. Liquid culture from this callus tissue forming microcallus suspension (MCS) was established in SH medium containing 15/~M NAA and 10 #M KIN and subcultured twice a week. In MCS the dedifferentiated cells were grown as unorganized proliferating clusters up to 3 mm in diameter. The differentiation of somatic embryos was induced by transfer of the MCS into new medium including 100 #M 2,4-dichlorophenoxyacetic acid (2,4-D) instead of 15 #M NAA for 1 hour. Subsequently the cells were washed twice and cultured in hormone-free SH liquid medium supplemented with 3 0 # M proline and 10#M ( N H 4 ) 2 S O 4. The first embryos became visible after about 3 weeks. The separation of embryos of various developmental stages was carried out from 5-week-old culture containing different size of embryos. This culture was size fractionated by sieving (pore sizes: see legend of Fig. 7), and embryos were picked out manually from each fraction.

Construction of a cDNA library and sequencing of cDNA clones RA3 callus for poly(A) + RNA preparation was passed through an 800 #m mesh and incubated in SH liquid medium supplemented with 5 0 # M 2,4-D and 5/IM KIN for 3 days. A cDNA-library from poly(A) + RNA has been constructed in the pGEM-2 (Promega) vector as described by De Loose et al. [8]. Heat-shock cDNAs were found as secondary products of a differential screening for 2,4-D induced one (to be published elsewhere). Several clones selected in colony screening did not show

1001 2,4-D response in northern analysis. However some of them were further investigated by sequencing. On the basis of nucleotide sequence a few clones could be identified as heat-shockgene-related cDNAs. Fragments from selected cDNA clones were subcloned into M13mpl8 and 19 and single-stranded templates were sequenced with the Sequenase kit (US Biochemicals) utilizing the chain-termination technique [22]. Sequences were analyzed with the Microgenie program (Beckman Instruments). The cDNA clone (Msc27) used as internal control in northern analysis was also sequenced. Databank search did not reveal any significant homology of the Msc27 to any other known gene.

Isolation and analysis of RNA M SC or embryos were frozen in liquid N2, ground in a coffee-mill and RNA was isolated by the method of Cathala et al. [4] based on extraction in the presence of guanidium thiocyanate and selective precipitation with lithium chloride. 24#g total RNA per sample was electrophoresed on a formaldehyde-agarose gel and transferred to Hybond-N membrane (Amersham) according to the manufacturer's instructions. 32p_ labelled probes of the cDNA clones were prepared by the method of Feinberg and Vogelstein [11]. The northern blots were prehybridized for 12 hours in 50~o formamide, 3 × SSC (450#M NaC1, 45 #M sodium citrate), 50 #M Tris-HCl pH 7.6, 5 #M EDTA, 1~o SDS and 0.25~o nonfat milk powder, and hybridized for 24 hours in the same solution supplemented with 3-6 x 106 cpm/ml probe at 42 °C. Blots were washed several times at 68 °C first with 3 x SSC, 0.1~o SDS, finally with 0.1 x SSC, 0.1~o SDS and then autoradiography was carried out at - 7 0 °C for 24-72 hours.

Results

Analysis of the nucleotide and derived amino acid sequences of alfalfa heat shock cDNAs On the basis of their nucleotide sequences (Fig. 1) two cDNAs (Mshspl8-1; Mshspl8-2) were identified to be heat shock genes encoding for small HSPs (Fig. 2). One open reading frame (ORF) could be predicted in the case of each clone. The latter clone Mshspl8-2 was found to be full-length and showed 89~o nucleotide sequence homology with Mshspl8-1 within the ORF and 56~o on the 3' non-translated region resulting in 82yo overall similarity. Sequence homology search of these clones against data banks revealed significant homology to the soybean (Glycine max L.) low-MW HSP gene family. 81-85 ~o similarities in the ORFs and 47-50~o in the 3' non-translated region to Gmshspl7.5-E, 17.5-M, 17.6-L and hs6871 have been found [7, 19, 24]. The ORF of Mshspl8-2 is 474 nucleotides in length and codes for a 158 amino acid long polypeptide. The ORF of Mshspl8-1 consists of 429 nucleotides coding for 143 amino acids. The lack of a start ATG and alignment to the Mshspl8-2 and to the different GmHSPs made clear that this cDNA is truncated and very likely 16 codons are missing from the 5' end (Fig. 2). The two alfalfa HSPs are very homologous to each other: they show 92 ~o sequence identity and 6 out of 11 mismatches are conservative changes. The deduced amino acid sequences of the Mshspl8 genes (Fig. 2) were compared with various members of the hsp20 family [20]. The protein encoded by Mshspl8-2 shows 89.9~o amino acid sequence homology to Pshspl7 (from Vierling E. after Neumann et al. [20]. Considering the sequence similarity (80-86~o of homology) between the alfalfa proteins and various soybean HSPs the described cDNAs are members of the hsp20 gene family. There is the only region from amino acid 32 to 47 that shows significant differences. It requires introduction of gaps in alignments (Fig. 2): 1 and 5 amino acid long gaps are to be inserted into the soybean sequence (the

