American Journal of Medical Genetics 40493-499 (1991)

Amber Mutation Creates a Diagnostic MaeI Site in the Androgen Receptor Gene of a Family With Complete Androgen Insensitivity Mark "rifiro, R. Lynn Prior, Nelly Sabbaghian, Leonard Pinsky, Morris Kaufman, Edward G. Nylen, Denise D. Belsham, Cheryl R. Greenberg, and Klaus Wrogemann Lady Davis Institute for Medical Research (M.T.,R.LP.,N.S.,L.P.,M.K.), Centre for Human Genetics (LP.,M.K.), Departments of Medicine (M.T.J.P.), Biology (LP.), and Pediatrics (LP.), McGill University, Montreal, Quebec; Children$ Hospital (C.R.G.) and Departments of Human Genetics (C.R.G.,K.W.) and Biochemistry and Molecular Biology (E.G.N.,LI.D.B.,K.W.), University of Manitoba, Winnipeg, Manitoba, Canada

We have discovered in the X-linked androgen receptor gene a single nucleotide substitution that is the putative cause of complete androgen insensitivity (resistance) in a family with affected individuals in 2 generations. Earlier studies on the family indicated cosegregation of mutant phenotype and the RFLPs at the loci DXSl and DXYs1. The mutation is an adenine-to-thyminetransversion in exon 8 that changes the sense of codon 882 from lysine to an amber WAG) translation termination signal. The substitution creates a recognition sequence for the restriction endonuclease MaeI: this permits ready recognition of hemizygotes and heterozygotes after amplification of genomic exon 8 by the polymerase chain reaction. The mutation predicts the synthesis of a truncated receptor that lacks 36 amino acids at the carboxy terminus of its 252-amino acid androgen-binding domain. The cultured genital skin fibroblasts of the one affected patient examined have normal levels of androgen receptor mRNA, but negligible androgen-receptor binding activity. These results accord with a variety of data from spontaneous and artificial mutations indicating that all portions of the steroid binding domain contribute to normal steroid binding by a steroid receptor.

INTRODUCTION Morphogenesisof the male internal and external genitalia, and maturation of the male secondary sexual characteristics a t puberty depend on the normal synthesis, delivery and response to androgens. The cardinal component of the androgen-response apparatus is the androgen receptor. The androgen receptor is an intracellular protein, encoded by a locus at Xq12 [Brown et al., 1989; Imperato-McGinley et al., 19901, that transduces the signal embodied by an androgen. It does so by uniting noncovalently with an androgen to form an androgen-receptor complex that, in turn, interacts with a specificregulatory sequence of nucleotides (an androgen response element) to enhance or suppress transcription of a gene under the control of a nearby promoter [Rundlett et al., 19901. Androgen-receptor complexes can also alter mRNA levels of specific target genes posttranscriptionally [Berger and Watson, 19891;they may even affect the translational efficiency of a given mRNA [Bracey and Paigen, 19881.Absent, deficient or defective androgen-receptor activity can cause 46,XY individuals to have an extreme array of sexual phenotypes ranging from apparently normal females with primary amenorrhea (complete androgen insensitivity) to apparently normal males with impaired spermatogenesis (mild androgen insensitivity). The cloning of cDNA for the human androgen receptor gene [Chang et al., 1988; Lubahn et al., 1988; Tilley et al., 1989; Trapman et al., 19881, and knowledge of its intron-exon organization [Brinkmann et al., 1989; Lubahn et al., 19891, have KEY WORDS: androgen insensitivity, anenabled us to detect 21 sequence alterations in its coding drogen receptor, nonsense portion, and one at a splice site, that are the putative or mutation, MaeI site proven causal mutations in 26 unrelated subjects or families with various phenotypes of androgen resistance Received for publication October 3,1990; revision received Janu- [Pinsky et al., 19901. Here we describe one such alteration in a family with complete androgen insensitivity: ary 18, 1991. Address reprint requests to Dr. L. Pinsky, Lady Davis Institute, a single nucleotide substitution that creates a diagnosSir Mortimer B. Davis-Jewish General Hospital, 3755 Cote Ste. tic MaeI site and a translation termination signal 36 codons away from the C-terminus of the protein. Catherine Road, Montreal, Canada H3T 1E2. 0 1991 Wiley-Liss, Inc.

