Human Immunology 75 (2014) 245–249
Contents lists available at ScienceDirect
www.ashi-hla.org
journal homepage: www.elsevier.com/locate/humimm
Allelic polymorphism, mRNA and antigen expression of KIR2DL1 in the Chinese Han population Yanmin He, Sudan Tao, Yanling Ying, Ji He, Faming Zhu ⇑, Hangjun Lv Blood Center of Zhejiang Province, Hangzhou, Zhejiang, People’s Republic of China Key Laboratory of Blood Safety Research, Ministry of Health, Hangzhou, Zhejiang, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 3 July 2013 Accepted 17 December 2013 Available online 27 December 2013
a b s t r a c t KIR2DL1 is one important molecule of inhibitory receptors that recognizes a subset of HLA-C allelic products carrying Lys80. In this study, we have investigated the allelic polymorphism, mRNA and antigen expression level of KIR2DL1 in the Chinese Han population. KIR2DL1⁄001,⁄00302 and ⁄00401 alleles and seven genotypes including two copy 2DL1⁄00302, one copy 2DL1⁄00302, two copy 2DL1⁄001, one copy 2DL1⁄001, 2DL1⁄00302/2DL1⁄001, 2DL1⁄001/2DL1⁄00401, 2DL1⁄00302/2DL1⁄00401 were identified in the total 164 Chinese Han individuals. The frequency of NK cells expression KIR2DL1 was varied considerably. There was no disparity on the level of antibody-binding for different genotypes according to mean fluorescent intensity and there was almost similar frequency of antibody-binding NK cells except for group KIR2DL1⁄00302 with one copy. The frequency of NK cells expression KIR2DL1 of the individuals in the group 2DL1⁄00302 with one copy was lower than that in the group 2DL1⁄00302 with two copies. The amount of transcript was variable among the individuals and the mean value of transcript abundance in 21 individuals with one copy was lower than that in 143 individuals with two copies. In conclusion, the frequency of NK cells expression KIR2DL1 and the mRNA transcript abundance were not associated with allelic polymorphism but with gene copy number. Ó 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
1. Introduction Killer cell immunoglobulin like receptors (KIRs) are glycoproteins expressed on the cell surface of natural killer cells and a few subsets of T cells. KIRs regulate the function of these cells through interaction with human leucocyte antigen (HLA) class I molecules [1]. The KIR family has both activating and inhibitory receptors. KIR2DL1 is one important molecule of the inhibitory receptors that recognizes a subset of HLA-C allelic products carrying Lys80 [2], which is associated with disease susceptibility, transplantation outcome and donor selection [3–5]. Many clinical studies, but not all, have shown the importance of KIRs mismatch between the donor and recipient in improving the outcomes of allogeneic hemopoietic stem cell transplantation (HCT) for leukemia [6,7]. However, the ‘‘best KIR mismatch’’ donor could be selected on the basis of a single, direct measurement of the donor’s KIR repertoire and recipient’s ligand repertoire before HCT. The repertoire of KIRs can be determined at the level of genomic DNA, mRNA, or surface protein expression for selection of blood stem cell donors and other clinical studies. Leung et al. [8] showed ⇑ Corresponding author at: Blood Center of Zhejiang Province, Key Laboratory of Blood Safety Research of MOH, Wulin Road 345, Hangzhou, Zhejiang Province 310006, People’s Republic of China. Fax: +86 571 85167816. E-mail address: [email protected] (F. Zhu).
that the results of genotyping and phenotyping of KIR2DL1 were not in complete agreement, which the responding antigen was not found to be expressed on the NK cells as determined by flow cytometry analysis in the partial samples with positive for the KIR2DL1 gene [8]. Moreover, the level of transcript and surface expression of KIR2DL1 are varied considerably. In this study, we have investigated gene frequency and allele diversity of KIR2DL1 in 166 unrelated healthy individuals from the Chinese Han population by polymerase chain reaction sequence-based typing (PCR–SBT) and also analyzed the transcription level and surface expression of KIR2DL1 by real-time PCR and flow cytometry, respectively.
2. Materials and methods 2.1. Samples and nucleic acid extraction 166 samples were collected from the voluntary blood donors in Blood Center of Zhejiang Province, China. The ethnicity of them was Han and informed consent was obtained for all participants. This study was approved by the regional ethics committee in Blood Center of Zhejiang Province. Peripheral blood mononuclear cells (PBMCs) were isolated from the buffy coats using lymphocyte separation medium after density gradient centrifugation. Total RNA
0198-8859/$36.00 - see front matter Ó 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.humimm.2013.12.005
246
Y. He et al. / Human Immunology 75 (2014) 245–249
was extracted from the PBMCs using QIAamp RNA blood mini kit (Qiagen, Shanghai, China) and stored at 80 °C until used for the analysis of KIR transcript. Genomic DNA was extracted from the buffy coats with QuickGene DNA whole blood kits using a QuickGene Mini80™ Nucleic Acid Isolation Device (FujiFilm Corporation, Tokyo, Japan) according to the manufacturer’s instruction, which was used for detecting the KIR2DL1, HLA-C and KIR2DS1.
Analyzer and the sequence data were analyzed with SeqScape 2.5 software (Applied Biosystems, Foster City, CA, USA). All nucleotides sequences obtained were compared with the standard KIR2DL1 polymorphisms from the immuno polymorphism database–KIR database (www.ebi.ac.uk/ipd/kir) and every variant was analyzed and recorded. 2.5. KIR2DL1 ligand (HLA-C) was genotying by PCR–SBT method
2.2. KIR2DL1 and KIR2DS1 genotyping by PCR–SSP method To verify the presence or absence of KIR2DL1 and KIR2DS1, all samples were analyzed for KIR2DL1 and KIR2DS1 by polymerase chain reaction sequence specific primer (PCR–SSP) method, according to our previously reported [9].
To investigate the frequency of HLA-C (KIR2DL1 ligand), HLA-C allotype (C1 with Asn80 and C2 with Lys80) was determined using a high resolution polymerase chain reaction sequence-based typing according to our previously reported [11]. 2.6. Real-time PCR quantification for KIR2DL1 mRNA transcripts
2.3. PCR amplification for the complete coding region of KIR2DL1 gene The sequences for the genomic region of the KIR2DL1 gene including exon 1 to exon 9 were amplified using two pairs of overlapping primers (set 2DL1-A1 and 2DL1-B) as the previously reported [10]. The sequence of the modified 2DL1-B primer is listed in Table 1. In some samples, KIR2DS1 was coamplified with the 50 amplicon of KIR2DL1 using primer set 2DL1-A1 because of the sequence homology of the KIR2DS1 and KIR2DL1. Therefore, the allelic specific primer set 2DL1-A2 was used to amplify for KIR2DS1 in these samples. All the PCR reactions were optimized by performing in 25 ll volumes containing about 100 ng genomic DNA in 1 LA PCR buffer, 0.5 lmol/L of each primer, 200 lmol/L of each dNTP, 2.0 mmol/L MgCl2 and 0.5 unit of LA-Taq DNA polymerase (TaKaRa, Dalian, China). The PCR amplification was carried out in a PTC-240 thermocycler (MJ Research, Waltham, MA, USA) and the PCR reaction parameters for the primer pairs A1 and A2 were same as below. The thermocycling condition was performed with one cycle of 95 °C for 2 min, then contained five cycles of 95 °C for 20 s, 64 °C for 45 s, 68 °C for 5 min, followed by 32 cycles of 95 °C for 20 s, 61 °C for 45 s, 68 °C for 5 min and a final extension was carried out for 10 min at 68 °C. The PCR reaction condition for primer pair B was one cycle of 95 °C for 2 min, then five cycles of 95 °C for 20 s, 62 °C for 45 s, 68 °C for 7 min followed by 32 cycles of 95 °C for 20 s, 68 °C for 8 min and a final extension was carried out for 10 min at 68 °C. The amplificons were analyzed in 1% agarose gel stained with ethidium bromide and visualized by ultraviolet light (Genegenius, Syngene, Cambridge, UK). The amplificons were then purified with 10 units exonuclease I (TaKaRa, Dalian, China) and 2 units shrimp alkaline phosphatase (Promega, Madison, WI, USA) digestion according to the manufacturer’s instruction.