1002 Mshspl8-2

1

Mshspl8-2

81

Mshspl8-1

1

AAAGCATTCAAAACTTCTTCAACCAAGAAATTGAAGCGAA~CACTGATTCCAAGTTTCTTCGGCGGC

CGAAGGAGC

AACGTTTTCGATCCATTCTCCCTCGACGTTTGGGACCCCTTCAAGGATTTTCCTTTCAACAATTCTGCACTTTCTG ................................

- - -C

T ................

C .................

Mshspl8-2

158

Mshspl8-1

72

Mshspl8-2

238

CGGATCTTCcAGGAATGAAGAAGGGGAAAGTGAAGGTAGAGATTGAAGATGATAGGGTTCTTCAGATCAGCGGAGAGAGA

Mshspl8-1

152

.T ............

Mshspl8-2

318

AGCGTTGAGAAAGAAGATAAGAACGATCAATGGCATCGCTTGGAGCGTAGCAGTGGAAAGTTCATGAGGAGATTTAGATT

Mshspl8-1

232

.AT ....................

CTT.

TTCATTCCCT•GTGAGAATTCCGCATTTGTGAGCACACGAGTCGACTGGAAGGAGACTCCAGAAGCGCATGTGTTCAAGG ...........

AG ........

T. -T ...........

CA.GA

C ......................

T..A

T ...............

Mshspl8-2

398

G CCTGAGAATGCGAAAATGGATCAAGTGAAAG

Mshspl8-1

312

• ..A

Mshspl8-2

478

TTAAGAAG

Mshspl8-1

392

.C ..............

Mshspl8-2

550

TCT-

Mshspl8-1

472

G..C..T..G.TGCA.C

Mshspl8-2

629

GAAAATTGAATAAACTCCGGTTTACAGT

Mshspl8-1

551

.TC

.... T ...........

...........

G .......

C ........

C ..............

C ........

CTGCAATGGAGAATGGTG

T..A

T..AT

.......

CTGG ...... A..T...

A ...........

T..T..G

T~-~ATACTAATCG-

poly

C .....

-GC.G..TCT..G

......

A

-AGTTCTGTGTTAGAATGATGT C.CT.T

.... TA.T.

TTGCTTTCATGTGTGTTTTGTGTGCTGTGTGTATGAAAAAAAATAATGAAATCATGTACTATGTTTTGTAAT-

poly

G

TTCTCACTGTCACTGTGCCAAAAGAAGAGG

A . C~--A-A-A~C. . . . . A C A . G C . T . T T .

.... GGT .... A .......

C .......

..............

..............................................................

CCTGAAGTGAAGACCATTGATATCT

A .....

.... TG.A

CG...

TTT

........

ATAA.A

..... G.G.

(A)

(A)

Fig. 1. DNA sequence alignment of the two alfalfa HSP cDNA clones. The start and stop codons of the predicted ORFs are boxed, the putative polyadenylation signals are underlined. Dots represent identical nucleotides in Mshspl8-1 and dashes are gaps introduced for best fitting. The poly(A) tract was 8 bp long in clone Mshspl8-2 and 20 bp in Mshspl8-1.

Mshspl8-2

MSLIPSFFGG

RRSNVFDPFS

Pshspl7

........

Gmhs6871

.............

STRVDWKETP

EAHVF~DLP

..oi

S .................

PFNNSALSAS

L .....

S ..................

GMKKEEV~E

.................

IEDDRV~IS

1 ........

..................

i..i

PENAKMDQVK

......

S..Q

S..s

- .....

AAMENGVLTV

....

PS°-...-

GERSVEKEDK

.........

TVPKEEVKKP

N ........

i ......

.... 1 ............

.s ..............

i..A

...s.e...

s ..............

i...

d..a

...Lv

..........

v .....

...... P...

. .....

NDQWHRLERS v...