494

Murayama et al.

THE FAMILY The family was ascertained three times (Fig. 1):once when the proposita (111-2) appeared as a 12-year-old with a lump in the left groin after a history of left inguinal herniorrhaphy in infancy; once as an adult when she was contacted for further studies after her first cousin, 111-10, was referred for genetic counselling; and once through 3 affected maternal nieces. It is historically interesting that we found negligible specific androgen-binding activity in her nongenital skin fibroblasts, following a report by Keenan et al. [19741, but we lost contact with her before we could confirm the finding in her genital skin fibroblasts. The latter was confirmed when she was reascertained recently; and in the past year, after the death of 11-1,the proposita's mother, we were able to use DNA from her 20-year-old nongenital skin fibroblast line to demonstrate her heterozygosity at the androgen receptor locus by molecular-genetic techniques.

DNA Isolation Forty to sixty million confluent genital skin fibroblasts were washed, collected by scraping and pelleted in 0.85% NaC1. After washing and repelleting in the same solution, they were resuspended in 2 or 4 ml of High TE (100 mM Tris-HCl,40 mM EDTA, pH 8), and lysed by adding 2 or 4 ml, respectively, of 100 mM "risHC1, pH 8, 40 mM EDTA, 0.2% SDS, 1 M NaC1, and passing the suspension repeatedly through an 18-gauge needle attached to a 10-ml syringe. After extraction with phenol, then with High TE the aqueous phases were combined and extracted with 1:l chloroform:isoamyl alcohol. DNA was precipitated by the addition of 0.2 vol 5 M NaCl and an equal volume of isopropanol. The DNA pellet was resuspended in Low TE (10 mM Tris-HC1, pH 8, 1 mM EDTA). DNA was isolated from peripheral blood lymphocytes according to Greenberg et al. 119871. Southern Blot Analysis In the Winnipeg laboratory this was performed as MATERIALS AND METHODS described previously [Greenberg et al., 19871 using diSpecific Androgen-Binding Activity azobenzyloxymethyl (DBM) paper according to the The ability of genital skin fibroblasts to bind an- method of Alwine et al. [1979]. In the Montreal laboradrogen specifically was assayed, as described previously tory, blots were obtained with Hybond-N membrane. In [Kaufman and Pinsky, 19891, on intact monolayers both laboratories the probes were labeled by random grown to confluence in 5-cm petri dishes. Replicate cul- priming [Feinberg and Vogelstein, 19831 to a specific tures were exposed to serial concentrations of r3H1an- activity greater than 5 x lo8 c p d p g . The probes used drogen (0.2-3.5 nM) alone (to measure total binding) or were various human androgen receptor cDNAs [Chang with 200-fold excess radioinert androgen (to measure et al., 19881 that recognized its DNA- and androgennonspecific binding). Specific binding, computed from binding regions, and p8 [Aldridge et al., 19841 and the difference between total and nonspecific binding at pDP34 [Page et al., 19821that recognize the anonymous each concentration, was plotted according to Scatchard loci DXSl and DXYS1, respectively. (19491, in order to estimate maximum binding capacity RNA Isolation (Bmax)and the apparent equilibrium dissociation conForty to sixty million confluent genital skin fibrostant (&). The androgens used were [17a-rnethyL3H1 blasts were washed, collected by scraping and pelleted mibolerone (74 Cihmol) and [1,2,4,~5,6,7-~H15a-dihyat room temperature in 20 mM Tris-HC1, pH 7.4. The drotestosterone (147 Ci/mmol).

I

I1

A

111

IV 1

2

3

4

5

I l l 6

11

12

Fig. 1. Family pedigree, the proposita is 111-2. 0 ,heterozygote. @, affected hemizygote.