cDNA was reverse transcripted from 5 lg total RNA using Oligo(dT)20 primer and SuperScript™ III reverse transcriptase (Invitrogen Corporation, Wisconsin, USA). Then the KIR2DL1 gene was amplified by the published primers combined with short locked nucleic acid (LNA) [12,13] hydrolysis probe from a pre-designed genome wide probe library (Roche, Shanghai, China). Each amplification reaction was performed with 2 ll of cDNA, 4 ll 5 buffer, 0.2 mmol/L of each dNTP, 0.5U GO-Taq polymerase (Promega, Madison, WI, USA), 0.2 ll LNA probe (UPL probe 51) and 0.5 lmol/L forward and reverse primers in a final reaction volume of 20 ll. The Cycling parameter was 95 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 60 °C for 60 s. NKp46 gene was used as an internal control to normalize the difference in the amount of cDNA contained in each initial reaction. Considering the repeatability, each sample repeated two or three times with the amplification of KIR2DL1 and NKp46. Real-time quantitative PCR (RQ-PCR) was performed with a chromo 4 Four-color Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). The Cp value was directly related with amplicon abundance and used for the quantification parameter. For each sample, the relative transcript abundance of KIR2DL1 gene was obtained with respect to the housekeeping gene NKp46 and estimated by the 2DCp method [14], where DCp = Cp(KIR2DL1) Cp(NKp46). 2.7. KIR2DL1 gene copy number analysis Copy number assay was performed to determine whether the KIR2DL1 homozygous samples carried one or two copies as the previously reported [13]. The reference gene KIR3DL2 was used as abundance control, which presents at one copy in all haplotypes. 2.8. Detection of KIR2DL1 cell surface expression by flow cytometry
2.4. DNA sequencing for exon 1 to 9 of KIR2DL1 gene The purified amplificons were sequenced by a BigDye3.1 Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the previously reported [10], partial modified gene-specific primers of KIR2DL1 are also listed in Table 1. The sequence reaction products were processed on an ABI 3730 DNA
Surface expression of KIR2DL1 by NK cells was determined by flow cytometry using double monoclonal antibodies. PE mouse anti-human CD56 is a pan-NK-cell marker and FITC mouse anti-human CD158a (Clone HP-3E4, Becton Dickinson, Mountain View, CA) specific reacts with KIR2DL1/2DS1 molecules. Fresh PBMCs were labeled as follows: 1 106 cells of the sample in a 100 ll
Table 1 Partial primers for PCR amplification and sequencing of KIR2DL1. Name
Sequence
Nucleotide position
Usage
2DL1-E9(14029A)-R I1R I5R3 i6RN I5F2 I7R2
TGTTGTCTCYCTAGAAGACG GGCCCATGTCTCCACTTCA CATGTAGGAGGGTTTGGAGGTG TGTCAGAGCTGTGAGATGCT GGACAGAMACCCTCATTTC GAAGGCAGGGRCAGGGAGT
30 UTR, 13985–14004 I1, 399–418 I5, 5759–5780 I6, 8887–8906 I5,8713–8731 I7, 13,319–13,337
Amplification for 2DL1-B Sequencing Sequencing Sequencing Sequencing Sequencing
247
Y. He et al. / Human Immunology 75 (2014) 245–249
experimental solution were labeled with 10 ll of anti-CD56-PE and 10 ll anti-CD158a-FITC (Becton Dickinson, Mountain View, CA, USA) at room temperature protected from light. After 15 min incubation, 400 ll FACS lysing solution (Becton Dickinson, Mountain View, CA, USA) was added and mixed. An additional 15 min later, samples were analyzed on a FACScan flow cytometer measuring at least 10000 cells and analyzed by Cellquest 1.1 software (Becton Dickinson). 2.9. Statistical analysis KIR genes frequencies were calculated using the formula of Hsu et al. [15] reported and the allelic frequencies of KIR2DL1 were determined by direct counting. The GraphPrism (version 5.0) program was used for statistical analysis and the data were presented as mean ± SE. The nonparametric Mann–Whitney U test was performed for comparisons between independent groups except the number was small (n < 3). All p values reported were two-tails and p < 0.05 was considered statistically significant. In the figures, n.s. indicates not significant; ⁄⁄ indicates P < 0.01; and ⁄ indicates P < 0.05. 3. Results 3.1. Genotyping for KIR2DL1 and KIR2DS1 with PCR–SSP 164 of 166 individuals (98.80%) were positive for the KIR2DL1 and two individuals were negative for KIR2DL1 but positive for KIR2DS1. Among the 164 KIR2DL1 positive individuals, 102 individuals were only positive for KIR2DL1 and 62 individuals were positive for both KIR2DL1 and KIR2DS1. The gene frequencies of the KIR2DL1 and KIR2DS1 were 0.89 and 0.22 respectively in the Chinese Han population according to the formula of Hsu et al. [15]. 3.2. The genotype distribution and the frequency of KIR2DL1 in the Chinese Han population Only KIR2DL1⁄001, ⁄00302 and ⁄00401 alleles and no new variant were detected in our study. Of the 164 individuals with KIR2DL1 positive, 26 individuals were heterozygous for KIR2DL1 Table 2 The frequencies of KIR2DL1 alleles in the Chinese Han population. Allele
Number
Frequency
KIR2DL1⁄00302 KIR2DL1⁄001 KIR2DL1⁄00401
241 57 9
0.7850 0.1857 0.0293
