Mutation Research, 269 (1992) 55-62 © 1992 Elsevier Science Publishers B.V. All rights reserved 0027-5107/92/$05.00
55
MUT 05133
Allelic losses in mutations at the aprt locus of human lymphoblastoid cells Akira Fujimori, Akira Tachibana and Kouichi Tatsumi Department of Molecular Oncology, Facultyof Medicine, Kyoto Unit'ersi~, Kyoto 606, Japan (Received 19 October 1991) (Revision received 10 January 19921 (Accepted 13 January 1992)
Keywords: Aprt gene; Allelic loss; Spontaneous mutation; Gamma-ray-induced mutation: Carcinogenesis
Summary We analyzed the nature of mutations at the autosomal locus coding for adenine phosphoribosyltransferase (aprt) in human cells to elucidate the process(es) governing mutagenesis at autosomal loci. A human lymphoblastoid cell line, WRI0, was found to be heterozygous for mutated allele at the aprt locus, and was used for mutation analyses. By the use of a restriction fragment length polymorphism associated with the aprt locus in WRI0 cells, the molecular characteristics of mutations arising spontaneously or induced by y-rays were investigated. Eighty-five percent (22/26) of the spontaneous mutant clones and 93% (64/69) of the y-ray-induced mutant clones resulted from loss of one of the two aprt alleles. Determination of the dosage of aprt genes in those mutants with allelic losses revealed that approximately half of them retained two copies of the mutated allele. These data suggest that the mutational events leading to APRT deficiency are analogous to those reported for tumor suppressor genes in malignancies.
There is substantial evidence that inactivation or loss of tumor suppressor genes, thought to be involved in the regulation of cell proliferation, plays a major role in the emergence of various kinds of tumors (Ponder, 1988; Stanbridge, 1990). The somatic events in the process of loss-of-function mutations include chromosome losses, deletions, mitotic recombinations, and gene convert
Correspondence: Dr. K. Tatsumi, Department of Molecular Oncology, Faculty of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606, Japan.
Abbreviations: APRT, adenine pbosphoribosyltransferase; RFLP, restriction fragment length polymorphism; DAP, 2,6diaminopurine; TIL thymidine kinase.
sions (Hansen and Cavenee, 1987). However, the molecular mechanisms of these events are not fully understood. Investigation of mutations in autosomal genes is difficult, since both alleles must be inactivated if the mutant phenotype is recessive. Furthermore, there is no easy way of distinguishing those cells which have mutations in these tumor suppressor genes from normal cells. We have attempted to establish a model system for investigating somatic mutations at an autosomai locus. A human iymphoblastoid cell line heterozygous at the adenine phosphoribosyltransferase (aprt) locus (APRT +/-) has been employed. The human aprt gene is located on chromosome 16 (16q24) (Fratini et al., '.986; Chen et al., 1991), and has been cloned anrd sequenced
56 (Murray et al., 1984; Stambrook et al., 1984; Broderick et al., 1987; Hidaka et al., 1987). APRT - / - mutants are selectable in medium containing a drug such as 2,6-diaminopurine (DAP), which is converted to a lethal metabolite by the APRT enzyme. We have found that the spontaneous mutation frequency at the aprt locus was much higher than that at the hypoxanthineguanine phosphoribosyltransferasc locus. We also found that mutations were induced at the aprt locus by y-rays in a dose-dependent manner (Tatsumi et al., in preparation). In order to clarify the molecular nature of mutations arising spontaneously or induced by y-rays, we examined the aprt genes in mutant clones utilizing a restriction fragment length polymorphism (RFLP) at the locus in this cell line. We found that a majority of mutant clones had lost the wild-type allele. In addition, our results suggest that the mutational mechanisms for the aprt locus are similar to those for tumor suppressor genes.
Materials and methods
Cell culture The lymphoblastoid cell line W R I 0 was provided by Dr. N. Kamatani (Institute of Rheumatology, Tokyo Women's Medical College, Tokyo). This cell line was established from peripheral blood of a heterozygous carrier of 2,8-dihydroxyadenine urolithiasis (APRT deficiency) (Nobori et al., 1986). Cytogenetic analysis revealed that the karyotype of WR10 was normal diploid (46,XX). Another lymphoblastoid cell line TK6 (Skopek et al., 1978) was provided by Dr. W.G. Thilly (Massachusetts Institute of Technology, Cambridge, MA). The cells were grown in RPMI 1640 medium supplemented with 14% fetal calf serum, and maintained by daily dilution to 5 × l0 s cells/ml.
treatment, cells were centrifuged and resuspended in TAC medium (the same formulation as CA_AT medium but without aminopterin) and a part of the TAC medium was replaced with the complete medium repeatedly for 3-5 days prior to irradiation. For irradiation with y-rays, cell cultures (5 × 107-10 s cells per point) were centrifuged and resuspended at 5 × 10 6 cells/ml in RPMI 1640. The cells were exposed to a 137Cs source at a dose rate of 4 Gy/min at room temperature and were resuspended in a 1 0 x volume of complete medium. Cell survival was determined by backextrapolating the exponential portion of growth curves of the cultures (DeLuca et al., 1983; Tatsumi and Takebe, 1984). The cells were incubated for 6 days to allow maximum expression of DAP resistance and then inoculated into microwells of 96-well microtiter plates at a density of 2 x 104 cells/well in the presence of 100 p M DAP. After 2 weeks half of the medium in each well was replaced with fresh medium containing 100/zM DAP. At 4 weeks after plating, positive wells with growing cells were scored and the mutation frequency was calculated as described before (Furth et al., 1981; Tatsumi et al., 1987). The mutant clones were isolated from independent cultures, expanded to approximately 3 x 10 7 cells, pelleted and frozen for subsequent DNA analysis.
Enzymatic amplification and DNA sequence analysis of exon 3 of the aprt gene Enzymatic amplification of exon 3 of the aprt gene and direct sequencing of the doublestranded products were accomplished as described previously (Harwood et ai., 1991). For amplification, 20-mers (ACCAGGTACCCCTTGCCACC and G G A G A G T G G C C A C G G T G GCC) were used, and a 20-mer G G G A T r C C CATGCTGCCGAG was used as the primer for sequencing.