13

Amber Mutation in the Androgen Receptor Gene pellet was vortexed gently in 4 ml of 4 M guanidinium isothiocyante, 50 mM Tris-HC1, pH 7.5, 10 mM EDTA (GMC),and the suspension was placed on a 7 ml cushion of 5.6 M CsC1,O.l M EDTA in a 12-ml polyallomer tube. RNA was pelleted in an SW-4OTi rotor (16-24 hr, 21"C, 25,000 rpm). The pellet was dissolved in 400 pl of 10 mM Tris-HC1,pH 7.5, and RNA was precipitated (overnight, - 20°C)by 40 pl sodium acetate (2 M, pH 5.5) and 1ml of 95% ethanol, before dissolving it in water treated with diethylpyrocarbonate. Northern Blot Analysis Poly(A') RNA was isolated using the Fast Track mRNA Isolation Kit (Invitrogen Corporation, San Diego, CA) according to the manufacturer's protocol. Poly (A') RNA was fractionated on 1%agarose gels containing 2.2 M formaldehyde as described [Murphy and Dotzlaw, 19891,blotted onto DBM paper [Alwine et al., 19791 and probed with androgen receptor cDNA probes labeled by the random priming method [Feinberg and Vogelstein, 19831. PCR-Amplification of Genomic Exons 2-8 This was performed essentially as described by Saiki et al. 119881using sets of flanking intronic primers [RisStalpers et al., 19901whose composition was given to us before publication by J. Trapman and A.O. Brinkmann, Erasmus University, Rotterdam. Those that bracket exon 8 are shown in Figure 4. Each 100 pl reaction mixture contained PCR buffer, 0.01% gelatin, 20 nmol each dNTP, 100 pmol each primer, 1 pg DNA, and 2.5 units of Taq polymerase, and was covered with 100 pl of mineral oil. The reaction was carried out cyclically, as above, with denaturation at 94°C for 1min, annealing a t 60°C for 2 min, and extension at 72°C for 3 min. At the end of the 35th cycle, the reaction was incubated at 72°C for 7 min. The PCR products were extracted with chloroform and then used for direct sequence analysis or to demonstrate MaeI sensitivity of mutant exon 8 by analysis of the digestion products in an 8%polyacrylamide gel. Direct DNA Sequencing PCR-amplified DNA was purified by electrophoresis on low melt LMP agarose (BRL). The primary product was excised and stored a t 4"C, or melted before removal of a 4 pl sample. Four microliters of water and 3 pl (2 pmol) of a 32Pend-labeled version of one or another of the primers used in the PCR were added to the sample, and the mixture was heated to 95°C for 5 min then allowed to cool to 50°C. Sequencing reactions using Sequenase (United States Biochemical Corp. Cleveland) were initiated exactly as described by Higuchi et al. [1988] exce t that the incubation temperature was 50°C, and Mn (final concentration, 2 pM) was added to the sequencing buffer as described by Tabor and Richardson [1989].

f+

RESULTS Genital skin fibroblasts of the proposita (111-2,Fig. 1) had negligible specific androgen-binding activity in accord with the clinical diagnosis of complete androgen insensitivity. In the same assay performed with

