Proc. Natl. Acad. Sci. USA Vol. 89, pp. 10331-10335, November 1992 Neurobiology
Alternative splicing generates metabotropic glutamate receptors inducing different patterns of calcium release in Xenopus oocytes JEAN-PHILIPPE PIN*t, CHRISTIAN WAEBER*, LAURENT PREZEAU*, JOEL BOCKAERT*, STEPHEN F. HEINEMANN*
AND
*Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, Post Office Box 85800, San Diego, CA 92138-5800; tCentre National de la Recherche Scientifique (CNRS)-Institut National de la Sante et de la Recherche Medicale (INSERM) de Pharmacologie-Endocrinologie, rue de la Cardonille, 34094 Montpellier Cedex 05, France
Communicated by Charles F. Stevens, July 8, 1992
A splice variant of the metabotropic glutaABSTRACT mate receptor (mGluR) la, named mGluRlc, was isolated. Compared to mGluRla, the predicted mGluRlc protein is 302 amino acids shorter at its C-terminal end. Despite this difference, mGluRlc activates phospholipase C in Xenopus oocytes with a pharmacological prorfle identical to that of mGluRla. However, in contrast to the large fast transient responses induced by mGluRla, mGluRlc receptors elicit a small more slowly generated long-lasting oscillatory current, s in that these two receptors do not generate the same pattern of Ca2+ release in Xenopus oocytes. In situ hybridization data show that mGluRlc mRNA is expressed at a lower level than the other splice variants of mGluRl. Some differences in the regional distribution of these transcripts were observed in the cerebellum, the olfactory bulb, and the striatum.
Glutamate, the main excitatory neurotransmitter in the mammalian brain, acts on two classes of receptors (1). One class corresponds to ligand-gated channels and is composed of three main pharmacologically defined receptor types, named according to their specific agonist, N-methyl-D-aspartate, a-amino-3-hydroxy-5-methylisoxazole-4propionate (AMPA), and kainate. The AMPA and kainate receptor types are composed of several different subunits that can form heterooligomeric receptors having different properties. Glutamate also activates a second class of receptors called metabotropic receptors (mGluRs) that are coupled to guanine nucleotide binding (G) proteins and modulate the production of intracellular messengers (2-6) or the opening of ion channels (7-9). The cloning of some of these receptors (mGluRl-4) has been reported (1012). Although they contain seven hydrophobic segments that probably correspond to transmembrane a-helices, no amino acid sequence homology can be found between mGluRl-4 and the other G-protein-coupled receptors. In contrast to other seven-transmembrane domain (7-TMD) receptors that are activated by small ligands, the mGluRs possess a long N-terminal extracellular domain (11). The mGluRl receptor also possesses a very long (359 amino acids), presumably intracellular, C-terminal region (10, 12). The function of this region is not known, but it has been shown recently that a truncated version of mGluRl (named mGluRlb) lacking the last 292 C-terminal amino acid residues can be generated by alternative splicing (11). However, the function of mGluRlb has not been described. Variations in the level of intracellular Ca2+ concentration are critical in many different aspects of cell physiology. The use of specific dyes to measure variation in intracellular Ca2+ concentration reveals the complexity of Ca2+ signals. The cellular response depends not only on the amount of intracellular free Ca2+ but on the spatio-temporal variations of its The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
10331
concentration within the various cytoplasmic compartments
(13-16). In the brain, many of the effects of glutamate result
from variation in intracellular Ca2+ concentration. Accordingly, multiple and complex mechanisms are likely to be involved in the regulation of Ca2+ signals generated by glutamate particularly through the modulation of the Ca2+ permeability of the glutamate-gated channels (1, 17-19). In addition, mGluRs stimulate the release of Ca2+ from internal stores in neurons (20, 21) and in astrocytes (13, 22, 23). In the present study we report the isolation and functional characterization of a splice variant of mGluRl, mGluRlc, in which the C-terminal 312 amino acid residues are replaced by a stretch of only 10 residues. By measuring the activation of the Ca2+-activated Cl- channel, a good indicator of the intracellular variations of Ca2+ concentration in Xenopus oocytes (14), we present evidence that these two receptors generate different Ca2+ signals.