Mutagenesis Prior to each experiment, WR10 cells were incubated in the complete medium supplemented with 1 x 10 -5 M cytidine, 1 × 10 -4 M adenine, 1 x 10 -~' M aminopterin and 1.75 × 10 -s M thymidine (CAAT medium) for 2 days to reduce the A P R T - mutant fraction. Following CAAT
Southern blot analysis Genomic DNA was purified by standard methods including proteinase K and RNase digestion and phenol:chloroform extractions. DNA (5 or 10/~g) was digested with the restriction enzyme Sphl (Toyobo Co., Ltd., Osaka), fractionated on
57 1% agarose gel, and transferred to BioTrace RP membrane (Gelman Sciences, Ann Arbor, MI) using 0.4 N N a O H . The 1.7-kb SmaI-BamHI aprt fragment was isolated from pAT2.3aprt (Murray et al., 1984) which was provided by Dr. J.E. Arrand (CRC G r a y Laboratory, Middlesex, UK). T h e 1.5-kb BamHI fragment containing human thymidine kinase ( t k ) c D N A was obtained from p T K l l (Bradshaw and Deininger, 1984) which was supplied by Dr. P.L. Deininger (L.S.U. Medical Center, New Orleans, LA). Probes were labeled with [32P]dCTP (Amersham International plc, Amersham, UK) with Multiprime D N A labeling system (Amersham International plc,
1
2
3
4
5
6
Amersham, UK). Filters were hybridized and washed as described previously (Tachibana et al., 1990). Radioactive counts on filters were measured with Fujix Bio-lmage Analyzer (Model BAS2000, Fuji Photo Co., Ltd., Kanagawa) based on principles published elsewhere (Sonoda et al., 1983). Results
Confirmation of the inherited mutation in a heterozygous cell line, WRIO We amplified and sequenced the region which contained exon 3 of the aprt gene. Bands were
7
8
9
10
11
12
(kb)
-23.0 O
-
9.6
•
6.6
•
4.4
O
Fig. 1. Southern blot analysis of DNAs from parental WR10 cells and spontaneous DAP-resistant mutant clones. Genomic DNA (10 ~g) was digested with Sphl and probed with the SmaI.BamHl aprt fragment. Both 12-kb and 8-kb bands are evident in parental WRI0 cells (lane 12). Three out of 11 mutants show the same pattern as WRI0 (lanes 8, 9 and 111.while other mutants lost the 12-kbband (lanes I-7 and 10). No other bands resulting from DNA rearrangement were observed in any mutant clones.
58 TABLE l
found at position 2037 in both A and G lanes on the sequencing gel (data not shown). This indicated that one of the two alleles had a G ~ A transition leading to a nonsense mutation at this position, confirming the result of Mimori et aL (1991).
STRUCTURAL CHANGES IN THE APRT GENE IN DAP-RESISTANT MUTANTS Treatment
RFLP at the aprt locus in WRIO cells We searched available RFLPs for an informative one that would enable us to distinguish the
1
2
3
4
5
6
Number of mutant clones analyzed
Number of clones which lost 12-kb signal (%)
None (spontaneous)
26
22 (85)
y-Rays (2 Gy)
69
64(93)
7
8
9
10
11
12
(kb)
(A)
APRT
-23.0 ~J 41
- 9.6
- 6,6 (B)
TK - 44
~
,
"
e
- 2.3
Fig. 2. Determination of the number of aprt copies in wild-type cells and y-ray-induced mutant clones. Genomic DNAs (5 p.g) from parental cells (lanes ] and 12) and from APRT-deficient mutants with allelic loss (lanes 2-]0) were digested with SphI, fractionated on a ]% agarose gel and blotted onto nylon membrane, DNA of TK6 was subjected to the same analysis simultaneously (lane ] ]). The membrane was cut into two parts at about 7 kb, The upper part was hybridized with the aprt probe (A), and the lower part, with the tk probe (B), Radioactive counts of the 8-kb aprt bands and the 6-kb tk bands were measured with Fujix Bio-lmage Analyzer. In lane 2, a signal at 12 kb is visible, but this was due to an experimental error since this signal of this clone was not reproducible in other blots.
59
two aprt alleles in the WR10 cell line. It has been shown that Sphl identifies a two-allele polymorphism with bands at either 12 kb or 8 kb (Arrand et al., 1987). WR10 DNA was digested with SphI and probed with the aprt fragment. Two bands corresponding to 12 kb and 8 kb were observed (Fig. 1, lane 12; Fig. 2A, lanes 1 and 12), indicating that WR10 is heterozygous also for SphI polymorphism. Mutation frequency Cells were exposed to 2 Gy of y-rays, which reduced the survival to 15%. DAP-resistant mu-
tant clones were induced by y-rays at a frequency of 2.5 x 10 - 4 with a background fraction of 1.1 × 10 -5 for spontaneous mutation, implying that the spontaneously arising mutants accounted for a v e r y l i m i t e d p o r t i o n o f t h e m u t a n t s isolated f r o m t h e y - r a y - i r r a d i a t e d cells.
Southern blot analysis Genomic DNA of spontaneous mutant clones was digested with SphI and subjected to Southern blot analysis using a SmaI-BamHI aprt fragment as a probe. Some mutant clones showed two bands at 12 kb and 8 kb (Fig. 1, lanes 8, 9 and
TABLE 2 DOSAGE OF APRT GENE IN SPONTANEOUS (A) AND v-RAY-INDUCED (B) DAP-RESISTANT MUTANTS Cells (A) References WR10 TK6 Mutant clones No. 2202 No. 2203 No. 2204 No. 2205 No. 2207 No. 2209 No. 2210
Radioactivity a APRT 8 kb
TK 6 kb
Ratio APRT 8 kb/ TK 6 kb
APRT 8 kb dosage b
508.3 1025.0
180.8 134.8
2.8 7.6
1.0 2.7
952.2 447.8 1007.0 615.0 668.2 362.3 758.8
370.7 79.4 194.1 321.4 219.4 100.2 137.8
2.6 5.6 5.2 1.9 3.0 3.6 5.5
0.91 2.0 1.8 0.68 1. I 1.3 2.0
805.7 1495.0
458.2 362.1
1.8 4. I
1.0 2.4
726.4 967.7 1058.0 934.8
210.0 300.1 307.1 466.1
3.5 3.2 3.4 2.0
2.0 1.8 2.0 1.1
1265.0 1614.0
241.3 168.1
5.2 9.6
1.0 1.8
599.0 1452.0
51.2 336.3
12.0 4.3
2.2 0.8
(B) c Experiment I
References WRI0 TK6 Mutant clones No. 1001 No. 1002 No. 1003 No. 1012
Experiment II References WRI0 TK6 Mutant clones No. 1006 No. 1011
Photostimulable luminescence (PSL) intensities per unit area (mm2) were measured for aprt 8-kb bands and tk 6-kb bands with the Bio-lmage Analyzer by setting the fixed window size for each film to cover the thickest band. Background inten3ities from areas adjacent to each band were subtracted from band intensities to obtain the net radioactivities. b Relative dosage of the aprt 8-kb band was obtained by dividing the ratio for each mutant clone by that for parental WRI0 cells. c Data were from two independent experiments. a
60
11), like the parental W R I 0 cells (Fig. 1, lane 12). All other mutant clones lost the 12-kb band and retained the 8-kb band only (Fig. 1, lanes 1-7 and 10). Twenty-two of 26 spontaneous mutants analyzed lost the 12-kb band (Table 1). Of 69 T-rayinduced mutant clones examined, 64 lost the 12-kb band (Table 1). No new bands were detected in either spontaneous or y-ray-induced mutants.