495

[17a-rnethyZ-3H]mibolerone,a normal genital skin fibroblast strain had a B,,, of 40 fmol/mg protein (normal: 20-45 fmol/mg protein) with a Kd of 0.1 nM (normal: 0.1-0.25 nM), and one from a subject with partial androgen insensitivity had 25 fmol/mgprotein with a Kd of 0.7 nM. Figure 2 shows a partial pedigree, wherein the proposita is 111-2, and the results of Southern analysis with the probes p8 and pDP34 on genomic DNA digested with TaqI. It is apparent that the mutant phenotype segregates with the 9-kb allele as detected by probe p8 at the DXSl locus (Fig. 2, top). Yet 11-3, the maternal aunt of the proposita, could not be assigned carrier status even though she is heterozygous for the 9- and 15-kb alleles at the locus. On the other hand, the mutant phenotype segregates with the l l - k b allele at the DXYSl locus as detected by pDP34 (Fig. 2, bottom), and 11-3 is homozygous for that allele. This result increased the suspicion that she was a carrier. Contrarily, both sets of results indicated that IV-4 was not a carrier. We next examined the androgen receptor gene of the proposita in 3 ways. Southern analysis with cDNA probes recognizing the DNA- and androgen-binding domains revealed that genomic DNA extracted from her genital skin fibroblast yielded normal patterns with the restriction enzymes EcoRI or TaqI. (Results not shown).She had the common 7-kb allele of the Hind111 dimorphism [Brown et al., 19891;the chronologyof our study made it superfluous to analyze other members of the family for informativeness of this marker. Northern analysis [Fig. 3; 13082 (DB)]exposed a normal amount of 10-kb androgen receptor mRNA in her genital skin fibroblasts. This demonstrated that the gene itself, and its transcription were grossly intact. Direct sequencing of PCR-amplifiedgenomic exons 2-8 revealed a unique sequence alteration in exon 8 (Fig. 4): an adenine-to-thymine transversion at codon 882 that changes its sense from lysine to a translation termination signal of the amber type (Fig. 5). This nucleotide substitution predicted the creation of a recognition sequence for the restriction enzyme MaeI. To test the prediction and to determine whether the maternal aunt of the proposita (11-3, Fig. 2) was hetero,zygous, we subjected PCR-amplified exon 8 from the proposita, her sister, her mother, and her maternal aunt to digestion by MaeI and analyzed its effect by PAGE. Figure 6, lanes 9-12, shows the original product (295 bp) amplified between the flanking primers identified in Figure 5. Lanes 4-7 show the original product, and the 2 fragments, 208 and 87 bp, that result from its cleavage a t the MaeI site. Lanes 2 and 3 show the results o f exposing exon 8 from 2 normal males to MaeI. It is apparent that normal exon 8 is MaeI-resistant, that exon 8 of the proposita (lane 4) is totally cleaved into the 2 expected fragments, and that her mother, aunt, and sister have both the normal and mutant types of exon 8. We have recently used MaeI-PCR analysis to demonstrate that 111-8and 111-10 (Fig. 1)are not heterozygous for the androgen receptor gene mutation, and to confirm the previous RFLP analysis indicating that IV-4 (Fig. 1) is also not a carrier.

496

Trifiro et al.

IV

6

- 15 kb -9kb - 15 kb - I? I% Fig. 2. (Top) A partial pedigree in which all relevant individuals are identified numerically exactly as in Figure 1. (Middle) The distribution of the 9- and 15-kb alleles at the DXSl locus. (Bottom) The distribution of the 11-, 12- (X chromosome), and 15-kb (Y chromosome) alleles at the DXYSl locus. Individual 11-1 was not tested (NT).

kb

- 10 - 7

Fig. 3. Northern analysis of androgen receptor (AR) mRNA extracted for LNCaP (Lymph Node Carcinoma Prostate), a human cell line that overproducesthe AR, the nongenital skin fibroblasts of a normal individual (WPO9), and the genital skin fibroblasts of a normal individual (MCHG), the proposita [DB (1308211 and three unrelated subjects with complete androgen insensitivity. LEL and 6779 have different nucleotide alterations leading to different missense substitutions at Arg 773 [numbered according to Chang et al., 19881 in the AR protein (manuscript submitted). The molecular-genetic defect in NHL is not yet known.

DISCUSSION We have used standard molecular-genetic technology to define the mutational basis for complete androgen insensitivity in 2 generations of a Canadian family. The presence of normal androgen receptor mRNA and the absence of measurable specific androgen-binding activity in the genital skin fibroblasts of the proposita sug-

gested a nonsense or missense mutation in the coding portion of the androgen receptor gene. By sequencing exons 2-8, the exons encoding the DNA-binding and androgen-binding domains of the androgen receptor, we found a single nucleotide substitution that is the putative pathogenic mutation in the androgen receptor gene: it is an A+ T transversion at codon 882 that changes its sense from lysine to an amber translational stop signal.

hAR

Binding Domain

-

Androgen

DNA

918

1

___---

_- _- _ - -_- _ -_- _ - - _ _ _ _ _ _ _ _ - - -_- -_ _ _ - -

_ _ - _- _ _ - - -

.-_ _ - -

'. '.

-.