and 138 individuals were homozygous by directly sequencing analysis. Based on the copy number assay, the latter ones have been divided into two groups. Among them, 117 individuals carried two copies of KIR2DL1 allele and 21 individuals carried one copies of KIR2DL1 allele. Overall, the allele frequency of KIR2DL1 was obtained by directing count method (Table 2), KIR2DL1⁄00302 was the most common allele with the frequency of 0.7850. According to the sequencing results and copy number assays, seven kinds of genotypes have been identified and the frequency of the genotypes is listed in Table 3. The most common were 99, 20 and 18 individuals carrying two copies of 2DL1⁄00302, one copy of 2DL1⁄00302 and two copies of 2DL1⁄001, respectively. 3.3. The expression of KIR2DL1 by flow cytometry Among the 164 individuals with positive for KIR2DL1, the surface expression level of KIR2DL1/2DS1 antigen was varied considerably, ranged from 8.65% to 88.1%. The data of the frequency of antigen expression and mean fluorescent intensity (MFI) on the NK cells with anti-CD158a reaction are shown in Table 3 and the individuals were categorized into different groups according to the KIR2DL1 genotype with or without KIR2DS1 (Table 3). The reaction pattern of the NK cells with anti-CD158a by flow cytometry was original from the KIR2DL1/2DS1 molecules because antihuman CD158a can react with KIR2DL1 and KIR2DS1 molecules. Therefore, we only analyzed the relationship between antigen surface expression and KIR2DL1 allelic groups in the 102 individuals with different KIR2DL1 genotypes but negative for 2DS1, which can exclude the effects of the KIR2DS1 molecules (Fig. 1). We found that there was no disparity on the level of antibody-binding for the different KIR2DL1 genotypes according to MFI values and it was also showed that there was almost similar frequency of antibody-binding NK cells except for the individuals carried one copy 2DL1⁄00302 group. The frequency of antibody-binding NK cells in the individuals carried one copy KIR2DL1⁄00302 was lower than that of the individuals carried two copy KIR2DL1⁄00302(P = 0.0046, Mann–Whitney tests). 3.4. Cognate HLA-C increases the frequency of NK cells expression KIR2DL1 According to the results of HLA-C by PCR–SBT method, all the individuals were divided into three groups as follow: 98, 55 and 11 individuals were C1/C1, C1/C2, C2/C2, respectively. Totally, 77% individuals have C1 and 23% have C2 (the KIR2DL1 ligand) in the Chinese Han population. 68 individuals carrying two copies KIR2DL1⁄00302 without KIR2DS1 were divided into three groups according to the presence
Table 3 The genotype frequency, surface expression and relative mRNA transcript abundance of KIR2DL1 in the Chinese Han population. KIR2DL1 group
GF
Relative mRNA expression Mean
SD
2DL1⁄00302 2#
99
0.6037
0.97
0.10
2DL1⁄00302 1#
20
0.1220
0.93
0.09
2DL1⁄001 2#
18
0.1098
0.97
0.08
#
1 17
0.0061 0.1037
0.81 0.97
/ 0.14
3 6
0.0183 0.0366
0.86 0.90
0.04 0.07
⁄
2DL1 001 1 2DL1⁄00302/2DL1⁄001 2DL1⁄001/2DL1⁄00401 2DL1⁄00302/2DL1⁄00401 #
Number
KIR2DS1
+ + + + + +
Number
31 68 8 12 12 6 1 6 11 3 4 2
%NK cells
MFI
Mean
SD
Mean
SD
57 64 57 50 57 65 33 74 62 72 68 65
16 15 11 17 11 8 / 11 23 6 16 8
84 87 73 83 78 75 126 76 85 82 88 69
24 22 26 24 27 12 / 20 18 9 28 15
One copy of KIR2DL1 is showed by 1, two copies are showed by 2. ‘‘GF’’: genotype frequency. MFI: mean fluorescent intensity.
248
Y. He et al. / Human Immunology 75 (2014) 245–249
100
**
60
ns
40
ns
40
ns 01 ×1
01 04
01
*0
*0
0
/2
2D
D
L1
L1
*0 L1 D
C1/C1
02
/2
C2/C2
03
01
LI 2D
2D
C1/C2
2DL1*00302×2
*0
L1
*0
03 *0 L1 2D
04
01 *0 L1
/2 02
2D
2D
D
*0 L1
03 *0 L1
01 ×2
02 ×2
02 ×1 03 *0 L1 2D
60
20
0
b
200
200
ns
ns
ns
150
150 100
MFI
MFI
ns
*
80
20
b
100
ns
80
%NK cells
a
ns
ns
%NK cells
a
100
50
ns
50
01
×1
01 L1
*0
0 C1/C1
C2/C2
03
02
2D
L1
*0
04
01 04 /2
D /2 01
D
L1
D /2
C1/C2
2DL1*00302×2
2D
LI
*0
*0
Fig. 1. The relationship between surface expression and KIR2DL1 allelic groups within the KIR2DL1+2DS1 individuals. The frequency of NK cells expressing KIR2DL1 and the antibody-binding level (mean fluorescent intensity, MFI) stratified based on the different allelic groups as plotted in (a) and (b).
or absence of C2 ligand (Fig. 2). The value of MFI among three groups was almost similar but the frequency of antibody-binding NK cells was increased in the C2 homozygotes when compared with C1 homozygotes (P = 0.0265, Mann–Whitney tests). 3.5. Relative transcript level of KIR2DL1 alleles To further characterize the heterogeneity of KIR2DL1 expression by NK cells, we used the RQ-PCR to analyze the amount of transcripts. All the individuals were divided into two groups based on the results of copy number assessment. As shown in Fig. 3, the mean mRNA transcript abundance in 21 individuals with one copy was lower than that in 143 individuals with two copies (p = 0.0197). Pairwise comparisons were made between different KIR2DL1 allelic groups to understand the polymorphic effect on the RNA transcript level. The mean value of transcript abundance of group 2DL1⁄00302 carried one copy was lower than that of group 2DL1⁄00302 carried two copies, while the mRNA expression of the group 2DL1⁄00302 carried two copies was similar to that of the groups including 2DL1⁄00302/2DL1⁄001, 2DL1⁄00302/2DL1⁄00401 and 2DL1⁄001 carried two copies (p > 0.05).
Fig. 2. The influence of cognate HLA-C on KIR2DL1 expression by NK cells. For individuals who have two copies of KIR2DL1⁄00302 and no KIR2DS1, the frequency of NK cells (a) and MFI (b) were determined by flow cytometry.
*
1.5
Relative expression
L1 2D
L1
*0
03
02
2D 2D
*0
L1
*0
01
01 ×2 *0
L1
02 ×2
L1 2D
2D
L1
*0
*0
03
03
02 ×1
0
ns
ns
*
ns ns
1.0
ns
0.5
ns 0.0
tw
s
ie
op
c o-
py
co
o
ne
*
L1
2D
02
3 00
×1 *
L1
2D
02
3 00
×2
×2 01
0 1*
L
2D
2D
2/
0 03
*0
L1
2D
L
L
2D
/ 02
01
04
0 1*
×1
01
0 1*
L
2D
03
*0
LI
2D
01
04
0 1*
2D
/ 01
*0
L1
2D
01
*0
L1
Fig. 3. The mRNA expression of KIR2DL1 relative to the housekeeping gene NKp46. Each symbol represents the relative transcript abundance of an individual sample by the 2DCp method.