Analysis of copy number of the 8-kb allele To determine the number of aprt alleles remaining in the mutants which lost the 12-kb allele, we measured the radioactivity of the 8-kb bands on blots. Blotted filters of Sphl.digested DNAs were cut into two parts at about 7 kb. The upper parts were probed with the SmaI-BamHl aprt fragment (Fig. 2A), and the lower parts with the 1.5-kb BamH! tk eDNA fragment (Fig. 2B). The radioactivity of the bands detected by the tk probe was taken as the standard for the amount of total DNA loaded on each lane, since the copy number of the tk gene, mapped to chromosome 17, was not expected to be altered in DAP-resistant mutants. We observed three bands, at 6.0, 5.0 and 4.0 kb, with the tk eDNA probe in WR10 cells upon Spill digestion (Fig. 2B, lanes 1 and 12), which were predicted from the published tk sequence (Flemington et al., 1987; Slagel et al., 1987; the accession numbers are M15205 and M15206), and the 6.0-kb band was used as the standard. The aprt/tk ratio of radioactive counts in mutant cells which lost the 12-kb allele was compared with the ratio in the parental WR10 cells, in which the 8-kb allele was presumed to be one copy (Table 2). Of seven spontaneous mutant clones examined, four retained one copy of the 8-kb allele, whereas three clones had two copies. Two of six mutants induced by ,/-rays retained one copy of the 8-kb allele, and the rest had two copies. Discussion
We have examined the molecular nature of mutations at the aprt gene in a human lymphoblastoid cell line which is heterozygous at the aprt locus. Our study revealed that most of the spontaneous mutant clones analyzed arose from loss of the 12-kh band. The fact that the mutants
which showed the allelic loss always lost the allele which does not retain the polymorphic Sphl site made us rationally assume that the allele bearing the Sphl site was the aprt- allele in this cell line. The aprt- allele was duplicated in about half of the mutants examined, implying that mitotic non-disjunctions or recombinations as well as deletions are involved in spontaneous mutagenesis at the aprt locus. We have also examined the molecular nature of mutations induced by y-rays. More than 90% of the T-ray-induced mutants showed aUelie loss. As was observed for spontaneous mutants, the mutant allele was duplicated in a substantial proportion of the mutants examined. This suggests that y-rays cause loss or inactivation of autosomal genes possibly in a similar fashion to the spontaneous events. Previous studies on mutations at the aprt locus in Chinese hamster cells revealed that most of the high-frequency mutational events in a C H O cell strain heterozygous at the aprt locus were large deletions (Dewyse and Bradley, 1989). It has been shown that there are complicated chromosome rearrangements in CHO cells involving both No. 3 chromosomes which carry the aprt locus (Adair et al., 1983), while WRI0 cells have no detectable chromosome rearrangements. This could cause the differential proportion of deletions in allelic losses between CHO cells and WR10 cells. Another autosomal locus which has been studied extensively is the tk locus, Yandell et al. (1990) reported that most tk- mutants arising spontaneously or induced by X-rays from a human lymphoblastoid cell line heterozygous at the tk locus had lost the entire wild-type tk allele based on analyses using RFLP. After examining another RFLP marker on the same chromosome, they also suggested that the large, multilocus changes including the tk locus and the surrounding region are often involved in TK-defieient mutations. A similar conclusion has been drawn from the study of a mouse cell line heterozygous at the tk locus (Applegate et al., 1990). Allelic losses are frequently observed in numerous malignancies at various loci which are supposed to be tumor suppressor genes (Ponder, 1988; Stanbridge, 1990). Studies on the RB-1
61
locus in retinoblastomas have revealed that tumorigenesis may result from the reduction to homozygosity for the mutant allele at the Rb-1 locus (Cavenee et al., 1983). The proposed mecbanisms that result in homozygosity included mitotic non-disjunctions, mitotic recombinations, gene conversions and deletions. The mutational events causing APRT deficiency in WR10 cells are apparently similar to those occurring at the tumor suppressor genes. Since T-rays increased the mutation frequency at the aprt locus, and induced similar types of mutations, ~/-rays could be a strong mutagenic agent to induce human cancers with molecular changes similar to those causing spontaneous cancers. In conclusion, our assay system employing the aprt locus in WR10 cells should be useful to analyze the broad spectrum of molecular changes in somatic mutations that have been implicated in tumorigenesis.