ACCTCCTTGTCACCCTGTTTTTCTCCCTCTTATTGTTCCCTACAG primerA

ATT GCG AGA GAG CTG CAT CAG TTC ACT TTT GAC CTG CTA I l e A l a A r g G l u L e u H i s G l n Phe T h r phe A s p L e u L e u T STOP

ATG GTG AGC GTG GAC T T T CCG GAA ATG

,

M e t V a l Ser V a l A s p Phe P r o G l u M e t 882, Mae I

ATG GCA GAG ATC ATC TCT GTG CAA GTG CCC AAG ATC CTT M e t A l a G l u I l e I l e Ser V a l G l n V a l P r o L y s I l e L e u TCT GGG AAA GTC AAG CCC ATC TAT TTC CAC ACC CAG TGAA S e r G l y L y s V a l L y s P r o I l e T y r Phe H i s T h r G l n

CTGCACACTCCTCTGCAGTGCCTT

+ primer6

Fig. 4. Location and context of the Lys-882 stop mutation in the androgen receptor, and in the nucleotide and amino acid sequences of exon 8 of the androgen receptor gene. The flanking primers used for the polymerase chain reaction are indicated by underlines and arrows. The A+T transversion and the Lys+ ter substitution at codon 882 are indicated in bold face type. The Mae1 site created by the mutation (CTAG) is identified by the bracket connecting codons 881 and 882.

C-terminus

I. GATC

G ATC

z]

Lys Ter[

* A

2T *

1 N-terminal

Normal

13082 (DB)

Fig. 5 . The direct dideoxynucleotidesequence ladders of codons 880-884 from normal DNA compared to that from DNA of the proposita [13082 (DB)]. The A-T transversion at codon 882 is asterisked.

498

Trifiro et al.

1

603

-

118

-

72

-

2

3

4

5

6

7

8

9

101112

m-

Fig. 6. Polyacrylamide gel analysis of PCR-amplified exon 8 before and after digestion with Mael. The size markers in lanes 1and 8 were generated by HaeIII digestion of 4X174RF. Lanes 2 and 3 show the MaeI-resistant PCR product (295 bp) of two unrelated normal males. Lane 4 shows the PCR fragments of 208 and 87 bp generated by Mae1 digestion of the 295-bp product of the proposita (lane 9). Lanes 5 and 6 represent the proposita’s mother and sister, obligate heterozygotes, and shows the Mael-digested PCR-fragment patterns expected from the presence of one normal and one mutant allele. Lane 7 shows that the proposita’s maternal aunt is a heterozygote as well. The slightly larger fragment above the normal allele in lanes 5-7 is a n artifact that probably represents a heteroduplex formed from the parental 295-bp product with its 87-bp fragment.

We have not ruled out the small chance of a coexisting stop mutation in exon 1,the one encoding the relatively long N-terminal domain of the androgen receptor [Faber et al., 19891.Notwithstanding this limitation, it is worth noting the considerable evidence that all parts of a steroid-binding domain contribute to normal steroid binding by a steroid receptor. For example, C-terminal truncations that remove as few as 5 or 14 amino acids from the rat glucocorticoid receptor seriously impair its glucocorticoid-binding affinity [Rusconi and Yamamoto, 19871. And, one that removes 29 amino acids leaves barely detectable residual glucocorticoid-bindingactivity [Rusconi and Yamamoto, 19871. The Lys-882 ter mutation in the present family appears to be similar to the latter. Likewise, a missense mutation at codon 546 of the mouse glucocorticoid receptor abolishes its hormone-binding activity and this position is close t o the N-terminus of the glucocorticoid-bindingdomain [Danielson et al., 19861. Indeed, we have found [Pinsky et al., 19901 a missense sequence alteration at the extreme N-terminus of the androgen-binding domain in the DNA of a subject with complete androgen insensitivity whose genital skin fibroblasts have negligible specific androgen-binding activity. The androgen-binding domain of the androgen receptor shares a t least 50% amino acid sequence homology with the hormone-binding domains of the receptors for progesterone (P), glucocorticoid (G), and mineralocorticoid (M) [Chang et al., 19881. In contrast, the codons homologous to Lys-882 in the androgen receptor are

represented by glutamine, glutamic acid, and aspartic acid in the PR, GR, and MR, respectively. This accords with the expectation that nonsense mutations will be more likely than missense mutations to be found at positions that are evolutionarily unconserved. The creation of a Mae1 restriction site by the A-T transversion a t codon 882 has been valuable in confirming, identifying or negating heterozygosity for the mutant allele a t the AR locus in the present family. We have found 4 translation stop mutations among 21 different coding sequence alterations in the AR genes of 26 unrelated families with various degrees of androgen insensitivity [Pinsky et al., 19901. One, at codon 717, has been published previously [Sai et al., 19901. Marcelli et al. [1990a,bl have reported stop mutations a t 2 different positions in the coding region of the androgen receptor gene in two unrelated patients with complete androgen resistance. One, in exon 3, was associated with a decreased concentration of genital skin fibroblast androgen receptor mRNA [Marcelli et al., 1990bl; the other, in exon 6 , was not [Marcelli et al., 1990al. The premature termination mutation reported here appears to mimic the latter.