E...v... T...v...

EVKTIDISG

.................................... K..

....

N ............

v .....................

i..Q.G

-FPRENSAFV

T .......

1 .....................

.....................

SGKFMRRFRL

LDVWDPFKDF

................

Mshspl8-1

s.e..S

.....

Fig. 2. Alignment of deduced protein sequences ofMshspl8-2, Mshspl8-1, Pshspl7 [20] and Gmhs6871 [24]. Dots are identical residues, dashes are gaps introduced for best fitting. Conservative changes are in lower case. Standard single-letter codes are used.

1003

Mshspl8-2

135

G

Dmhsp26

156

. . . . .

V

L

T

Dmhsp23

137

. . . .

Dmhsp22

130

. . . .

Mshspl8-2

ii0

S

G

K

Dmhsp22

104

. R

H

V

T

V

P

s

i

.

K

i

K

.

i

s

.

. N

F

M

R

R

F

.

1

.

R

L

P

E

. V

.

.

.

Fig. 3. Conservedboxesin the carboxyterminalregionofthe alfalfaand Drosophila [13] small HSPs. Symbolsas in Fig. 2. Numbers indicate the amino acid position in the respective proteins. same is observed by aligning all the other reported G m h s p l 7 s ; data not shown) and even a single amino acid gap is required in Mshspl8-2. The alfalfa H S P proteins described in this paper share a homologous stretch of amino acids in the carboxy-terminal region with small HSPs from Drosophila (Fig. 3A). We could also identify the GVLTV motif in the alfalfa sequence. In comparison between Mshspl8-2 and Drosophila hsp26 only two conservative changes can be found in this homologeous region of 9 amino acids. Considerable sequence identity of Mshspl8-2 and Drosophila hsp22 was also detected within a block of 12 amino acids (Fig. 3B).

Expression of Mshspl8 genes under various stress conditions Northern blot analysis of Mshspl8 m R N A in control and heat-shocked alfalfa MCS is shown in Fig. 4A. As an intemal control another cDNA clone (Msc27) was hybridized to the same RNA samples and showed constitutive and shockindependent expression (Fig. 4B). The data in Fig. 4C indicate the presence of Mshspl8 mRNAs in small amounts in MCS cultured at non-inductive temperature. Exposure of the cells to a higher temperature resulted in a marked increase in amount of M shsp 18 transcripts. A 2 h

Fig. 4. Heat-shock-inducedaccumulationof Mshsp18 transcripts. A. RNA samples from cells whichwere treated for 2 hours at different temperatures as follows: 1,22 °C; 2, 27 °C; 3, 32 °C; 4, 37 °C; 5, 42 °C; 6, 47 °C. The hybridization probe was the 32p-labelled cDNA insert from pMshspl8-1. Exposure time: 3 days. B. The same RNA samples as in A which were probed with the 32p-labelled Msc27 cDNA insert. C. RNA samples after 2 hours culture of alfalfa MCS at the following temperatures: 1,26 °C; 2, 28 °C; 3, 30 °C; 4, 32 °C. Exposure time 40 hours. pulse of heat treatment caused transient elevation in accumulation of Mshspl8 mRNAs. The recovery from heat shock was clearly visible as shown by considerable reduction in the amount of m R N A 12 hours after treatment (data not shown). As far as t h e temperature-dependent accumulation of Mshspl8 mRNAs is concerned we can see maximum expression at 37 °C, 42 °C (Fig. 4A) but 30 °C already caused a significant increase in amount of hybridizing RNAs (Fig. 4C). The activation of Mshspl8 genes in MCS by other stress factors was also analyzed by northern hybridization. As shown in Fig. 5, there was a slight increase in the amount of hybridizing mRNAs if the cells were treated for 2 h with 0.6 M sucrose as osmoficum. Significant induction was detected after 2 h incubation in culture medium supplemented with 0 . 5 # M CdC12. Studies on the response of the Mshspl8 genes to various hormone treatments (2,4-D, NAA, IAA up to 100 #M concentration and 3 days ofincuba-

1004

Fig. 5. Effect of different stress factors on amount of transcript from Mshspl8 genes in MCS. RNAs in panel A were probed with the insert from pMshspl8-1; in panel B from pMsc27. RNA samples from cells: 1, untreated; 2, treated with 0.6 M sucrose-containing medium for 2 hours; 3, with deionized water (2 hours); 4, with 0.5 mM CdCl2-containing medium (2 hours); 5, wounded by passing through an 800 #m mesh and incubated for 3 days in 50 #M 2,4-D-containing medium; 6, cultured for 14 days without change of medium; 7, heat-shocked at 42 °C for 2 hours. Exposure time: 3 days.