Acknowledgements We would like to thank Ms M. Toyoda and Ms Y. Houki for technical assistance, and the Center for Molecular Biology and Genetics, Kyoto University for the use of Bio-lmage Analyzer. This work was supported by grants from the Ministry of Education, Science and Culture, and a grant from the Science and Technology Agency of Japan. References Adair, G.M.) R.L. Stallings, R.S. Nairn and MJ. Siciliano (1983) High-frequency structural gene deletion as the basis for functional hemizygosityof the adenine phosphoribosyltransferase locus in Chinese hamster ovary cells, Proc. Natl. Acad. Sci. (U.S.A.), 80, 5961-5964. Applegate, M.L., M.M. Moore, C.B. Broder, A. Burrell, G. Juhn, K.L. Kasweck, P.-F. Lin, A. Wadhams and J.C. Hozier (1990) Molecular dissection of mutations at the heterozygous thymidine kinase locus in mouse lymphoma cells, Proc. Natl. Acad. Sci. (U.S.A.), 87, 51-55. Arrand, J.E., A.M. Murray and N. Spurr (1987) Sphl restriction fragment length polymorphism on human chromosome 16 detected with an APRT gene probe, Nucleic Acids Res., 15, 9615. Bradshaw Jr., H., and P.L. Deininger (1984) Human thymidine kinase gene: molecular cloning and nucleotide sequence of a eDNA expressible in mammalian cells, Mol. Cell. Biol., 4, 2316-2320.
Broderick, T.P., D.A. Schaff, A.M. Bertino, M.IL Dush, J.A. Tischfield and P3. Stambrook (1987) Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement, Proc. Natl. Acad. Sci. (U.S.A.), 84, 3349-3353. Cavenee, W.K., T.P. Dryja, R.A. Phillips, W.F. Benedict, R. Godbout, B.L. Gallie, A.L. Murphree, L.C. Strong and R.L. White (1983) Expression of recessive alleles by chromosomal mechanisms in retinoblastoma, Nature (London), 305, 779-784. Chen, I Z., P.C. Harris, S. Apostolou, E. Baker, K. Holman, S.A. Lane, J.K. Nancarrow, S.A. Whitmore, R.L. Stallings, C.E. Hildebrand, R.I. Richards, G.R. Sutherland and D.F. Callen (1991) A refined physical map of the long arm of human chromosome 16, Genomics, 10, 308-312. DeLuca, J.G., L. Weinstein and W.G. Thilly (1983) Ultraviolet light-induced mutation of diploid human lymphoblasts, Mutation Res., 107, 347-370. Dewyse, P., and W.E.C. Bradley (1989) High-frequency deletion event at aprt locus of CHO cells: detection and characterization of endpoints, Somat. Cell Mol. Genet., 15, 19-28. Flemington, E., H.D. Bradshaw Jr., V. Traina-Dorge, V. Slagel and P.L. Deininger (1987) Sequence, structure and promoter characterization of the human thymidine kinase gene, Gene, 52, 267-277. Fratini, A., R.N. Simmers, D.F. Callen, V.J. Hyland, J.A. Tisehfield, P.J. Stamhrook and G.R. Sutherland (1986) A new location for the human adenine phosphorihosyltransferase gene (APRT) distal to the haptoglobin (HP) and fra(16Xq23) (FRAI6D) loci, Cytogenet. Cell Genet., 43, 10-13. Furth, E.E., W.G. Thilly, B.W. Penman, H.L. Liber and W.M. Rand (1981) Quantitative assay fi)r mutation in diploid human lymphoblasts using microtiter plates, Anal. Biochem., !10, 1-8. Hansen, M.F., and W.K. Cavenee (1987) Genetics of cancer predisposition, Cancer Res., 47, 5518-5527. Harwood, J., A. Tachibana and M. Meuth (1991) Multiple dispersed spontaneous mutations: a novel pathway of mutation in a malignant human cell line, Mol. Cell. Biol., 11, 3163-3170. Hidaka, Y., S.A. Tarle, T.E. O'Toole, W.N. Kelley and T.D. Palella (1987) Nucleotide sequence of the human APRT gene, Nucleic Acids Res., 15, 9086. Mimori, A., Y. Hidaka, V.C. Wu, S.A. Tarle, N. Kamatani, W.N. Kelley and T.D. Pallela (1991) A mutant allele common to the type I adenine phosphoribosyltransferase deficiency in Japanese subjects, Am. J. Hum. Genet., 48, 103-107. Murray, A.M., E. Drobetsky and J.E. Arrand (1984) Cloning the complete human adenine phosphoribosyl transferase gene, Gene, 31,233-240. Nobori, T., N. Kamatani, K. Mikanagi, Y. Nishida and K. Nishioka (1986) Establishment and characterization of B cell lines from individuals with various types of adenine phosphoribosyltransferase deficiencies, Biochem. Biophys. Res. Commun., 137, 998-1005.
62 Ponder, B. (1988) Gene losses in human tumours, Nature (London). 335, 400-402. $kopek, T.R., H.L. Liber, B.W. Penman and W.G. Thiily (1978) Isolation of a human lymphoblastoid line heterozygous at the thymidine kinase locus: possibility for a rapid human cell mutation assay, Biochem. Biophys. Res. Commun., 84, 411-416. Slagel, V,, E. Flemington, V. Traina-Dorge, H. Bradshaw Jr. and P.L. Deininger (1987) Clustering and subfamily relationships of the Alu family in the human genome, Mol. Biol. Evol., 4, 19-29. Sonoda, M., M. Takano, J. Miyahara and H. Kato (1983) Computed radiography utilizing scanning laser stimulated luminescence, Radiology, 148, 833-838. $tambrook, P.J., M.K. Dush, J.J. Trill and J.A. Tischfield (1984) Cloning of a functional human adenine phosphorihosyltransferase (APRT) gene: identification of a restriction fragment length polymorphism and preliminary analysis of DNAs from APRT-defieient families and cell mutants, Somat. Cell Mol. Genet., 10, 359-367.
Stanbridge, E.J. (1990) Human tumor suppressor genes, Annu. Rev. Genet., 24, 615-657. Tachibana, A., T. Ohbayashi, H. Takebe and IC Tatsumi (1990) Molecular changes in UV-induced and y-ray-induced mutations in human lymphoblastoid cells, Mutation Res., 230, 159-166. Tatsumi, K., and H. Takebe (1984) "},-Irradiation induces mutation in ataxia-telangiectasia lymphoblastoid cells, Gann, 75, 1040-1043. Tatsumi, K., M. Toyoda, T. Hashimoto, J. Furuyama, T. Kurihara, M. Inoue and H. Takebe (1987) Differential hypersensitivity of xeroderma pigmentosum iymphoblastold cell lines to ultraviolet light mutagenesis, Carcinogenesis, 8, 53-57. Yandell, D.W., T.P. Dryja and J.B. Little (1990) Molecular genetic analysis of recessive mutations at a heterozygous autosomal locus in human cells, Mutation Res., 229, 89102.