MATERIALS AND METHODS A set of primers was used to amplify the 5' end, 7-TMDs, and the 3' end of the coding sequence of mGluRl. Specific probes corresponding to each of these regions of mGluRl were then generated using random primers and used to screen rat cerebellar libraries at low and high stringency. Both oligo(dT) and random-primed cDNA libraries were constructed from poly(A)+ cerebellar RNA in AZap II (Stratagene). The oligo(dT)-primed cDNAs were size-selected (>3 kilobases) on a low-melting-temperature agarose gel before being ligated with the A vector. Approximately 106 plaques of each library were plated and screened by conventional methods. TM13 was isolated from the oligo(dT)-primed library by using the probe corresponding to the 7-TMD segment of mGluRl as described above. The sequence of TM13 was found to be identical to mGluRla, from nucleotide 1063 to nucleotide 2660 (12). The sequence of the 3' end of TM13 was found to be different from that of mGluRla (Fig. ic). TM13.15, the full-length clone of mGluRlc, was constructed by inserting the BamHI-Nco I fragment of clone RP15 (isolated from the random-primed library using the PCR fragment corresponding to the 5' end of mGluRla cDNA as a probe) into TM13 previously cut with both BamHI and Nco I. RP13.413, the full-length mGluRla clone, was constructed by inserting the Sph I-Xho I fragment of RP413 (isolated from the randomprimed library using the PRC fragment corresponding to the 3' end of mGluRla cDNA as a probe) into TM13.15 previously cut with both Xho I and Sph I. The inserts ofboth TM13.15 and RP13.413 were sequenced on both strands using 17-mer primers derived from the mGluRl sequence by using Sequenase Abbreviations: mGluR, metabotropic glutamate receptor; TMD, transmembrane domain; cRNA, complementary RNA; G protein, guanine nucleotide binding protein. tTo whom reprint requests should be addressed at: CC1PE, rue de la Cardonille, 34094 Montpellier, Cedex 05, France.
10332
Neurobiology: Pin et al.
a
Proc. Natl. Acad. Sci. USA 89 (1992)
7 TMD *
N-term
r-
-
886
-
2718
tary to bases 2658-2693), respectively]. The oligomers were labeled at their 3' end by the terminal deoxynucleotidyltransferase reaction with [a-32P]dATP. The hybridization was performed as described (25), except that 401% (vol/vol) formamide was used. Hybridization was carried out overnight at 420C. Sections were then washed at 500C in 600 mM NaCl/20 mM Tris HC1, pH 7.5/1 mM EDTA for 4 h with four buffer changes. Tissue sections were dehydrated and placed in contact with Kodak-Omat film for 3 days. The same sections were subsequently dipped in Ilford K-2 nuclear emulsion (diluted 1:1 with 0.6 M ammonium acetate); exposure time was 3 weeks. After development in D19 (diluted 1:1 with water), the sections were stained in 0.1% toluidine blue. The optical density of the film autoradiograms was measured using a computer-aided image analysis system (IMAGE Version 1.44; courtesy of Wayne Rasband, National Institute of Mental Health, Bethesda, MD). The optical density of the films over the white-matter regions was considered to represent nonspecific labeling.
-
2778
RESULTS
C-term
---I .
-1
i
.__
m.l
R.
____w' n ".,
rl-f
, " MGIuRlb
I
mGluRlc
b
mGluRlc: .. CAGGGAATGCCAA mGluRlb: ...""""" """"" mGluRla: ..." genomic: """"""""""
TTTTGCTTTAGA...
GAAGAGGCAGCC.. TTCTAACGGCAA
GTGAGTTGTCTA.
C TMD VII ... gggtgcatgtttactccgaagatgtacatcatcattgc aaacctgagaggaacgtc - 2538 P E R N V - 846 G C M F T P K M Y I I I A K
cgcagtgccttcacgacctctgatgttgtccgcatgcacgtcggtgatggcaaactgccg R
S
A
F
T
T
S
D
V
V
R M
H
V
G
D
G
K
L
P
-
2598
- 866
tgccgctccaacaccttcctcaacattttccggagaaagaagcccggggcagggaatgcc - 2658 C
R
S
N
T
F
L
N
I
F
R
R
K
K
P
G
A
G
N
A
aaTTTTGCTTTAGACCGCCAAAACACTGTCTATTGAAGTGAAATGCACCTGAGATGCAGA N
F
A L
D R
Q
N T
V
Y
*
CCAAAAATAAAAACATCGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACCCGACTGCTC
TTCCAGAGGTCATGAGTTCAATTCCCAGCAACACATGGTGGCTCACAACCATCTGTAAAG
AGATCCGATGCCCTCTTCTGGTGTATCTGAAGACAGCTACAGTGTACTTATATATAATAA ATAAATAAATCTAAAAAAATAAAAAATA
FIG. 1. Comparison of mGluRlc sequence with other splice variants of mGluRl. (a) Schematic representation of the sequence of the three splice variants of mGluR1. Open boxes, coding sequences; solid boxes, 7-TMD sequences. Identical sequences found in the different variants are joined by dashed lines. Only the introns that may be involved in the generation of these splice variants are presented. (b) Comparison of the mGluRlc sequence around the splicing site with mGluRla, mGluRlb, and the genomic sequence. (c) DNA sequence of the 3' end of mGluRlc, starting in the middle of TMD-VII. The numbers on the right refer to the position of the nucleotide (or the amino acid), number 1 corresponding to the first base (or amino acid) of the coding sequence. Lowercase type, nucleotide sequence identical to mGluRla; uppercase type, sequence specific for mGluRlc. The underlined sequence represents the B2 repetitive segment. Arrows indicate the position where the sequence starts to diverge between the different splice variants.