tion) in suspension cultures revealed that none of these hormones could induce the expression of these genes above the background level (data not shown).

in amount of Mshspl8 mRNAs was detected after 28 days growth in hormone-free culture (date not shown). At this time the cultures already consist of a large number of globular somatic embryos in unorganized tissues. Northern analysis of total RNAs from somatic embryos at various developmental stages clearly indicated a significant level of expression of the Mshspl8 genes in comparison to the amount of Mshspl8 transcripts in MCS (Fig. 7). Interestingly, embryos at early stages such as globular and heart synthesized a considerable amount of heat-shock mRNAs under normal culture conditions. As embryo development proceeds and torpedo stage embryos are formed expression of the Mshspl8 genes decreases to the level observed in MCS. Since in the experiments described the somatic embryos were induced and grown in liquid suspension cultures we also analyzed embryos developed on the surface of agar-solidified hormonefree culture medium. These studies confirmed the presence of Mshspl8 mRNAs during the early stages of embryogenesis (data not shown).

Expression of the Mshsp18 genes in somatic embryos of alfalfa at room temperature When total RNAs were isolated from roots or shoots of alfalfa plants grown in vitro, the hybridization with Mshspl8-1 cDNA insert did not detect the expression of these genes (data not shown). We have investigated the amount of Mshspl8 transcripts in MCS as well as in somatic embryos. Somatic embryogenesis could be initiated by 1 hour treatment with 100 pM 2,4-D. This short pulse of treatment with a strong auxin is required to initiate organized growth in multicellular structures of MCS and for subsequent formation of embryos under hormone free condition (Fig. 6). Expression level of Mshspl8 transcripts was not significantly influenced by the 2,4-D treatment for one hour or longer period. During the course of embryo formation several-fold increase

Fig. 6. Induction of somatic embryos in alfalfa MCS. A. Callus tissues in suspension culture grown in the presence of 15 #M NAA, 10/~M KIN. B, Purified fraction of embryos representing different developmental stages.

1005

Stage-specific expression of Mshsp18 transcripts during somatic embryogenesis under normal in vitro conditions

Fig. 7. Accumulation of Mshspl8 mRNAs during somatic embryo formation. RNA samples in panel A were probed with the insert from pMshspl8-1, in panel B from pMsc27. 1-3: RNA samples from alfalfa somatic embryos developed from MCS after the treatment with 100 #M 2,4-D and 10 #M KIN for 1 hour and subsequent culture in hormone free medium. 1: early stage globular embryos in size 300-500/zm. 2: heart stage embryos 500-800/~m. 3: elongated torpedo shape embryos larger than 800/~m. 4: RNA sample from MCS grown in the presence of 15 #M NAA and 10/~M KIN.

Discussion

Two alfalfa heat-shock cDNAs belong to the group of small heat-shock genes The two HSP cDNAs of alfalfa reported here are not only highly homologous to each other, but possess a high level of similarity to the well characterized hsp20 multigene family of soybean and pea. Based on the overall high level of amino acid sequence homology we assume that we have isolated transcripts of two alfalfa equivalents of these genes. In addition to the expected extensive homology between the alfalfa heat-shock polypeptides and other small HSPs from plants regions of homology were detected with Drosophila hsp22, hsp23, hsp26 [13]. This homology can be seen in the carboxy-terminal region known to be conserved in small HSPs [20]. The described alfalfa HSPs contain the GVLTV pattern of amino acids which is characteristic also of ~-crystallins, soybean and Drosophila HSPs. Based on the structural features of these proteins it has been suggested that these sequence motifs may have a function in protein aggregation [ 13, 24].