55
MUT 05133
Allelic losses in mutations at the aprt locus of human lymphoblastoid cells Akira Fujimori, Akira Tachibana and Kouichi Tatsumi Department of Molecular Oncology, Facultyof Medicine, Kyoto Unit'ersi~, Kyoto 606, Japan (Received 19 October 1991) (Revision received 10 January 19921 (Accepted 13 January 1992)
Keywords: Aprt gene; Allelic loss; Spontaneous mutation; Gamma-ray-induced mutation: Carcinogenesis
Summary We analyzed the nature of mutations at the autosomal locus coding for adenine phosphoribosyltransferase (aprt) in human cells to elucidate the process(es) governing mutagenesis at autosomal loci. A human lymphoblastoid cell line, WRI0, was found to be heterozygous for mutated allele at the aprt locus, and was used for mutation analyses. By the use of a restriction fragment length polymorphism associated with the aprt locus in WRI0 cells, the molecular characteristics of mutations arising spontaneously or induced by y-rays were investigated. Eighty-five percent (22/26) of the spontaneous mutant clones and 93% (64/69) of the y-ray-induced mutant clones resulted from loss of one of the two aprt alleles. Determination of the dosage of aprt genes in those mutants with allelic losses revealed that approximately half of them retained two copies of the mutated allele. These data suggest that the mutational events leading to APRT deficiency are analogous to those reported for tumor suppressor genes in malignancies.
There is substantial evidence that inactivation or loss of tumor suppressor genes, thought to be involved in the regulation of cell proliferation, plays a major role in the emergence of various kinds of tumors (Ponder, 1988; Stanbridge, 1990). The somatic events in the process of loss-of-function mutations include chromosome losses, deletions, mitotic recombinations, and gene convert
Correspondence: Dr. K. Tatsumi, Department of Molecular Oncology, Faculty of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606, Japan.
Abbreviations: APRT, adenine pbosphoribosyltransferase; RFLP, restriction fragment length polymorphism; DAP, 2,6diaminopurine; TIL thymidine kinase.
sions (Hansen and Cavenee, 1987). However, the molecular mechanisms of these events are not fully understood. Investigation of mutations in autosomal genes is difficult, since both alleles must be inactivated if the mutant phenotype is recessive. Furthermore, there is no easy way of distinguishing those cells which have mutations in these tumor suppressor genes from normal cells. We have attempted to establish a model system for investigating somatic mutations at an autosomai locus. A human iymphoblastoid cell line heterozygous at the adenine phosphoribosyltransferase (aprt) locus (APRT +/-) has been employed. The human aprt gene is located on chromosome 16 (16q24) (Fratini et al., '.986; Chen et al., 1991), and has been cloned anrd sequenced
56 (Murray et al., 1984; Stambrook et al., 1984; Broderick et al., 1987; Hidaka et al., 1987). APRT - / - mutants are selectable in medium containing a drug such as 2,6-diaminopurine (DAP), which is converted to a lethal metabolite by the APRT enzyme. We have found that the spontaneous mutation frequency at the aprt locus was much higher than that at the hypoxanthineguanine phosphoribosyltransferasc locus. We also found that mutations were induced at the aprt locus by y-rays in a dose-dependent manner (Tatsumi et al., in preparation). In order to clarify the molecular nature of mutations arising spontaneously or induced by y-rays, we examined the aprt genes in mutant clones utilizing a restriction fragment length polymorphism (RFLP) at the locus in this cell line. We found that a majority of mutant clones had lost the wild-type allele. In addition, our results suggest that the mutational mechanisms for the aprt locus are similar to those for tumor suppressor genes.
Materials and methods
Cell culture The lymphoblastoid cell line W R I 0 was provided by Dr. N. Kamatani (Institute of Rheumatology, Tokyo Women's Medical College, Tokyo). This cell line was established from peripheral blood of a heterozygous carrier of 2,8-dihydroxyadenine urolithiasis (APRT deficiency) (Nobori et al., 1986). Cytogenetic analysis revealed that the karyotype of WR10 was normal diploid (46,XX). Another lymphoblastoid cell line TK6 (Skopek et al., 1978) was provided by Dr. W.G. Thilly (Massachusetts Institute of Technology, Cambridge, MA). The cells were grown in RPMI 1640 medium supplemented with 14% fetal calf serum, and maintained by daily dilution to 5 × l0 s cells/ml.
treatment, cells were centrifuged and resuspended in TAC medium (the same formulation as CA_AT medium but without aminopterin) and a part of the TAC medium was replaced with the complete medium repeatedly for 3-5 days prior to irradiation. For irradiation with y-rays, cell cultures (5 × 107-10 s cells per point) were centrifuged and resuspended at 5 × 10 6 cells/ml in RPMI 1640. The cells were exposed to a 137Cs source at a dose rate of 4 Gy/min at room temperature and were resuspended in a 1 0 x volume of complete medium. Cell survival was determined by backextrapolating the exponential portion of growth curves of the cultures (DeLuca et al., 1983; Tatsumi and Takebe, 1984). The cells were incubated for 6 days to allow maximum expression of DAP resistance and then inoculated into microwells of 96-well microtiter plates at a density of 2 x 104 cells/well in the presence of 100 p M DAP. After 2 weeks half of the medium in each well was replaced with fresh medium containing 100/zM DAP. At 4 weeks after plating, positive wells with growing cells were scored and the mutation frequency was calculated as described before (Furth et al., 1981; Tatsumi et al., 1987). The mutant clones were isolated from independent cultures, expanded to approximately 3 x 10 7 cells, pelleted and frozen for subsequent DNA analysis.
Enzymatic amplification and DNA sequence analysis of exon 3 of the aprt gene Enzymatic amplification of exon 3 of the aprt gene and direct sequencing of the doublestranded products were accomplished as described previously (Harwood et ai., 1991). For amplification, 20-mers (ACCAGGTACCCCTTGCCACC and G G A G A G T G G C C A C G G T G GCC) were used, and a 20-mer G G G A T r C C CATGCTGCCGAG was used as the primer for sequencing.