(United States Biochemical). The sequence of RP13.413 was found to be identical to that reported by others (10) except that the 3' untranslated region of RP13.413 is 1414 base pairs (bp) longer, in agreement with the 7.5-kilobase size of the majority of the mRNA encoding mGluRla. The preparation of oocytes and the in vitro synthesis of RNA transcripts from the cloned cDNA have been reported (24). The TM13.15 and RP13.413 plasmids were linearized with Xho I prior to sense-strand RNA transcription with T3 RNA polymerase. Each complementary RNA (cRNA) was injected (5 ng per oocyte unless otherwise indicated), and recordings from oocytes were made (in Barth's medium 3-10 days later using the two electrode voltage-clamp technique (Axoclamp-2A). Data were recorded on a PC computer and analyzed using the PCLAMP software. In situ hybridization histochemistry was performed as described (25). Briefly, Wistar rats (male, 200-300 g) were killed by decapitation, and the brains were quickly removed and frozen. Tissue sections (20 ,um thick) were thaw-mounted on gelatin-coated glass slides. The oligonucleotides (Appligene, Illkirch, France) were complementary to the bases located downstream of the splice site: oligo-I for mGluRla/b (complementary to bases 2655-2690; 5'-TCA GAC CAT GAC ACA GAC TTG CCG TTA GAA-3') and oligo-II and oligo-III specific for mGluRlc [5'-GGT CTG CAT CTC AGG TGC ATT TCA CTT CAA TAG-3' (complementary to bases 2688-2720 according to Fig. ic); and 5'-CAA TAG ACA GTG TTT TGG CGG TCT AAA GCA AAA TTG-3' (complemen-
The full-length cDNA clones for mGluRla and mGluRlc were engineered from clones isolated from rat cerebellar libraries by using mGluRla PCR fragments as probes. The sequence of mGluRlc cDNA is identical to that of mGluRla up to position 2660 (position 1 corresponds to the first nucleotide of the coding region) (Fig. 1). This position has been reported to correspond to a splice donor site (10). Downstream of position 2660, no significant sequence identity can be found between mGluRlc and mGluRlb, the other splice variant described for mGluRl, or the intron sequence (Fig. 1 a and b). This suggests that mGluRla, -b, and -c are generated by alternative splicing. The 3'-terminal 206 bp of mGluRlc cDNA were found to be 95% identical to that of the rodent B2 repetitive element (26) (underlined in Fig. ic). It has been proposed that these B2 repetitive sequences can influence the stability of the RNA (27). However, it has been shown recently that these repetitive sequences may influence gene expression rather than the stability of the RNA per se (28). An in-frame stop codon is present 30 bp downstream of the splice site in mGluRlc cDNA that results in an mGluRlc protein that is shorter than that of mGluRla (Fig. lc). The last 312 amino acids of mGluRla are replaced by a stretch of 10 amino acids in mGluRlc and by 20 amino acids in mGluRlb (Fig. la). The possible coupling of mGluRlc to phospholipase C was examined by injecting in vitro-synthesized transcripts of mGluRlc into Xenopus oocytes. Three days after injection, glutamate was observed to elicit an oscillatory inward current (Fig. 2a), typical of receptors that activate phospholipase C. Such a response has been shown to result from the activation of Ca2+-sensitive Cl- channels in response to Ca2+ released from internal stores by inositol trisphosphate (29). Accordingly, the glutamate response in mGluRlc-expressing oocytes was suppressed by intracellular injection of EGTA (Fig. 2b), whereas a response could still be observed in the absence of external Ca2+ (the oocytes were preincubated for 1 min in a Ca2+-free Barth's solution containing 5 mM EGTA and were then stimulated for 30 s with glutamate in the same buffer; data not shown). In a control experiment, intracellular EGTA did not modify the Ca2+-independent response mediated by the glutamate-gated channel GluR3 (Fig. 2b). Moreover, changing the extracellular Cl- concentration shifted the reversal potential of the glutamate response toward more positive values by 49 mV per 10-fold change in the C1concentration, as expected for a Cl- current (Fig. 2 c and d). Quisqualate, ibotenate, and trans-1-aminocyclopentyl-1,3dicarboxylate (t-ACPD) also activated the Cl- current in mGluRlc-expressing oocytes with EC50 values of 13, 0.75, 60, and 130 t&M, respectively (Fig. 3). Kainate and N-methyl-
Neurobiology: Pin et al.