4. Discussion At present, the data about allelic diversity for KIR2DL1 is available from several ethnic and some populations, such as Mestizo populations from Mexico [16], Japanese population [1], North India
Hindu population [17] and African Americans population [18]. In this study, we investigated the allelic diversity of KIR2DL1 in the Chinese Han population. Based on the sequence of coding regions, three of the 43 known 2DL1 variants were detected (KIR2DL1⁄001,
Y. He et al. / Human Immunology 75 (2014) 245–249 ⁄
00302 and ⁄00401). KIR2DL1⁄00302 was the most common allele being found in 142 individuals which was in accordance with the previous report [1,16–18], but the frequency was higher than that of African Americans population (68/100) [18]. Sixty-four of the 166 (38.5%) showed the presence of KIR2DS1, which is highly similar to that of Northern Irish population (59/154) [19]. Considering the co-amplified KIR2DS1 in the set 2DL1-A1, all the DNA samples were genotyping for KIR2DS1 by PCR–SSP and the set 2DL1-A2 primers was used to eliminate 2DS1 contamination, which can assure the accuracy the results of KIR2DL1 genotyping. The surface expression of KIR2DL1 was detected for all samples by flow cytometry in our study. In order to explore the relationship between the surface expression and allelic type for KIR2DL1, only the surface expression of the KIR2DL1 on the NK cell for KIR2DL1+2DS1 individuals was further analyzed because anti-CD158a can simultaneously recognize KIR2DL1 and KIR2DS1. There was no disparity on the level of antibody-binding for the different KIR2DL1 genotypes based on the results of 102 KIR2DL1+2DS1 individuals, which suggested that there was no correlation between allelic polymorphism of KIR2DL1 and the level of antibody-binding NK cells. This phenomenon of KIR2DL1 is completely different from that of KIR3DL1, which individuals with different KIR3DL1 allotype should display distinguish level of cell-surface expression. However, there was significant difference on the frequency of NK cell expression KIR2DL1 between group 2DL1⁄00302 with two copies and group 2DL1⁄00302 with one copy. In this way, it was presumed that the frequency of NK cells expression increased with copy number and the expression of the individuals with two copies was higher than that of individuals with one copy, which was agreement with the previously reported by Yawata et al. [1]. However, group 2DL1⁄001 with one copy was not compared with the group 2DL1⁄001 with two copies because of the small numbers and this need further to investigate in the future. The frequency of HLA-C ligand for KIR2DL1 in this study was distinguishing from that of the Japanese [1], which the frequency of HLA-C2 ligand for KIR2DL1 in the Chinese Han population (23%) was higher than that in Japanese (8%). Interestingly, it was found that 59% of individuals in this study did not carry HLA-C allele that would serve as a ligand for KIR2DL1. In these individuals without the cognate ligand, KIR2DL1 would not be ‘‘licensed’’ and are likely to be hyporeactive [20]. To further analyze the cognate HLA–KIR interactions, group 2DL3⁄00302 (carried two copies) was divided into three subgroups according to the presence or absence of C2 ligand. The presence of C2 ligand was increased the frequency of the NK cell expression KIR2DL1 and did not influence the level of the antibody-binding. The expression of KIR2DL1 in vitro will help to understand the mechanism of the cognate HLA–KIR interactions. Moreover, we investigated the mRNA expression of KIR2DL1 alleles by real-time quantitative reverse transcriptase PCR (qRT-PCR). The relative transcript abundance of KIR2DL1 allele was associated with copy number, which is in line with the results of antigen expression. McErlean et al. [13] reported that the transcript expression level of KIR2DL1⁄002 was relative lower than that of KIR2DL1⁄00302, but KIR2DL1⁄002 was not detected in our study. Interestingly, KIR2DL1⁄00302 did not show higher expression than KIR2DL1⁄001 and 2DL1⁄00401 alleles, this evidence can be presumed that the transcriptional mechanism may be not associated the expression of KIR2DL1 genotypes. In conclusion, we had obtained the data for the allelic polymorphism, mRNA and antigen expression level of KIR2DL1 in the Chinese Han population. The frequency of NK cells expression KIR2DL1 and mRNA expression were not associated with allelic
249
polymorphism but with copy number in our data. Study on the relationship between the allelic polymorphism and surface expression will help to understand functional heterogeneity of KIR2DL1 and provide useful information for donor selection and other studies. Acknowledgments This work was sponsored by Zhejiang Provincial Program for the Cultivation of High-Level Innovative Health Talents, the Science Research Foundation of Zhejiang Province (Y2090988 and LY12H10001) and Medical Science Research Foundation of Zhejiang Health Bureau (2012KYA061). The authors declare that they have no conflicts of interest relevant to the manuscript. References [1] Yawata M, Yawata N, Draghi M, Little AM, Partheniou F, Parham P. Roles for HLA and KIR polymorphisms in natural killer cell repertoire selection and modulation of effector function. J Exp Med 2006;203:633–45. [2] Fan QR, Long EO, Wiley DC. Crystal structure of the human natural killer cell inhibitory receptor KIR2DL1-HLA-CW4 complex. Nat Immunol 2001;2:452–60. [3] Kulkarni S, Martin MP, Carrington M. The Yin and Yang of HLA and KIR in human disease. Semin Immunol 2008;20:343–52. [4] Velardi A, Ruggeri L, Moretta A, Moretta L. NK cells: a lesson from mismatched hematopoietic transplantation. Trends Immunol 2002;23:438–44. [5] Leung W, Iyengar R, Turner V, Lang P, Bader P, Conn P, et al. Determinants of antileukemia effects of allogeneic NK cells. J Immunol 2004;172:644–50. [6] Beelen DW, Ottinger HD, Ferencik S, Elmaagacli AH, Peceny R, Trenschel R, et al. Genotypic inhibitory killer immunoglobulin-like receptor ligand incompatibility enhances the long-term antileukemic effect of unmodified allogeneic hematopoietic stem cell transplantation in patients with myeloid leukemias. Blood 2005;105:2594–600. [7] Davies SM, Ruggieri L, DeFor T, Wagner JE, Weisdorf DJ, Miller JS, et al. Evaluation of KIR ligand incompatibility in mismatched unrelated donor hematopoietic transplants. Killer immunoglobulin like receptor. Blood 2002;100:3825–7. [8] Leung W, Iyengar R, Triplett B, Turner V, Behm FG, Holladay MS, et al. Comparison of killer Ig-like receptor genotyping and phenotyping for selection of allogeneic blood stem cell donors. J Immunol 2005;174:6540–5. [9] Jiang K, Zhu FM, Zhang W, LV QF, He J, Fu QH, et al. The establishment of PCRSSP method for killer cell immunoglobulin-like receptor gene family and its application. Chin J Microbiol Immunol 2005;25:1044–8. [10] Hou LH, Steiner NK, Chen M, Belle I, Ng J, Hurley CK. KIR2DL1 allelic diversity: four new alleles characterized in a bone marrow transplant population and three families. Tissue Antigens 2007;69:250–4. [11] Zhu F, He Y, Zhang W, He J, He J, Xu X, et al. Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population. Int J Immunogenet 2011;38:281–4. [12] You Y, Moreira BG, Behlke MA, Owczarzy R. Design of LNA probes that improve mismatch discrimination. Nucleic Acids Res 2006;34:e60. [13] McErlean C, Gonzalez AA, Cunningham R, Meenagh A, Shovlin T, Middleton D. Differential RNA expression of KIR alleles. Immunogenetics 2010;62:431–40. [14] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001;25:402–8. [15] Hsu KC, Liu XR, Selvakumar A, Mickelson E, O’Reilly RJ, Dupont B. Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic diversity with a minimum of six basic framework haplotypes, each with multiple subsets. J Immunol 2002;169:5118–29. [16] Gutiérrez-Rodríguez ME, Sandoval-Ramírez L, Díaz-Flores M, Marsh SG, Valladares-Salgado A, Madrigal JA, et al. KIR gene in ethnic and Mestizo populations from Mexico. Hum Immunol 2006;67:85–93. [17] Rajalingam R, Krausa P, Shilling HG, Stein JB, Balamurugan A, McGinnis MD, et al. Distinctive KIR and HLA diversity in a panel of north Indian Hindus. Immunogenetics 2002;53:1009–19. [18] Hou L, Chen M, Jiang B, Ng J, Hurley CK. African Americans exhibit a predominant allele in the midst of extensive KIR2DL1 allelic diversity. Tissue Antigens 2010;76:31–4. [19] Meenagh A, Gonzalez A, Sleator C, McQuaid S, Middleton D. Investigation of killer cell immunoglobulin-like receptor gene diversity, KIR2DL1 and KIR2DS1. Tissue Antigens 2008;72:383–91. [20] Anfossi N, André P, Guia S, Falk CS, Roetynck S, Stewart CA, et al. Human NK cell education by inhibitory receptors for MHC class I. Immunity 2006;25:331–42.