Mutagenesis Prior to each experiment, WR10 cells were incubated in the complete medium supplemented with 1 x 10 -5 M cytidine, 1 × 10 -4 M adenine, 1 x 10 -~' M aminopterin and 1.75 × 10 -s M thymidine (CAAT medium) for 2 days to reduce the A P R T - mutant fraction. Following CAAT
Southern blot analysis Genomic DNA was purified by standard methods including proteinase K and RNase digestion and phenol:chloroform extractions. DNA (5 or 10/~g) was digested with the restriction enzyme Sphl (Toyobo Co., Ltd., Osaka), fractionated on
57 1% agarose gel, and transferred to BioTrace RP membrane (Gelman Sciences, Ann Arbor, MI) using 0.4 N N a O H . The 1.7-kb SmaI-BamHI aprt fragment was isolated from pAT2.3aprt (Murray et al., 1984) which was provided by Dr. J.E. Arrand (CRC G r a y Laboratory, Middlesex, UK). T h e 1.5-kb BamHI fragment containing human thymidine kinase ( t k ) c D N A was obtained from p T K l l (Bradshaw and Deininger, 1984) which was supplied by Dr. P.L. Deininger (L.S.U. Medical Center, New Orleans, LA). Probes were labeled with [32P]dCTP (Amersham International plc, Amersham, UK) with Multiprime D N A labeling system (Amersham International plc,
1
2
3
4
5
6
Amersham, UK). Filters were hybridized and washed as described previously (Tachibana et al., 1990). Radioactive counts on filters were measured with Fujix Bio-lmage Analyzer (Model BAS2000, Fuji Photo Co., Ltd., Kanagawa) based on principles published elsewhere (Sonoda et al., 1983). Results
Confirmation of the inherited mutation in a heterozygous cell line, WRIO We amplified and sequenced the region which contained exon 3 of the aprt gene. Bands were
7
8
9
10
11
12
(kb)
-23.0 O
-
9.6
•
6.6
•
4.4
O
Fig. 1. Southern blot analysis of DNAs from parental WR10 cells and spontaneous DAP-resistant mutant clones. Genomic DNA (10 ~g) was digested with Sphl and probed with the SmaI.BamHl aprt fragment. Both 12-kb and 8-kb bands are evident in parental WRI0 cells (lane 12). Three out of 11 mutants show the same pattern as WRI0 (lanes 8, 9 and 111.while other mutants lost the 12-kbband (lanes I-7 and 10). No other bands resulting from DNA rearrangement were observed in any mutant clones.
58 TABLE l
found at position 2037 in both A and G lanes on the sequencing gel (data not shown). This indicated that one of the two alleles had a G ~ A transition leading to a nonsense mutation at this position, confirming the result of Mimori et aL (1991).
STRUCTURAL CHANGES IN THE APRT GENE IN DAP-RESISTANT MUTANTS Treatment
RFLP at the aprt locus in WRIO cells We searched available RFLPs for an informative one that would enable us to distinguish the
1
2
3
4
5
6
Number of mutant clones analyzed
Number of clones which lost 12-kb signal (%)
None (spontaneous)
26
22 (85)
y-Rays (2 Gy)
69
64(93)
7
8
9
10
11
12
(kb)
(A)
APRT
-23.0 ~J 41
- 9.6
- 6,6 (B)
TK - 44
~
,
"
e
- 2.3
Fig. 2. Determination of the number of aprt copies in wild-type cells and y-ray-induced mutant clones. Genomic DNAs (5 p.g) from parental cells (lanes ] and 12) and from APRT-deficient mutants with allelic loss (lanes 2-]0) were digested with SphI, fractionated on a ]% agarose gel and blotted onto nylon membrane, DNA of TK6 was subjected to the same analysis simultaneously (lane ] ]). The membrane was cut into two parts at about 7 kb, The upper part was hybridized with the aprt probe (A), and the lower part, with the tk probe (B), Radioactive counts of the 8-kb aprt bands and the 6-kb tk bands were measured with Fujix Bio-lmage Analyzer. In lane 2, a signal at 12 kb is visible, but this was due to an experimental error since this signal of this clone was not reproducible in other blots.
59
two aprt alleles in the WR10 cell line. It has been shown that Sphl identifies a two-allele polymorphism with bands at either 12 kb or 8 kb (Arrand et al., 1987). WR10 DNA was digested with SphI and probed with the aprt fragment. Two bands corresponding to 12 kb and 8 kb were observed (Fig. 1, lane 12; Fig. 2A, lanes 1 and 12), indicating that WR10 is heterozygous also for SphI polymorphism. Mutation frequency Cells were exposed to 2 Gy of y-rays, which reduced the survival to 15%. DAP-resistant mu-
tant clones were induced by y-rays at a frequency of 2.5 x 10 - 4 with a background fraction of 1.1 × 10 -5 for spontaneous mutation, implying that the spontaneously arising mutants accounted for a v e r y l i m i t e d p o r t i o n o f t h e m u t a n t s isolated f r o m t h e y - r a y - i r r a d i a t e d cells.
Southern blot analysis Genomic DNA of spontaneous mutant clones was digested with SphI and subjected to Southern blot analysis using a SmaI-BamHI aprt fragment as a probe. Some mutant clones showed two bands at 12 kb and 8 kb (Fig. 1, lanes 8, 9 and
TABLE 2 DOSAGE OF APRT GENE IN SPONTANEOUS (A) AND v-RAY-INDUCED (B) DAP-RESISTANT MUTANTS Cells (A) References WR10 TK6 Mutant clones No. 2202 No. 2203 No. 2204 No. 2205 No. 2207 No. 2209 No. 2210
Radioactivity a APRT 8 kb
TK 6 kb
Ratio APRT 8 kb/ TK 6 kb
APRT 8 kb dosage b
508.3 1025.0
180.8 134.8
2.8 7.6
1.0 2.7
952.2 447.8 1007.0 615.0 668.2 362.3 758.8
370.7 79.4 194.1 321.4 219.4 100.2 137.8
2.6 5.6 5.2 1.9 3.0 3.6 5.5
0.91 2.0 1.8 0.68 1. I 1.3 2.0
805.7 1495.0
458.2 362.1
1.8 4. I
1.0 2.4
726.4 967.7 1058.0 934.8
210.0 300.1 307.1 466.1
3.5 3.2 3.4 2.0
2.0 1.8 2.0 1.1
1265.0 1614.0
241.3 168.1
5.2 9.6
1.0 1.8
599.0 1452.0
51.2 336.3
12.0 4.3
2.2 0.8
(B) c Experiment I
References WRI0 TK6 Mutant clones No. 1001 No. 1002 No. 1003 No. 1012
Experiment II References WRI0 TK6 Mutant clones No. 1006 No. 1011
Photostimulable luminescence (PSL) intensities per unit area (mm2) were measured for aprt 8-kb bands and tk 6-kb bands with the Bio-lmage Analyzer by setting the fixed window size for each film to cover the thickest band. Background inten3ities from areas adjacent to each band were subtracted from band intensities to obtain the net radioactivities. b Relative dosage of the aprt 8-kb band was obtained by dividing the ratio for each mutant clone by that for parental WRI0 cells. c Data were from two independent experiments. a
60
11), like the parental W R I 0 cells (Fig. 1, lane 12). All other mutant clones lost the 12-kb band and retained the 8-kb band only (Fig. 1, lanes 1-7 and 10). Twenty-two of 26 spontaneous mutants analyzed lost the 12-kb band (Table 1). Of 69 T-rayinduced mutant clones examined, 64 lost the 12-kb band (Table 1). No new bands were detected in either spontaneous or y-ray-induced mutants.