Proc. Nadl. Acad. Sci. USA 89 (1992) 5)(l
a
niIi
I)
LIE
u
120-
X
RL
eRn
111 (
10333
QA
1-1
)0 *I ()()
c)
80-
)() ED -
60-
Z:)(
40-
A
lb
A
ACPD
20-
(13 Control
1120 C
0I
.\
.01
c r
1
10
100
1000
10000
FiG. 3. Pharmacological characterization of mGluRlc. Maximal inward currents elicited by different concentrations of quisqualate (QA, *), glutamate (Glu, o), ibotenate (Ibo, A), and trans-1aminocyclopentyl-1,3-dicarboxylate (ACPD, A) were measured in Xenopus oocytes injected with 5 ng of mGluRlc cRNA. Values represent the mean - SEM of 5-lOdeterminations and are expressed as percent of the maximal response elicited with 1 mM glutamate.
0
100'
a40:
9
Pi
I I
.1
[agonist] (gM)
200
II
-100
0 -40 l -80 Membrane potential (mV)
30
[PI (MM)
FIG. 2. mGluRlc receptors expressed in Xenopus oocytes activate a Ca2+-dependent C1- channel. (a) Typical response recorded from Xenopus oocytes 3 days after injection of 5 ng of mGluRic cRNA. The oocyte was voltage-clamped at -70 mV, and 1 mM
glutamate was applied for 30 s (horizontal bar). (b) The mGluRic response depends on an increase in intracellular Ca2+. The maximal inward currents induced by 1 mM glutamate or 0.3 mM kainate were recorded from 5 to 10 oocytes injected with 5 ng of either mGluRic or GluR3 cRNA, respectively. Experiment was performed on control oocytes or on oocytes injected with either 20 ni of H20 or 20 al of 10 mM EGTA 15-30 min before recordings. (c) Current-voltage relationship ofthe mGluRlc response. The maximal response induced by 1 mM glutamate in oocytes injected with mGluRIc cRNA was measured at various holding potentials ranging from -70 mV to 0 mV. (d) Variation of the reversal potential as a function of the extracellular Cl- concentrations. The reversal potential of the response elicited by 1 mM glutamate in mGluRlc cRNA-injected oocytes was measured using a 1-s ramp from -60 to +40 mV in Barth's solutions containing various C1- concentration (C being replaced by methanesulfonic acid). Each point represents the mean SEM of four or five determinations performed on different
characterize the responses elicited by mGluRlc and mGluR1a, we determined the time needed to reach the maximal response after the beginning of the response (time to peak value). Fig. 4 Right clearly shows that the responses elicited by mGluRla were maximal within the first 7 s, whateverthe maximal amplitude of the response. In contrast, mGluRlc
a
1< ._
x-
9
0
10
20
30
40
50
Time to peak (s)
mGluRla
b
_
oocytes.
D-aspartat! (400 ,uM) did not elicit detectable responses.was
The function of the C-terminal end of mGluRla examined by comparing the responses elicited by mGluRla and mGluRlc in Xenopus oocytes. Glutamate elicited much larger responses inqocytes expressing mGluRla (4084 ± 587 nA, n = 10) compared to oocytes expressing m~luRlc (426 ± 74 nA, n = 10). Using radiolabeled mGluRla and mOluRlc transcripts, we could demonstrate that this difference in the maximal amplitude of the response is not due to a differential stability of these two RNAs (data not shown), although we could not eliminate the possibility that the expression of the two proteins is somehow different. The glutamate responses elicited in mGluRic mRNAinjected oocytes often consisted of a number of oscillations, and the maximal response was rarely imasured during the first peak but rather during the second, third, or even fourth peak (Fig. 4a). In contrast, glutamate responses mediated by nGluRla often consisted of a single peak that was rarely followed by long-lasting oscillations (Fig. 4b). This shape of the Cl--current response was also observed in oocytes injected with less (0.1-1 ng) mGluRla transcripts, when the maximal
amplitude of the
response
was
in the same range
as
that measured in m~luRIc-expressing oocytes. To further
10
20
30
40
Time to peak (s)
FIG. 4./ Shapes of the glutamate responses induced in mGluRlcnOlulRla-expressing oocytes have different characteristics. (Lef~t)Typical responses elicited by 1 mM glutamate on oocytes injected with mOluRlc (a) or mGluRla (b) tripts. To obtain mGluRla-mediated responses in the same nanoamp range as mGluRic-nediated responses, 0.5-0.1 ng of mOluRla transcripts were injected in most of these experiments instead of 5 ng. In a and b, calibration bars correspond to 20 s (horizontal) and 500 nA (vertical). For the lowest race in b, the vertical calibration bar indicates 2000 nM. (Right) Time to peak values are plotted against the maximal response. The time to peak value is defined as the time needed to reach the maximal response after the response begins. (a) Values obtained from 123 oocytes injected with mGluRic transcripts from 12 experiments. (b) Values obtained from 111 oocytes injected with mGluRla transcripts from 9 experiments.
and
10334
Neurobiology: Pin et al.