Contents lists available at ScienceDirect
www.ashi-hla.org
journal homepage: www.elsevier.com/locate/humimm
Allelic polymorphism, mRNA and antigen expression of KIR2DL1 in the Chinese Han population Yanmin He, Sudan Tao, Yanling Ying, Ji He, Faming Zhu ⇑, Hangjun Lv Blood Center of Zhejiang Province, Hangzhou, Zhejiang, People’s Republic of China Key Laboratory of Blood Safety Research, Ministry of Health, Hangzhou, Zhejiang, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 3 July 2013 Accepted 17 December 2013 Available online 27 December 2013
a b s t r a c t KIR2DL1 is one important molecule of inhibitory receptors that recognizes a subset of HLA-C allelic products carrying Lys80. In this study, we have investigated the allelic polymorphism, mRNA and antigen expression level of KIR2DL1 in the Chinese Han population. KIR2DL1⁄001,⁄00302 and ⁄00401 alleles and seven genotypes including two copy 2DL1⁄00302, one copy 2DL1⁄00302, two copy 2DL1⁄001, one copy 2DL1⁄001, 2DL1⁄00302/2DL1⁄001, 2DL1⁄001/2DL1⁄00401, 2DL1⁄00302/2DL1⁄00401 were identified in the total 164 Chinese Han individuals. The frequency of NK cells expression KIR2DL1 was varied considerably. There was no disparity on the level of antibody-binding for different genotypes according to mean fluorescent intensity and there was almost similar frequency of antibody-binding NK cells except for group KIR2DL1⁄00302 with one copy. The frequency of NK cells expression KIR2DL1 of the individuals in the group 2DL1⁄00302 with one copy was lower than that in the group 2DL1⁄00302 with two copies. The amount of transcript was variable among the individuals and the mean value of transcript abundance in 21 individuals with one copy was lower than that in 143 individuals with two copies. In conclusion, the frequency of NK cells expression KIR2DL1 and the mRNA transcript abundance were not associated with allelic polymorphism but with gene copy number. Ó 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
1. Introduction Killer cell immunoglobulin like receptors (KIRs) are glycoproteins expressed on the cell surface of natural killer cells and a few subsets of T cells. KIRs regulate the function of these cells through interaction with human leucocyte antigen (HLA) class I molecules [1]. The KIR family has both activating and inhibitory receptors. KIR2DL1 is one important molecule of the inhibitory receptors that recognizes a subset of HLA-C allelic products carrying Lys80 [2], which is associated with disease susceptibility, transplantation outcome and donor selection [3–5]. Many clinical studies, but not all, have shown the importance of KIRs mismatch between the donor and recipient in improving the outcomes of allogeneic hemopoietic stem cell transplantation (HCT) for leukemia [6,7]. However, the ‘‘best KIR mismatch’’ donor could be selected on the basis of a single, direct measurement of the donor’s KIR repertoire and recipient’s ligand repertoire before HCT. The repertoire of KIRs can be determined at the level of genomic DNA, mRNA, or surface protein expression for selection of blood stem cell donors and other clinical studies. Leung et al. [8] showed ⇑ Corresponding author at: Blood Center of Zhejiang Province, Key Laboratory of Blood Safety Research of MOH, Wulin Road 345, Hangzhou, Zhejiang Province 310006, People’s Republic of China. Fax: +86 571 85167816. E-mail address: [email protected] (F. Zhu).
that the results of genotyping and phenotyping of KIR2DL1 were not in complete agreement, which the responding antigen was not found to be expressed on the NK cells as determined by flow cytometry analysis in the partial samples with positive for the KIR2DL1 gene [8]. Moreover, the level of transcript and surface expression of KIR2DL1 are varied considerably. In this study, we have investigated gene frequency and allele diversity of KIR2DL1 in 166 unrelated healthy individuals from the Chinese Han population by polymerase chain reaction sequence-based typing (PCR–SBT) and also analyzed the transcription level and surface expression of KIR2DL1 by real-time PCR and flow cytometry, respectively.
2. Materials and methods 2.1. Samples and nucleic acid extraction 166 samples were collected from the voluntary blood donors in Blood Center of Zhejiang Province, China. The ethnicity of them was Han and informed consent was obtained for all participants. This study was approved by the regional ethics committee in Blood Center of Zhejiang Province. Peripheral blood mononuclear cells (PBMCs) were isolated from the buffy coats using lymphocyte separation medium after density gradient centrifugation. Total RNA
0198-8859/$36.00 - see front matter Ó 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.humimm.2013.12.005
246
Y. He et al. / Human Immunology 75 (2014) 245–249
was extracted from the PBMCs using QIAamp RNA blood mini kit (Qiagen, Shanghai, China) and stored at 80 °C until used for the analysis of KIR transcript. Genomic DNA was extracted from the buffy coats with QuickGene DNA whole blood kits using a QuickGene Mini80™ Nucleic Acid Isolation Device (FujiFilm Corporation, Tokyo, Japan) according to the manufacturer’s instruction, which was used for detecting the KIR2DL1, HLA-C and KIR2DS1.
Analyzer and the sequence data were analyzed with SeqScape 2.5 software (Applied Biosystems, Foster City, CA, USA). All nucleotides sequences obtained were compared with the standard KIR2DL1 polymorphisms from the immuno polymorphism database–KIR database (www.ebi.ac.uk/ipd/kir) and every variant was analyzed and recorded. 2.5. KIR2DL1 ligand (HLA-C) was genotying by PCR–SBT method
2.2. KIR2DL1 and KIR2DS1 genotyping by PCR–SSP method To verify the presence or absence of KIR2DL1 and KIR2DS1, all samples were analyzed for KIR2DL1 and KIR2DS1 by polymerase chain reaction sequence specific primer (PCR–SSP) method, according to our previously reported [9].
To investigate the frequency of HLA-C (KIR2DL1 ligand), HLA-C allotype (C1 with Asn80 and C2 with Lys80) was determined using a high resolution polymerase chain reaction sequence-based typing according to our previously reported [11]. 2.6. Real-time PCR quantification for KIR2DL1 mRNA transcripts
2.3. PCR amplification for the complete coding region of KIR2DL1 gene The sequences for the genomic region of the KIR2DL1 gene including exon 1 to exon 9 were amplified using two pairs of overlapping primers (set 2DL1-A1 and 2DL1-B) as the previously reported [10]. The sequence of the modified 2DL1-B primer is listed in Table 1. In some samples, KIR2DS1 was coamplified with the 50 amplicon of KIR2DL1 using primer set 2DL1-A1 because of the sequence homology of the KIR2DS1 and KIR2DL1. Therefore, the allelic specific primer set 2DL1-A2 was used to amplify for KIR2DS1 in these samples. All the PCR reactions were optimized by performing in 25 ll volumes containing about 100 ng genomic DNA in 1 LA PCR buffer, 0.5 lmol/L of each primer, 200 lmol/L of each dNTP, 2.0 mmol/L MgCl2 and 0.5 unit of LA-Taq DNA polymerase (TaKaRa, Dalian, China). The PCR amplification was carried out in a PTC-240 thermocycler (MJ Research, Waltham, MA, USA) and the PCR reaction parameters for the primer pairs A1 and A2 were same as below. The thermocycling condition was performed with one cycle of 95 °C for 2 min, then contained five cycles of 95 °C for 20 s, 64 °C for 45 s, 68 °C for 5 min, followed by 32 cycles of 95 °C for 20 s, 61 °C for 45 s, 68 °C for 5 min and a final extension was carried out for 10 min at 68 °C. The PCR reaction condition for primer pair B was one cycle of 95 °C for 2 min, then five cycles of 95 °C for 20 s, 62 °C for 45 s, 68 °C for 7 min followed by 32 cycles of 95 °C for 20 s, 68 °C for 8 min and a final extension was carried out for 10 min at 68 °C. The amplificons were analyzed in 1% agarose gel stained with ethidium bromide and visualized by ultraviolet light (Genegenius, Syngene, Cambridge, UK). The amplificons were then purified with 10 units exonuclease I (TaKaRa, Dalian, China) and 2 units shrimp alkaline phosphatase (Promega, Madison, WI, USA) digestion according to the manufacturer’s instruction.