Analysis of copy number of the 8-kb allele To determine the number of aprt alleles remaining in the mutants which lost the 12-kb allele, we measured the radioactivity of the 8-kb bands on blots. Blotted filters of Sphl.digested DNAs were cut into two parts at about 7 kb. The upper parts were probed with the SmaI-BamHl aprt fragment (Fig. 2A), and the lower parts with the 1.5-kb BamH! tk eDNA fragment (Fig. 2B). The radioactivity of the bands detected by the tk probe was taken as the standard for the amount of total DNA loaded on each lane, since the copy number of the tk gene, mapped to chromosome 17, was not expected to be altered in DAP-resistant mutants. We observed three bands, at 6.0, 5.0 and 4.0 kb, with the tk eDNA probe in WR10 cells upon Spill digestion (Fig. 2B, lanes 1 and 12), which were predicted from the published tk sequence (Flemington et al., 1987; Slagel et al., 1987; the accession numbers are M15205 and M15206), and the 6.0-kb band was used as the standard. The aprt/tk ratio of radioactive counts in mutant cells which lost the 12-kb allele was compared with the ratio in the parental WR10 cells, in which the 8-kb allele was presumed to be one copy (Table 2). Of seven spontaneous mutant clones examined, four retained one copy of the 8-kb allele, whereas three clones had two copies. Two of six mutants induced by ,/-rays retained one copy of the 8-kb allele, and the rest had two copies. Discussion
We have examined the molecular nature of mutations at the aprt gene in a human lymphoblastoid cell line which is heterozygous at the aprt locus. Our study revealed that most of the spontaneous mutant clones analyzed arose from loss of the 12-kh band. The fact that the mutants
which showed the allelic loss always lost the allele which does not retain the polymorphic Sphl site made us rationally assume that the allele bearing the Sphl site was the aprt- allele in this cell line. The aprt- allele was duplicated in about half of the mutants examined, implying that mitotic non-disjunctions or recombinations as well as deletions are involved in spontaneous mutagenesis at the aprt locus. We have also examined the molecular nature of mutations induced by y-rays. More than 90% of the T-ray-induced mutants showed aUelie loss. As was observed for spontaneous mutants, the mutant allele was duplicated in a substantial proportion of the mutants examined. This suggests that y-rays cause loss or inactivation of autosomal genes possibly in a similar fashion to the spontaneous events. Previous studies on mutations at the aprt locus in Chinese hamster cells revealed that most of the high-frequency mutational events in a C H O cell strain heterozygous at the aprt locus were large deletions (Dewyse and Bradley, 1989). It has been shown that there are complicated chromosome rearrangements in CHO cells involving both No. 3 chromosomes which carry the aprt locus (Adair et al., 1983), while WRI0 cells have no detectable chromosome rearrangements. This could cause the differential proportion of deletions in allelic losses between CHO cells and WR10 cells. Another autosomal locus which has been studied extensively is the tk locus, Yandell et al. (1990) reported that most tk- mutants arising spontaneously or induced by X-rays from a human lymphoblastoid cell line heterozygous at the tk locus had lost the entire wild-type tk allele based on analyses using RFLP. After examining another RFLP marker on the same chromosome, they also suggested that the large, multilocus changes including the tk locus and the surrounding region are often involved in TK-defieient mutations. A similar conclusion has been drawn from the study of a mouse cell line heterozygous at the tk locus (Applegate et al., 1990). Allelic losses are frequently observed in numerous malignancies at various loci which are supposed to be tumor suppressor genes (Ponder, 1988; Stanbridge, 1990). Studies on the RB-1
61
locus in retinoblastomas have revealed that tumorigenesis may result from the reduction to homozygosity for the mutant allele at the Rb-1 locus (Cavenee et al., 1983). The proposed mecbanisms that result in homozygosity included mitotic non-disjunctions, mitotic recombinations, gene conversions and deletions. The mutational events causing APRT deficiency in WR10 cells are apparently similar to those occurring at the tumor suppressor genes. Since T-rays increased the mutation frequency at the aprt locus, and induced similar types of mutations, ~/-rays could be a strong mutagenic agent to induce human cancers with molecular changes similar to those causing spontaneous cancers. In conclusion, our assay system employing the aprt locus in WR10 cells should be useful to analyze the broad spectrum of molecular changes in somatic mutations that have been implicated in tumorigenesis.
Acknowledgements We would like to thank Ms M. Toyoda and Ms Y. Houki for technical assistance, and the Center for Molecular Biology and Genetics, Kyoto University for the use of Bio-lmage Analyzer. This work was supported by grants from the Ministry of Education, Science and Culture, and a grant from the Science and Technology Agency of Japan. References Adair, G.M.) R.L. Stallings, R.S. Nairn and MJ. Siciliano (1983) High-frequency structural gene deletion as the basis for functional hemizygosityof the adenine phosphoribosyltransferase locus in Chinese hamster ovary cells, Proc. Natl. Acad. Sci. (U.S.A.), 80, 5961-5964. Applegate, M.L., M.M. Moore, C.B. Broder, A. Burrell, G. Juhn, K.L. Kasweck, P.-F. Lin, A. Wadhams and J.C. Hozier (1990) Molecular dissection of mutations at the heterozygous thymidine kinase locus in mouse lymphoma cells, Proc. Natl. Acad. Sci. (U.S.A.), 87, 51-55. Arrand, J.E., A.M. Murray and N. Spurr (1987) Sphl restriction fragment length polymorphism on human chromosome 16 detected with an APRT gene probe, Nucleic Acids Res., 15, 9615. Bradshaw Jr., H., and P.L. Deininger (1984) Human thymidine kinase gene: molecular cloning and nucleotide sequence of a eDNA expressible in mammalian cells, Mol. Cell. Biol., 4, 2316-2320.