the maximal response elicited by mGluR1c was much delayed after the beginning of the response. By considering only responses
Alternative splicing generates metabotropic glutamate receptors inducing different patterns of calcium release in Xenopus oocytes JEAN-PHILIPPE PIN*t, CHRISTIAN WAEBER*, LAURENT PREZEAU*, JOEL BOCKAERT*, STEPHEN F. HEINEMANN*
AND
*Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, Post Office Box 85800, San Diego, CA 92138-5800; tCentre National de la Recherche Scientifique (CNRS)-Institut National de la Sante et de la Recherche Medicale (INSERM) de Pharmacologie-Endocrinologie, rue de la Cardonille, 34094 Montpellier Cedex 05, France
Communicated by Charles F. Stevens, July 8, 1992
A splice variant of the metabotropic glutaABSTRACT mate receptor (mGluR) la, named mGluRlc, was isolated. Compared to mGluRla, the predicted mGluRlc protein is 302 amino acids shorter at its C-terminal end. Despite this difference, mGluRlc activates phospholipase C in Xenopus oocytes with a pharmacological prorfle identical to that of mGluRla. However, in contrast to the large fast transient responses induced by mGluRla, mGluRlc receptors elicit a small more slowly generated long-lasting oscillatory current, s in that these two receptors do not generate the same pattern of Ca2+ release in Xenopus oocytes. In situ hybridization data show that mGluRlc mRNA is expressed at a lower level than the other splice variants of mGluRl. Some differences in the regional distribution of these transcripts were observed in the cerebellum, the olfactory bulb, and the striatum.
Glutamate, the main excitatory neurotransmitter in the mammalian brain, acts on two classes of receptors (1). One class corresponds to ligand-gated channels and is composed of three main pharmacologically defined receptor types, named according to their specific agonist, N-methyl-D-aspartate, a-amino-3-hydroxy-5-methylisoxazole-4propionate (AMPA), and kainate. The AMPA and kainate receptor types are composed of several different subunits that can form heterooligomeric receptors having different properties. Glutamate also activates a second class of receptors called metabotropic receptors (mGluRs) that are coupled to guanine nucleotide binding (G) proteins and modulate the production of intracellular messengers (2-6) or the opening of ion channels (7-9). The cloning of some of these receptors (mGluRl-4) has been reported (1012). Although they contain seven hydrophobic segments that probably correspond to transmembrane a-helices, no amino acid sequence homology can be found between mGluRl-4 and the other G-protein-coupled receptors. In contrast to other seven-transmembrane domain (7-TMD) receptors that are activated by small ligands, the mGluRs possess a long N-terminal extracellular domain (11). The mGluRl receptor also possesses a very long (359 amino acids), presumably intracellular, C-terminal region (10, 12). The function of this region is not known, but it has been shown recently that a truncated version of mGluRl (named mGluRlb) lacking the last 292 C-terminal amino acid residues can be generated by alternative splicing (11). However, the function of mGluRlb has not been described. Variations in the level of intracellular Ca2+ concentration are critical in many different aspects of cell physiology. The use of specific dyes to measure variation in intracellular Ca2+ concentration reveals the complexity of Ca2+ signals. The cellular response depends not only on the amount of intracellular free Ca2+ but on the spatio-temporal variations of its The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
10331
concentration within the various cytoplasmic compartments
(13-16). In the brain, many of the effects of glutamate result
from variation in intracellular Ca2+ concentration. Accordingly, multiple and complex mechanisms are likely to be involved in the regulation of Ca2+ signals generated by glutamate particularly through the modulation of the Ca2+ permeability of the glutamate-gated channels (1, 17-19). In addition, mGluRs stimulate the release of Ca2+ from internal stores in neurons (20, 21) and in astrocytes (13, 22, 23). In the present study we report the isolation and functional characterization of a splice variant of mGluRl, mGluRlc, in which the C-terminal 312 amino acid residues are replaced by a stretch of only 10 residues. By measuring the activation of the Ca2+-activated Cl- channel, a good indicator of the intracellular variations of Ca2+ concentration in Xenopus oocytes (14), we present evidence that these two receptors generate different Ca2+ signals.