cDNA was reverse transcripted from 5 lg total RNA using Oligo(dT)20 primer and SuperScript™ III reverse transcriptase (Invitrogen Corporation, Wisconsin, USA). Then the KIR2DL1 gene was amplified by the published primers combined with short locked nucleic acid (LNA) [12,13] hydrolysis probe from a pre-designed genome wide probe library (Roche, Shanghai, China). Each amplification reaction was performed with 2 ll of cDNA, 4 ll 5 buffer, 0.2 mmol/L of each dNTP, 0.5U GO-Taq polymerase (Promega, Madison, WI, USA), 0.2 ll LNA probe (UPL probe 51) and 0.5 lmol/L forward and reverse primers in a final reaction volume of 20 ll. The Cycling parameter was 95 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 60 °C for 60 s. NKp46 gene was used as an internal control to normalize the difference in the amount of cDNA contained in each initial reaction. Considering the repeatability, each sample repeated two or three times with the amplification of KIR2DL1 and NKp46. Real-time quantitative PCR (RQ-PCR) was performed with a chromo 4 Four-color Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). The Cp value was directly related with amplicon abundance and used for the quantification parameter. For each sample, the relative transcript abundance of KIR2DL1 gene was obtained with respect to the housekeeping gene NKp46 and estimated by the 2DCp method [14], where DCp = Cp(KIR2DL1) Cp(NKp46). 2.7. KIR2DL1 gene copy number analysis Copy number assay was performed to determine whether the KIR2DL1 homozygous samples carried one or two copies as the previously reported [13]. The reference gene KIR3DL2 was used as abundance control, which presents at one copy in all haplotypes. 2.8. Detection of KIR2DL1 cell surface expression by flow cytometry
2.4. DNA sequencing for exon 1 to 9 of KIR2DL1 gene The purified amplificons were sequenced by a BigDye3.1 Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the previously reported [10], partial modified gene-specific primers of KIR2DL1 are also listed in Table 1. The sequence reaction products were processed on an ABI 3730 DNA
Surface expression of KIR2DL1 by NK cells was determined by flow cytometry using double monoclonal antibodies. PE mouse anti-human CD56 is a pan-NK-cell marker and FITC mouse anti-human CD158a (Clone HP-3E4, Becton Dickinson, Mountain View, CA) specific reacts with KIR2DL1/2DS1 molecules. Fresh PBMCs were labeled as follows: 1 106 cells of the sample in a 100 ll
Table 1 Partial primers for PCR amplification and sequencing of KIR2DL1. Name
Sequence
Nucleotide position
Usage
2DL1-E9(14029A)-R I1R I5R3 i6RN I5F2 I7R2
TGTTGTCTCYCTAGAAGACG GGCCCATGTCTCCACTTCA CATGTAGGAGGGTTTGGAGGTG TGTCAGAGCTGTGAGATGCT GGACAGAMACCCTCATTTC GAAGGCAGGGRCAGGGAGT
30 UTR, 13985–14004 I1, 399–418 I5, 5759–5780 I6, 8887–8906 I5,8713–8731 I7, 13,319–13,337
Amplification for 2DL1-B Sequencing Sequencing Sequencing Sequencing Sequencing
247
Y. He et al. / Human Immunology 75 (2014) 245–249
experimental solution were labeled with 10 ll of anti-CD56-PE and 10 ll anti-CD158a-FITC (Becton Dickinson, Mountain View, CA, USA) at room temperature protected from light. After 15 min incubation, 400 ll FACS lysing solution (Becton Dickinson, Mountain View, CA, USA) was added and mixed. An additional 15 min later, samples were analyzed on a FACScan flow cytometer measuring at least 10000 cells and analyzed by Cellquest 1.1 software (Becton Dickinson). 2.9. Statistical analysis KIR genes frequencies were calculated using the formula of Hsu et al. [15] reported and the allelic frequencies of KIR2DL1 were determined by direct counting. The GraphPrism (version 5.0) program was used for statistical analysis and the data were presented as mean ± SE. The nonparametric Mann–Whitney U test was performed for comparisons between independent groups except the number was small (n < 3). All p values reported were two-tails and p < 0.05 was considered statistically significant. In the figures, n.s. indicates not significant; ⁄⁄ indicates P < 0.01; and ⁄ indicates P < 0.05. 3. Results 3.1. Genotyping for KIR2DL1 and KIR2DS1 with PCR–SSP 164 of 166 individuals (98.80%) were positive for the KIR2DL1 and two individuals were negative for KIR2DL1 but positive for KIR2DS1. Among the 164 KIR2DL1 positive individuals, 102 individuals were only positive for KIR2DL1 and 62 individuals were positive for both KIR2DL1 and KIR2DS1. The gene frequencies of the KIR2DL1 and KIR2DS1 were 0.89 and 0.22 respectively in the Chinese Han population according to the formula of Hsu et al. [15]. 3.2. The genotype distribution and the frequency of KIR2DL1 in the Chinese Han population Only KIR2DL1⁄001, ⁄00302 and ⁄00401 alleles and no new variant were detected in our study. Of the 164 individuals with KIR2DL1 positive, 26 individuals were heterozygous for KIR2DL1 Table 2 The frequencies of KIR2DL1 alleles in the Chinese Han population. Allele
Number
Frequency
KIR2DL1⁄00302 KIR2DL1⁄001 KIR2DL1⁄00401
241 57 9
0.7850 0.1857 0.0293