As shown by several examples in a wide range of organisms the small HSPs share the property of being induced at specific stages in development at normal temperature. Lindquist and Craig [16] suggested that the developmental induction of small HSPs could be universal. In view of this hypothesis we addressed questions about the possible relation between accumulation of certain heat-shock mRNAs and plant cell differentiation. For this purpose we used an experimental system based on the induction of somatic embryogenesis from cultured somatic alfalfa cells. The choice of embryogenic cultures for this analysis was also supported by the fact that previous studies have indicated the stage-specific synthesis of HSPs in carrot embryogenic cultures [21] and growthcycle-dependent heat-shock response in tobacco cell suspension [14]. Recently the lack of heat inducibility of heat-shock mRNAs in globular carrot embryos was observed [31]. In agreement with several reports on the transient heat-shock gene expression in early stages of animal embryogenesis (see [3]), we found high expression of Mshspl8 genes in early stages of alfalfa somatic embryos under normal culture conditions. Contrary to the very low level of carrot hsp 17.5 mRNAs in suspension cultures and embryos prior to heat shock, the young alfalfa embryos do show the presence of Mshspl8 mRNAs at detectable levels without heat shock. We lack experimental data to explain the observed differences. One possible explanation is that the carrot hspl7.5 and alfalfa hspl8 represent different members of a small heat-shock gene family that exhibit differences in their regulation during embryo development. However there are significant differences between the two embryogenic tissue cultures systems as the pre-growth conditions are concerned. In the presence of 2,4-D the carrot suspension cultures grow as proembryogenic masses and in hormone-free medium the cells are released from the 2,4-D inhibition and embryo development proceeds [28]. In contrast,

1006 the alfalfa MCS represents cells which are not committed to embryo formation yet, the short 2,4-D treatment is essential for triggering embryo development. In Drosophila the heat-shock mRNAs in unshocked early stages have been shown to be of maternal origin [30]. In sorghum, HSPs are synthesized from RNAs stored in the dry seed during the first 2 h of imbibition [ 12]. Detection of heat-shock RNAs in alfalfa somatic embryos also supports a suggestion about the involvement of these stress proteins in embryogenesis, however the dry seeds and somatic embryos represent significantly different physiological states. In our opinion, somatic embryogenesis can be regarded as the result of reprogramming of gene expression which involved coordinated induction of a large number of genes during hormoneinduced cell division and subsequent organized growth. These overall changes in cell metabolism and initiation of new ontogenic pathway can generate a need for proteins with a function to ensure proper folding or assembly of cellular proteins. Based on the various types and characteristics of molecular chaperones [5, 9, 10], HSPs may be considered as functional components in various assembly processes during embryogenic cell differentiation. In addition to the suggested classes of chaperonins such as HSP70 or HSP60 there are known small HSPs with a protective function through interaction with aggregation of membrane proteins [26]. As far as the aggregation capability is concerned functional similarities can be predicted between the small and highmolecular-weight HSPs on the basis of related amino acid motives. The GVITV motif can be found in the consensus amino acid sequence of HSP60 or GroEL proteins. The GVLTV sequence is characteristic of members of HSP20 family (for sequence reference see Neumann et aL [20]). Our present observations about the expression of Mshspl8 mRNAs encoding polypeptides with structural feature for aggregation capability (see the GVLTV motif in Fig. 3) in early somatic embryos can support a hypothesis about the functional role of these proteins during the switch of developmental programs such as of somatic

embryogenesis in plants similarly, for example, to sporulation in yeast [15]. The described two alfalfa heat-shock cDNAs may serve as molecular tools in further analysis of the possible role of HSPs in plant cell differentiation both in vitro and in vivo.

Acknowledgements The excellent technical assistance of Mrs J. Haj6s and photographic work of Brla Dusha are gratefully acknowledged. The authors also greatly appreciate the critical review of this manuscript by Csaba Koncz.

References 1. Bensaude O, Babinet C, Morange M, Jacob F: Heat shock proteins, first major products of zygotic gene activity in mouse embryos. Nature 305:331-333 (1983). 2. Bienz M: Xenopus hsp70 genes are constitutively expressed in injected oocytes. EMBO J 3:2477-2483 (1984). 3. Bond U, Schlesinger MJ: Heat shock proteins and development. Adv Genet 24:1-29 (1987). 4. Cathala G, Savouret JF, Mendez B, West BL, Karin M, Martial JA, Baster JD: A method for isolation of intact, translationally active ribonucleic acid. DNA 2:329-335 (1983). 5. Cheney CM, Shearn A: Developmental regulation of Drosophila imaginal disc proteins: synthesis of a HSP under non-heat-shock conditions. Devel Biol 95: 325-330 (1983). 6. Cheng MY, Hartl FU, Martin J, Pollock RA, Kalousek F, Neupert W, Hallberg EM, Hallberg RL, Horwich AL: Mitochondrial heat-shock protein hsp60 is essential for assembly of proteins imported into yeast mitochondria. Nature 337:620-625 (1989). 7. Czarnecka E, Gurley WB, Nagao RT, Mosqueva LA, Key JL: DNA sequence and transcript mapping of a soybean gene encoding a small HSP. Proc Natl Acad Sci USA 82:3726-3730 (1985). 8. De Loose M, Alliotte T, Gheysen G, Genetello L, Gielen J, Soetaert P, Van Montagu M, Inz6 D: Primary structure of a hormonally regulated B-glucanase of Nicotiana plurnbaginifolia. Gene 70:13-23 (1988). 9. Ellis RJ: Molecular chaperones: the plant connection. Science 250:954-959 (1990). 10. Ellis RJ, Hemmingsen SM: Molecular chaperons: proteins essential for the biogenesis of some macromolecular structures. TIBS 14:339-342 (1989).