MATERIALS AND METHODS A set of primers was used to amplify the 5' end, 7-TMDs, and the 3' end of the coding sequence of mGluRl. Specific probes corresponding to each of these regions of mGluRl were then generated using random primers and used to screen rat cerebellar libraries at low and high stringency. Both oligo(dT) and random-primed cDNA libraries were constructed from poly(A)+ cerebellar RNA in AZap II (Stratagene). The oligo(dT)-primed cDNAs were size-selected (>3 kilobases) on a low-melting-temperature agarose gel before being ligated with the A vector. Approximately 106 plaques of each library were plated and screened by conventional methods. TM13 was isolated from the oligo(dT)-primed library by using the probe corresponding to the 7-TMD segment of mGluRl as described above. The sequence of TM13 was found to be identical to mGluRla, from nucleotide 1063 to nucleotide 2660 (12). The sequence of the 3' end of TM13 was found to be different from that of mGluRla (Fig. ic). TM13.15, the full-length clone of mGluRlc, was constructed by inserting the BamHI-Nco I fragment of clone RP15 (isolated from the random-primed library using the PCR fragment corresponding to the 5' end of mGluRla cDNA as a probe) into TM13 previously cut with both BamHI and Nco I. RP13.413, the full-length mGluRla clone, was constructed by inserting the Sph I-Xho I fragment of RP413 (isolated from the randomprimed library using the PRC fragment corresponding to the 3' end of mGluRla cDNA as a probe) into TM13.15 previously cut with both Xho I and Sph I. The inserts ofboth TM13.15 and RP13.413 were sequenced on both strands using 17-mer primers derived from the mGluRl sequence by using Sequenase Abbreviations: mGluR, metabotropic glutamate receptor; TMD, transmembrane domain; cRNA, complementary RNA; G protein, guanine nucleotide binding protein. tTo whom reprint requests should be addressed at: CC1PE, rue de la Cardonille, 34094 Montpellier, Cedex 05, France.
10332
Neurobiology: Pin et al.
a
Proc. Natl. Acad. Sci. USA 89 (1992)
7 TMD *
N-term
r-
-
886
-
2718
tary to bases 2658-2693), respectively]. The oligomers were labeled at their 3' end by the terminal deoxynucleotidyltransferase reaction with [a-32P]dATP. The hybridization was performed as described (25), except that 401% (vol/vol) formamide was used. Hybridization was carried out overnight at 420C. Sections were then washed at 500C in 600 mM NaCl/20 mM Tris HC1, pH 7.5/1 mM EDTA for 4 h with four buffer changes. Tissue sections were dehydrated and placed in contact with Kodak-Omat film for 3 days. The same sections were subsequently dipped in Ilford K-2 nuclear emulsion (diluted 1:1 with 0.6 M ammonium acetate); exposure time was 3 weeks. After development in D19 (diluted 1:1 with water), the sections were stained in 0.1% toluidine blue. The optical density of the film autoradiograms was measured using a computer-aided image analysis system (IMAGE Version 1.44; courtesy of Wayne Rasband, National Institute of Mental Health, Bethesda, MD). The optical density of the films over the white-matter regions was considered to represent nonspecific labeling.
-
2778
RESULTS
C-term
---I .
-1
i
.__
m.l
R.
____w' n ".,
rl-f
, " MGIuRlb
I
mGluRlc
b
mGluRlc: .. CAGGGAATGCCAA mGluRlb: ...""""" """"" mGluRla: ..." genomic: """"""""""
TTTTGCTTTAGA...
GAAGAGGCAGCC.. TTCTAACGGCAA
GTGAGTTGTCTA.
C TMD VII ... gggtgcatgtttactccgaagatgtacatcatcattgc aaacctgagaggaacgtc - 2538 P E R N V - 846 G C M F T P K M Y I I I A K
cgcagtgccttcacgacctctgatgttgtccgcatgcacgtcggtgatggcaaactgccg R
S
A
F
T
T
S
D
V
V
R M
H
V
G
D
G
K
L
P
-
2598
- 866
tgccgctccaacaccttcctcaacattttccggagaaagaagcccggggcagggaatgcc - 2658 C
R
S
N
T
F
L
N
I
F
R
R
K
K
P
G
A
G
N
A
aaTTTTGCTTTAGACCGCCAAAACACTGTCTATTGAAGTGAAATGCACCTGAGATGCAGA N
F
A L
D R
Q
N T
V
Y
*
CCAAAAATAAAAACATCGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACCCGACTGCTC
TTCCAGAGGTCATGAGTTCAATTCCCAGCAACACATGGTGGCTCACAACCATCTGTAAAG
AGATCCGATGCCCTCTTCTGGTGTATCTGAAGACAGCTACAGTGTACTTATATATAATAA ATAAATAAATCTAAAAAAATAAAAAATA
FIG. 1. Comparison of mGluRlc sequence with other splice variants of mGluRl. (a) Schematic representation of the sequence of the three splice variants of mGluR1. Open boxes, coding sequences; solid boxes, 7-TMD sequences. Identical sequences found in the different variants are joined by dashed lines. Only the introns that may be involved in the generation of these splice variants are presented. (b) Comparison of the mGluRlc sequence around the splicing site with mGluRla, mGluRlb, and the genomic sequence. (c) DNA sequence of the 3' end of mGluRlc, starting in the middle of TMD-VII. The numbers on the right refer to the position of the nucleotide (or the amino acid), number 1 corresponding to the first base (or amino acid) of the coding sequence. Lowercase type, nucleotide sequence identical to mGluRla; uppercase type, sequence specific for mGluRlc. The underlined sequence represents the B2 repetitive segment. Arrows indicate the position where the sequence starts to diverge between the different splice variants.