and 138 individuals were homozygous by directly sequencing analysis. Based on the copy number assay, the latter ones have been divided into two groups. Among them, 117 individuals carried two copies of KIR2DL1 allele and 21 individuals carried one copies of KIR2DL1 allele. Overall, the allele frequency of KIR2DL1 was obtained by directing count method (Table 2), KIR2DL1⁄00302 was the most common allele with the frequency of 0.7850. According to the sequencing results and copy number assays, seven kinds of genotypes have been identified and the frequency of the genotypes is listed in Table 3. The most common were 99, 20 and 18 individuals carrying two copies of 2DL1⁄00302, one copy of 2DL1⁄00302 and two copies of 2DL1⁄001, respectively. 3.3. The expression of KIR2DL1 by flow cytometry Among the 164 individuals with positive for KIR2DL1, the surface expression level of KIR2DL1/2DS1 antigen was varied considerably, ranged from 8.65% to 88.1%. The data of the frequency of antigen expression and mean fluorescent intensity (MFI) on the NK cells with anti-CD158a reaction are shown in Table 3 and the individuals were categorized into different groups according to the KIR2DL1 genotype with or without KIR2DS1 (Table 3). The reaction pattern of the NK cells with anti-CD158a by flow cytometry was original from the KIR2DL1/2DS1 molecules because antihuman CD158a can react with KIR2DL1 and KIR2DS1 molecules. Therefore, we only analyzed the relationship between antigen surface expression and KIR2DL1 allelic groups in the 102 individuals with different KIR2DL1 genotypes but negative for 2DS1, which can exclude the effects of the KIR2DS1 molecules (Fig. 1). We found that there was no disparity on the level of antibody-binding for the different KIR2DL1 genotypes according to MFI values and it was also showed that there was almost similar frequency of antibody-binding NK cells except for the individuals carried one copy 2DL1⁄00302 group. The frequency of antibody-binding NK cells in the individuals carried one copy KIR2DL1⁄00302 was lower than that of the individuals carried two copy KIR2DL1⁄00302(P = 0.0046, Mann–Whitney tests). 3.4. Cognate HLA-C increases the frequency of NK cells expression KIR2DL1 According to the results of HLA-C by PCR–SBT method, all the individuals were divided into three groups as follow: 98, 55 and 11 individuals were C1/C1, C1/C2, C2/C2, respectively. Totally, 77% individuals have C1 and 23% have C2 (the KIR2DL1 ligand) in the Chinese Han population. 68 individuals carrying two copies KIR2DL1⁄00302 without KIR2DS1 were divided into three groups according to the presence
Table 3 The genotype frequency, surface expression and relative mRNA transcript abundance of KIR2DL1 in the Chinese Han population. KIR2DL1 group
GF
Relative mRNA expression Mean
SD
2DL1⁄00302 2#
99
0.6037
0.97
0.10
2DL1⁄00302 1#
20
0.1220
0.93
0.09
2DL1⁄001 2#
18
0.1098
0.97
0.08
#
1 17
0.0061 0.1037
0.81 0.97
/ 0.14
3 6
0.0183 0.0366
0.86 0.90
0.04 0.07
⁄
2DL1 001 1 2DL1⁄00302/2DL1⁄001 2DL1⁄001/2DL1⁄00401 2DL1⁄00302/2DL1⁄00401 #
Number
KIR2DS1
+ + + + + +
Number
31 68 8 12 12 6 1 6 11 3 4 2
%NK cells
MFI
Mean
SD
Mean
SD
57 64 57 50 57 65 33 74 62 72 68 65
16 15 11 17 11 8 / 11 23 6 16 8
84 87 73 83 78 75 126 76 85 82 88 69
24 22 26 24 27 12 / 20 18 9 28 15
One copy of KIR2DL1 is showed by 1, two copies are showed by 2. ‘‘GF’’: genotype frequency. MFI: mean fluorescent intensity.
248
Y. He et al. / Human Immunology 75 (2014) 245–249
100
**
60
ns
40
ns
40
ns 01 ×1
01 04
01
*0
*0
0
/2
2D
D
L1
L1
*0 L1 D
C1/C1
02
/2
C2/C2
03
01
LI 2D
2D
C1/C2
2DL1*00302×2
*0
L1
*0
03 *0 L1 2D
04
01 *0 L1
/2 02
2D
2D
D
*0 L1
03 *0 L1
01 ×2
02 ×2
02 ×1 03 *0 L1 2D
60
20
0
b
200
200
ns
ns
ns
150
150 100
MFI
MFI
ns
*
80
20
b
100
ns
80
%NK cells
a
ns
ns
%NK cells
a
100
50
ns
50
01
×1
01 L1
*0
0 C1/C1
C2/C2
03
02
2D
L1
*0
04
01 04 /2
D /2 01
D
L1
D /2
C1/C2
2DL1*00302×2
2D
LI
*0
*0
Fig. 1. The relationship between surface expression and KIR2DL1 allelic groups within the KIR2DL1+2DS1 individuals. The frequency of NK cells expressing KIR2DL1 and the antibody-binding level (mean fluorescent intensity, MFI) stratified based on the different allelic groups as plotted in (a) and (b).
or absence of C2 ligand (Fig. 2). The value of MFI among three groups was almost similar but the frequency of antibody-binding NK cells was increased in the C2 homozygotes when compared with C1 homozygotes (P = 0.0265, Mann–Whitney tests). 3.5. Relative transcript level of KIR2DL1 alleles To further characterize the heterogeneity of KIR2DL1 expression by NK cells, we used the RQ-PCR to analyze the amount of transcripts. All the individuals were divided into two groups based on the results of copy number assessment. As shown in Fig. 3, the mean mRNA transcript abundance in 21 individuals with one copy was lower than that in 143 individuals with two copies (p = 0.0197). Pairwise comparisons were made between different KIR2DL1 allelic groups to understand the polymorphic effect on the RNA transcript level. The mean value of transcript abundance of group 2DL1⁄00302 carried one copy was lower than that of group 2DL1⁄00302 carried two copies, while the mRNA expression of the group 2DL1⁄00302 carried two copies was similar to that of the groups including 2DL1⁄00302/2DL1⁄001, 2DL1⁄00302/2DL1⁄00401 and 2DL1⁄001 carried two copies (p > 0.05).
Fig. 2. The influence of cognate HLA-C on KIR2DL1 expression by NK cells. For individuals who have two copies of KIR2DL1⁄00302 and no KIR2DS1, the frequency of NK cells (a) and MFI (b) were determined by flow cytometry.
*
1.5
Relative expression
L1 2D
L1
*0
03
02
2D 2D
*0
L1
*0
01
01 ×2 *0
L1
02 ×2
L1 2D
2D
L1
*0
*0
03
03
02 ×1
0
ns
ns
*
ns ns
1.0
ns
0.5
ns 0.0
tw
s
ie
op
c o-
py
co
o
ne
*
L1
2D
02
3 00
×1 *
L1
2D
02
3 00
×2
×2 01
0 1*
L
2D
2D
2/
0 03
*0
L1
2D
L
L
2D
/ 02
01
04
0 1*
×1
01
0 1*
L
2D
03
*0
LI
2D
01
04
0 1*
2D
/ 01
*0
L1
2D
01
*0
L1
Fig. 3. The mRNA expression of KIR2DL1 relative to the housekeeping gene NKp46. Each symbol represents the relative transcript abundance of an individual sample by the 2DCp method.