Broderick, T.P., D.A. Schaff, A.M. Bertino, M.IL Dush, J.A. Tischfield and P3. Stambrook (1987) Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement, Proc. Natl. Acad. Sci. (U.S.A.), 84, 3349-3353. Cavenee, W.K., T.P. Dryja, R.A. Phillips, W.F. Benedict, R. Godbout, B.L. Gallie, A.L. Murphree, L.C. Strong and R.L. White (1983) Expression of recessive alleles by chromosomal mechanisms in retinoblastoma, Nature (London), 305, 779-784. Chen, I Z., P.C. Harris, S. Apostolou, E. Baker, K. Holman, S.A. Lane, J.K. Nancarrow, S.A. Whitmore, R.L. Stallings, C.E. Hildebrand, R.I. Richards, G.R. Sutherland and D.F. Callen (1991) A refined physical map of the long arm of human chromosome 16, Genomics, 10, 308-312. DeLuca, J.G., L. Weinstein and W.G. Thilly (1983) Ultraviolet light-induced mutation of diploid human lymphoblasts, Mutation Res., 107, 347-370. Dewyse, P., and W.E.C. Bradley (1989) High-frequency deletion event at aprt locus of CHO cells: detection and characterization of endpoints, Somat. Cell Mol. Genet., 15, 19-28. Flemington, E., H.D. Bradshaw Jr., V. Traina-Dorge, V. Slagel and P.L. Deininger (1987) Sequence, structure and promoter characterization of the human thymidine kinase gene, Gene, 52, 267-277. Fratini, A., R.N. Simmers, D.F. Callen, V.J. Hyland, J.A. Tisehfield, P.J. Stamhrook and G.R. Sutherland (1986) A new location for the human adenine phosphorihosyltransferase gene (APRT) distal to the haptoglobin (HP) and fra(16Xq23) (FRAI6D) loci, Cytogenet. Cell Genet., 43, 10-13. Furth, E.E., W.G. Thilly, B.W. Penman, H.L. Liber and W.M. Rand (1981) Quantitative assay fi)r mutation in diploid human lymphoblasts using microtiter plates, Anal. Biochem., !10, 1-8. Hansen, M.F., and W.K. Cavenee (1987) Genetics of cancer predisposition, Cancer Res., 47, 5518-5527. Harwood, J., A. Tachibana and M. Meuth (1991) Multiple dispersed spontaneous mutations: a novel pathway of mutation in a malignant human cell line, Mol. Cell. Biol., 11, 3163-3170. Hidaka, Y., S.A. Tarle, T.E. O'Toole, W.N. Kelley and T.D. Palella (1987) Nucleotide sequence of the human APRT gene, Nucleic Acids Res., 15, 9086. Mimori, A., Y. Hidaka, V.C. Wu, S.A. Tarle, N. Kamatani, W.N. Kelley and T.D. Pallela (1991) A mutant allele common to the type I adenine phosphoribosyltransferase deficiency in Japanese subjects, Am. J. Hum. Genet., 48, 103-107. Murray, A.M., E. Drobetsky and J.E. Arrand (1984) Cloning the complete human adenine phosphoribosyl transferase gene, Gene, 31,233-240. Nobori, T., N. Kamatani, K. Mikanagi, Y. Nishida and K. Nishioka (1986) Establishment and characterization of B cell lines from individuals with various types of adenine phosphoribosyltransferase deficiencies, Biochem. Biophys. Res. Commun., 137, 998-1005.
62 Ponder, B. (1988) Gene losses in human tumours, Nature (London). 335, 400-402. $kopek, T.R., H.L. Liber, B.W. Penman and W.G. Thiily (1978) Isolation of a human lymphoblastoid line heterozygous at the thymidine kinase locus: possibility for a rapid human cell mutation assay, Biochem. Biophys. Res. Commun., 84, 411-416. Slagel, V,, E. Flemington, V. Traina-Dorge, H. Bradshaw Jr. and P.L. Deininger (1987) Clustering and subfamily relationships of the Alu family in the human genome, Mol. Biol. Evol., 4, 19-29. Sonoda, M., M. Takano, J. Miyahara and H. Kato (1983) Computed radiography utilizing scanning laser stimulated luminescence, Radiology, 148, 833-838. $tambrook, P.J., M.K. Dush, J.J. Trill and J.A. Tischfield (1984) Cloning of a functional human adenine phosphorihosyltransferase (APRT) gene: identification of a restriction fragment length polymorphism and preliminary analysis of DNAs from APRT-defieient families and cell mutants, Somat. Cell Mol. Genet., 10, 359-367.
Stanbridge, E.J. (1990) Human tumor suppressor genes, Annu. Rev. Genet., 24, 615-657. Tachibana, A., T. Ohbayashi, H. Takebe and IC Tatsumi (1990) Molecular changes in UV-induced and y-ray-induced mutations in human lymphoblastoid cells, Mutation Res., 230, 159-166. Tatsumi, K., and H. Takebe (1984) "},-Irradiation induces mutation in ataxia-telangiectasia lymphoblastoid cells, Gann, 75, 1040-1043. Tatsumi, K., M. Toyoda, T. Hashimoto, J. Furuyama, T. Kurihara, M. Inoue and H. Takebe (1987) Differential hypersensitivity of xeroderma pigmentosum iymphoblastold cell lines to ultraviolet light mutagenesis, Carcinogenesis, 8, 53-57. Yandell, D.W., T.P. Dryja and J.B. Little (1990) Molecular genetic analysis of recessive mutations at a heterozygous autosomal locus in human cells, Mutation Res., 229, 89102.