(United States Biochemical). The sequence of RP13.413 was found to be identical to that reported by others (10) except that the 3' untranslated region of RP13.413 is 1414 base pairs (bp) longer, in agreement with the 7.5-kilobase size of the majority of the mRNA encoding mGluRla. The preparation of oocytes and the in vitro synthesis of RNA transcripts from the cloned cDNA have been reported (24). The TM13.15 and RP13.413 plasmids were linearized with Xho I prior to sense-strand RNA transcription with T3 RNA polymerase. Each complementary RNA (cRNA) was injected (5 ng per oocyte unless otherwise indicated), and recordings from oocytes were made (in Barth's medium 3-10 days later using the two electrode voltage-clamp technique (Axoclamp-2A). Data were recorded on a PC computer and analyzed using the PCLAMP software. In situ hybridization histochemistry was performed as described (25). Briefly, Wistar rats (male, 200-300 g) were killed by decapitation, and the brains were quickly removed and frozen. Tissue sections (20 ,um thick) were thaw-mounted on gelatin-coated glass slides. The oligonucleotides (Appligene, Illkirch, France) were complementary to the bases located downstream of the splice site: oligo-I for mGluRla/b (complementary to bases 2655-2690; 5'-TCA GAC CAT GAC ACA GAC TTG CCG TTA GAA-3') and oligo-II and oligo-III specific for mGluRlc [5'-GGT CTG CAT CTC AGG TGC ATT TCA CTT CAA TAG-3' (complementary to bases 2688-2720 according to Fig. ic); and 5'-CAA TAG ACA GTG TTT TGG CGG TCT AAA GCA AAA TTG-3' (complemen-
The full-length cDNA clones for mGluRla and mGluRlc were engineered from clones isolated from rat cerebellar libraries by using mGluRla PCR fragments as probes. The sequence of mGluRlc cDNA is identical to that of mGluRla up to position 2660 (position 1 corresponds to the first nucleotide of the coding region) (Fig. 1). This position has been reported to correspond to a splice donor site (10). Downstream of position 2660, no significant sequence identity can be found between mGluRlc and mGluRlb, the other splice variant described for mGluRl, or the intron sequence (Fig. 1 a and b). This suggests that mGluRla, -b, and -c are generated by alternative splicing. The 3'-terminal 206 bp of mGluRlc cDNA were found to be 95% identical to that of the rodent B2 repetitive element (26) (underlined in Fig. ic). It has been proposed that these B2 repetitive sequences can influence the stability of the RNA (27). However, it has been shown recently that these repetitive sequences may influence gene expression rather than the stability of the RNA per se (28). An in-frame stop codon is present 30 bp downstream of the splice site in mGluRlc cDNA that results in an mGluRlc protein that is shorter than that of mGluRla (Fig. lc). The last 312 amino acids of mGluRla are replaced by a stretch of 10 amino acids in mGluRlc and by 20 amino acids in mGluRlb (Fig. la). The possible coupling of mGluRlc to phospholipase C was examined by injecting in vitro-synthesized transcripts of mGluRlc into Xenopus oocytes. Three days after injection, glutamate was observed to elicit an oscillatory inward current (Fig. 2a), typical of receptors that activate phospholipase C. Such a response has been shown to result from the activation of Ca2+-sensitive Cl- channels in response to Ca2+ released from internal stores by inositol trisphosphate (29). Accordingly, the glutamate response in mGluRlc-expressing oocytes was suppressed by intracellular injection of EGTA (Fig. 2b), whereas a response could still be observed in the absence of external Ca2+ (the oocytes were preincubated for 1 min in a Ca2+-free Barth's solution containing 5 mM EGTA and were then stimulated for 30 s with glutamate in the same buffer; data not shown). In a control experiment, intracellular EGTA did not modify the Ca2+-independent response mediated by the glutamate-gated channel GluR3 (Fig. 2b). Moreover, changing the extracellular Cl- concentration shifted the reversal potential of the glutamate response toward more positive values by 49 mV per 10-fold change in the C1concentration, as expected for a Cl- current (Fig. 2 c and d). Quisqualate, ibotenate, and trans-1-aminocyclopentyl-1,3dicarboxylate (t-ACPD) also activated the Cl- current in mGluRlc-expressing oocytes with EC50 values of 13, 0.75, 60, and 130 t&M, respectively (Fig. 3). Kainate and N-methyl-
Neurobiology: Pin et al.