4. Discussion At present, the data about allelic diversity for KIR2DL1 is available from several ethnic and some populations, such as Mestizo populations from Mexico [16], Japanese population [1], North India
Hindu population [17] and African Americans population [18]. In this study, we investigated the allelic diversity of KIR2DL1 in the Chinese Han population. Based on the sequence of coding regions, three of the 43 known 2DL1 variants were detected (KIR2DL1⁄001,
Y. He et al. / Human Immunology 75 (2014) 245–249 ⁄
00302 and ⁄00401). KIR2DL1⁄00302 was the most common allele being found in 142 individuals which was in accordance with the previous report [1,16–18], but the frequency was higher than that of African Americans population (68/100) [18]. Sixty-four of the 166 (38.5%) showed the presence of KIR2DS1, which is highly similar to that of Northern Irish population (59/154) [19]. Considering the co-amplified KIR2DS1 in the set 2DL1-A1, all the DNA samples were genotyping for KIR2DS1 by PCR–SSP and the set 2DL1-A2 primers was used to eliminate 2DS1 contamination, which can assure the accuracy the results of KIR2DL1 genotyping. The surface expression of KIR2DL1 was detected for all samples by flow cytometry in our study. In order to explore the relationship between the surface expression and allelic type for KIR2DL1, only the surface expression of the KIR2DL1 on the NK cell for KIR2DL1+2DS1 individuals was further analyzed because anti-CD158a can simultaneously recognize KIR2DL1 and KIR2DS1. There was no disparity on the level of antibody-binding for the different KIR2DL1 genotypes based on the results of 102 KIR2DL1+2DS1 individuals, which suggested that there was no correlation between allelic polymorphism of KIR2DL1 and the level of antibody-binding NK cells. This phenomenon of KIR2DL1 is completely different from that of KIR3DL1, which individuals with different KIR3DL1 allotype should display distinguish level of cell-surface expression. However, there was significant difference on the frequency of NK cell expression KIR2DL1 between group 2DL1⁄00302 with two copies and group 2DL1⁄00302 with one copy. In this way, it was presumed that the frequency of NK cells expression increased with copy number and the expression of the individuals with two copies was higher than that of individuals with one copy, which was agreement with the previously reported by Yawata et al. [1]. However, group 2DL1⁄001 with one copy was not compared with the group 2DL1⁄001 with two copies because of the small numbers and this need further to investigate in the future. The frequency of HLA-C ligand for KIR2DL1 in this study was distinguishing from that of the Japanese [1], which the frequency of HLA-C2 ligand for KIR2DL1 in the Chinese Han population (23%) was higher than that in Japanese (8%). Interestingly, it was found that 59% of individuals in this study did not carry HLA-C allele that would serve as a ligand for KIR2DL1. In these individuals without the cognate ligand, KIR2DL1 would not be ‘‘licensed’’ and are likely to be hyporeactive [20]. To further analyze the cognate HLA–KIR interactions, group 2DL3⁄00302 (carried two copies) was divided into three subgroups according to the presence or absence of C2 ligand. The presence of C2 ligand was increased the frequency of the NK cell expression KIR2DL1 and did not influence the level of the antibody-binding. The expression of KIR2DL1 in vitro will help to understand the mechanism of the cognate HLA–KIR interactions. Moreover, we investigated the mRNA expression of KIR2DL1 alleles by real-time quantitative reverse transcriptase PCR (qRT-PCR). The relative transcript abundance of KIR2DL1 allele was associated with copy number, which is in line with the results of antigen expression. McErlean et al. [13] reported that the transcript expression level of KIR2DL1⁄002 was relative lower than that of KIR2DL1⁄00302, but KIR2DL1⁄002 was not detected in our study. Interestingly, KIR2DL1⁄00302 did not show higher expression than KIR2DL1⁄001 and 2DL1⁄00401 alleles, this evidence can be presumed that the transcriptional mechanism may be not associated the expression of KIR2DL1 genotypes. In conclusion, we had obtained the data for the allelic polymorphism, mRNA and antigen expression level of KIR2DL1 in the Chinese Han population. The frequency of NK cells expression KIR2DL1 and mRNA expression were not associated with allelic
249
polymorphism but with copy number in our data. Study on the relationship between the allelic polymorphism and surface expression will help to understand functional heterogeneity of KIR2DL1 and provide useful information for donor selection and other studies. Acknowledgments This work was sponsored by Zhejiang Provincial Program for the Cultivation of High-Level Innovative Health Talents, the Science Research Foundation of Zhejiang Province (Y2090988 and LY12H10001) and Medical Science Research Foundation of Zhejiang Health Bureau (2012KYA061). The authors declare that they have no conflicts of interest relevant to the manuscript. References [1] Yawata M, Yawata N, Draghi M, Little AM, Partheniou F, Parham P. Roles for HLA and KIR polymorphisms in natural killer cell repertoire selection and modulation of effector function. J Exp Med 2006;203:633–45. [2] Fan QR, Long EO, Wiley DC. Crystal structure of the human natural killer cell inhibitory receptor KIR2DL1-HLA-CW4 complex. Nat Immunol 2001;2:452–60. [3] Kulkarni S, Martin MP, Carrington M. The Yin and Yang of HLA and KIR in human disease. Semin Immunol 2008;20:343–52. [4] Velardi A, Ruggeri L, Moretta A, Moretta L. NK cells: a lesson from mismatched hematopoietic transplantation. Trends Immunol 2002;23:438–44. [5] Leung W, Iyengar R, Turner V, Lang P, Bader P, Conn P, et al. Determinants of antileukemia effects of allogeneic NK cells. J Immunol 2004;172:644–50. [6] Beelen DW, Ottinger HD, Ferencik S, Elmaagacli AH, Peceny R, Trenschel R, et al. Genotypic inhibitory killer immunoglobulin-like receptor ligand incompatibility enhances the long-term antileukemic effect of unmodified allogeneic hematopoietic stem cell transplantation in patients with myeloid leukemias. Blood 2005;105:2594–600. [7] Davies SM, Ruggieri L, DeFor T, Wagner JE, Weisdorf DJ, Miller JS, et al. Evaluation of KIR ligand incompatibility in mismatched unrelated donor hematopoietic transplants. Killer immunoglobulin like receptor. Blood 2002;100:3825–7. [8] Leung W, Iyengar R, Triplett B, Turner V, Behm FG, Holladay MS, et al. Comparison of killer Ig-like receptor genotyping and phenotyping for selection of allogeneic blood stem cell donors. J Immunol 2005;174:6540–5. [9] Jiang K, Zhu FM, Zhang W, LV QF, He J, Fu QH, et al. The establishment of PCRSSP method for killer cell immunoglobulin-like receptor gene family and its application. Chin J Microbiol Immunol 2005;25:1044–8. [10] Hou LH, Steiner NK, Chen M, Belle I, Ng J, Hurley CK. KIR2DL1 allelic diversity: four new alleles characterized in a bone marrow transplant population and three families. Tissue Antigens 2007;69:250–4. [11] Zhu F, He Y, Zhang W, He J, He J, Xu X, et al. Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population. Int J Immunogenet 2011;38:281–4. [12] You Y, Moreira BG, Behlke MA, Owczarzy R. Design of LNA probes that improve mismatch discrimination. Nucleic Acids Res 2006;34:e60. [13] McErlean C, Gonzalez AA, Cunningham R, Meenagh A, Shovlin T, Middleton D. Differential RNA expression of KIR alleles. Immunogenetics 2010;62:431–40. [14] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001;25:402–8. [15] Hsu KC, Liu XR, Selvakumar A, Mickelson E, O’Reilly RJ, Dupont B. Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic diversity with a minimum of six basic framework haplotypes, each with multiple subsets. J Immunol 2002;169:5118–29. [16] Gutiérrez-Rodríguez ME, Sandoval-Ramírez L, Díaz-Flores M, Marsh SG, Valladares-Salgado A, Madrigal JA, et al. KIR gene in ethnic and Mestizo populations from Mexico. Hum Immunol 2006;67:85–93. [17] Rajalingam R, Krausa P, Shilling HG, Stein JB, Balamurugan A, McGinnis MD, et al. Distinctive KIR and HLA diversity in a panel of north Indian Hindus. Immunogenetics 2002;53:1009–19. [18] Hou L, Chen M, Jiang B, Ng J, Hurley CK. African Americans exhibit a predominant allele in the midst of extensive KIR2DL1 allelic diversity. Tissue Antigens 2010;76:31–4. [19] Meenagh A, Gonzalez A, Sleator C, McQuaid S, Middleton D. Investigation of killer cell immunoglobulin-like receptor gene diversity, KIR2DL1 and KIR2DS1. Tissue Antigens 2008;72:383–91. [20] Anfossi N, André P, Guia S, Falk CS, Roetynck S, Stewart CA, et al. Human NK cell education by inhibitory receptors for MHC class I. Immunity 2006;25:331–42.