1007 11. Feinberg AP, Vogelstein B: A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 137:266-267 (1984). 12. Howarth C: Heat shock proteins in Sorghum bicolor and Pennisetum americanum II. Stored RNA in sorghum seed and its relationship to HSP synthesis during germination. Plant Cell Envir 13:57-64 (1990). 13. Ingolia TD, Craig EA: Four small Drosophila HSPs are related to each other and to mammalian crystallin. Proc Natl Acad Sci USA 79:2360-2364 (1982). 14. Kanabus J, Pikaard CS, Cherry JH: Heat shock proteins in tobacco cell suspension during growth cycle. Plant Physiol 75:639-644 (1984). 15. Kurtz S, Rossi J, Petko L, Lindquist S: An ancient developmental induction: HSPs induced in sporulation and oogenesis. Science 231 : 1154-1157 (1986). 16. Lindquist S, Craig EA: The heat-shock proteins. Annu Rev Genet 22:631-677 (1988). 17. Mansfield MA, Key JL: Synthesis of the low molecular weight HSPs in plants. Plant Physiol 84:1007-1017 (1987). 18. Mason PJ, Hall LMC, Gausz J: The expression of heat shock genes during normal development in Drosophila melanogaster. Mol Gen Genet 194:73-78 (1984). 19. Nagao RT, Czarnecka E, Gurley WB, SchSffl F, Key JL: Genes for low-molecular-weight HSPs of soybeans: Sequence analysis of a multigene family. Mol Cell Biol 5: 3417-3428 (1985). 20. Neumann D, Nover L, Parthier B, Rieger R, ScharfKD, Wollgiehn R, Nieden U: Heat shock and other stress response systems in plants. Biol Zentbl 108:1-155 (1989). 21. Pitto J, Lo Schiavo F, Guiliano G, Terzi M: Analysis of the heat-shock protein pattern during somatic embryogenesis of carrot. Plant Mol Biol 2:231-237 (1983). 22. Sanger F, Nicklen S, Coulson AR: DNA sequencing

23.

24.

25.

26.

27.

28.

29.

30.

31.

with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 (1977). Schenk RU, Hildebrandt AC: Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can J Bot 29: 199-204 (1972). SchSffl F, Raschke E, Nagao RT: The DNA sequence analysis of soybean heat-shock genes and identification of possible regulatory promoter elements. The EMBO J 3:2491-2497 (1984). Sch6ffl F, Baumann G, Raschke E: The expression of heat shock genes. A model for the environmental stress response. In: Goldberg B, Verna DPS (eds) Temporal and Spatial Regulations of Plant Genes, pp. 253-273. Springer-Verlag, Berlin (1988). Schuster G, Even D, Kloppstech K, Ohad J: Evidence for protection by heat-shock proteins against photoinhibition during heat shock. EMBO J 7 : 1 - 6 (1988). Stuart DA, Strickland SG: Somatic embryogenesis from cell cultures ofMedicago sativa. I. The role of amino acid additions to the gene regeneration medium. Plant Sci Lett 34:165-174 (1984). Sung ZR: Development states of embryogenic cultures. In: Terzi M, Pitto L, Sung ZR (eds) Somatic Embryogenesis, pp. 117-121 IPRA Roma (1985). Wu CH, Caspar T, Browse J, Lindquist S, Somerville C: Characterization of an hsp70 cognate gene family in Arabidopsis. Plant Physiol 88: 731-740 (1988). Zimmermann JL, Petri W, Meselson M: Accumulation of a specific subset of D. melanogaster heat shock mRNAs in normal development without heat shock. Cell 32:1161-1170 (1983). Zimmermann JL, Apuya N, Darwish K, O'Caroll C: Novel regulation of heat shock genes during carrot somatic embryo development. Plant Cell 1:1137-1146 (1989).