Proc. Nadl. Acad. Sci. USA 89 (1992) 5)(l
a
niIi
I)
LIE
u
120-
X
RL
eRn
111 (
10333
QA
1-1
)0 *I ()()
c)
80-
)() ED -
60-
Z:)(
40-
A
lb
A
ACPD
20-
(13 Control
1120 C
0I
.\
.01
c r
1
10
100
1000
10000
FiG. 3. Pharmacological characterization of mGluRlc. Maximal inward currents elicited by different concentrations of quisqualate (QA, *), glutamate (Glu, o), ibotenate (Ibo, A), and trans-1aminocyclopentyl-1,3-dicarboxylate (ACPD, A) were measured in Xenopus oocytes injected with 5 ng of mGluRlc cRNA. Values represent the mean - SEM of 5-lOdeterminations and are expressed as percent of the maximal response elicited with 1 mM glutamate.
0
100'
a40:
9
Pi
I I
.1
[agonist] (gM)
200
II
-100
0 -40 l -80 Membrane potential (mV)
30
[PI (MM)
FIG. 2. mGluRlc receptors expressed in Xenopus oocytes activate a Ca2+-dependent C1- channel. (a) Typical response recorded from Xenopus oocytes 3 days after injection of 5 ng of mGluRic cRNA. The oocyte was voltage-clamped at -70 mV, and 1 mM
glutamate was applied for 30 s (horizontal bar). (b) The mGluRic response depends on an increase in intracellular Ca2+. The maximal inward currents induced by 1 mM glutamate or 0.3 mM kainate were recorded from 5 to 10 oocytes injected with 5 ng of either mGluRic or GluR3 cRNA, respectively. Experiment was performed on control oocytes or on oocytes injected with either 20 ni of H20 or 20 al of 10 mM EGTA 15-30 min before recordings. (c) Current-voltage relationship ofthe mGluRlc response. The maximal response induced by 1 mM glutamate in oocytes injected with mGluRIc cRNA was measured at various holding potentials ranging from -70 mV to 0 mV. (d) Variation of the reversal potential as a function of the extracellular Cl- concentrations. The reversal potential of the response elicited by 1 mM glutamate in mGluRlc cRNA-injected oocytes was measured using a 1-s ramp from -60 to +40 mV in Barth's solutions containing various C1- concentration (C being replaced by methanesulfonic acid). Each point represents the mean SEM of four or five determinations performed on different
characterize the responses elicited by mGluRlc and mGluR1a, we determined the time needed to reach the maximal response after the beginning of the response (time to peak value). Fig. 4 Right clearly shows that the responses elicited by mGluRla were maximal within the first 7 s, whateverthe maximal amplitude of the response. In contrast, mGluRlc
a
1< ._
x-
9
0
10
20
30
40
50
Time to peak (s)
mGluRla
b
_
oocytes.
D-aspartat! (400 ,uM) did not elicit detectable responses.was
The function of the C-terminal end of mGluRla examined by comparing the responses elicited by mGluRla and mGluRlc in Xenopus oocytes. Glutamate elicited much larger responses inqocytes expressing mGluRla (4084 ± 587 nA, n = 10) compared to oocytes expressing m~luRlc (426 ± 74 nA, n = 10). Using radiolabeled mGluRla and mOluRlc transcripts, we could demonstrate that this difference in the maximal amplitude of the response is not due to a differential stability of these two RNAs (data not shown), although we could not eliminate the possibility that the expression of the two proteins is somehow different. The glutamate responses elicited in mGluRic mRNAinjected oocytes often consisted of a number of oscillations, and the maximal response was rarely imasured during the first peak but rather during the second, third, or even fourth peak (Fig. 4a). In contrast, glutamate responses mediated by nGluRla often consisted of a single peak that was rarely followed by long-lasting oscillations (Fig. 4b). This shape of the Cl--current response was also observed in oocytes injected with less (0.1-1 ng) mGluRla transcripts, when the maximal
amplitude of the
response
was
in the same range
as
that measured in m~luRIc-expressing oocytes. To further
10
20
30
40
Time to peak (s)
FIG. 4./ Shapes of the glutamate responses induced in mGluRlcnOlulRla-expressing oocytes have different characteristics. (Lef~t)Typical responses elicited by 1 mM glutamate on oocytes injected with mOluRlc (a) or mGluRla (b) tripts. To obtain mGluRla-mediated responses in the same nanoamp range as mGluRic-nediated responses, 0.5-0.1 ng of mOluRla transcripts were injected in most of these experiments instead of 5 ng. In a and b, calibration bars correspond to 20 s (horizontal) and 500 nA (vertical). For the lowest race in b, the vertical calibration bar indicates 2000 nM. (Right) Time to peak values are plotted against the maximal response. The time to peak value is defined as the time needed to reach the maximal response after the response begins. (a) Values obtained from 123 oocytes injected with mGluRic transcripts from 12 experiments. (b) Values obtained from 111 oocytes injected with mGluRla transcripts from 9 experiments.
and
10334
Neurobiology: Pin et al.
the maximal response elicited by mGluR1c was much delayed after the beginning of the response. By considering only responses