ACKNOWLEDGMENTS We thank S. Liao for the androgen receptor cDNA probes, Rose Lumbroso and Rhona Rosenzweig for faithful assistance. This work was supported by the Medical Research Council of Canada Group in Genetics (L.P.),by the Manitoba Health Research Council and Children’s Hospital of Winnipeg Research Foundation (K.W.), and an MRC Studentship (D.D.B.). REFERENCES Aldridge J , Kunkel L, Bruns G, Tantravahi U, Lalande M, Brewster T, Moreau E, Wilson M, Bromley W, Roderick T, Latt SA (1984): A strategy to reveal high-frequency RFLPs along the human X chromosome. Am J Hum Genet 36546-564. Alwine JC, Kemp DJ, Parker BA, Reiser J , Renart J , Stark GR, Wahl GM (1979): Detection of specific RNAs or specific fragments of DNA by fractionation in gels and transfer to diazobenzyloxymethyl paper. Methods Enzymol 68:220-242. Berger FG, Watson G (1989): Androgen-regulated gene expression. Annu Rev Physiol 51:51-65. Bracey L, Paigen K (1988): Androgen induction of P-glucuronidase translational yield in submaxillary gland of B6.N mice. Mol Endocrinol 2:701-705. Brinkman AO, Faber PW, van Rooij HCJ, Kuiper GGJM, Ris C, Klaassen P, van der Korput JAGM, Voorhorst MM, van Laar J H , Mulder E, Trapman J (1989): The human androgen receptor: Domain structure, genomic organization and regulation of expression. J Steroid Biochem 34:l-6. Brown CJ, Goss SJ, Lubahn DB, Joseph DR, Wilson EM, French FS, Willard HF (1989):Androgen receptor locus on the human X chromosome: Regional localization to Xqll-12 and description of a DNA polymorphism. Am J Hum Genet 44264-269. Chang C, Kokontis J, Liao S (1988):Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA 85:7211-7215. Danielsen M, Northrop JP, Ringold GM (1986): The mouse glucocorticoid receptor: mapping of functional domains by cloning, sequencing and expression of wild-type and mutant receptor proteins. EMBO J 52513-2522. Faber PW, Kuiper GGJM, van Rooij HCJ, van der Korput JAGM, Brinkmann AO, Trapman J (1989): The N-terminal domain of the human androgen receptor is encoded by one large exon. Mol Cell Endocrinol 61:257-262.

Amber Mutation in the Androgen Receptor Gene Feinberg AB, Vogelstein B (1983):A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6-13. Greenberg CR, Hamerton JL, Nigli M, Wrogemann K (1987): DNA studies in a family with Duchenne muscular dystrophy and a deletion at Xp21. Am J Hum Genet 41:128-137. Higuchi R, von Beroldingen CH, Sensabaugh GF, Erlich HA (1988): DNA typing from single hairs. Nature (London) 332543446, Imperato-McGinely J , Ip NY, Gautier T, Neuweiler J , Gruenspan H, Liao S, Chang C, Balazs I(1990): DNA linkage analysis and studies of the androgen receptor gene in a large kindred with complete androgen insensitivity. Am J Med Genet 36:104-108. Kaufman M, Pinsky L (1989): A single-site allosteric model of intracellular androgen-receptor interaction. J Steroid Biochem 32:113119. Keenan BS, Meyere I11 WJ, Hadjian AJ,Jones HW, Migeon CJ (1974): Syndrome of androgen insensitivity in man: Absence of 5a-dihydrotestosterone binding protein in skin fibroblasts. J Clin Endocrinol Metab 38:1143-1146. Lubahn DB, Brown TR, Simental JA, Higgs HN, Migeon CJ, Wilson EM, French FS (1989):Sequence of the introdexon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc Natl Acad Sci USA 869534-9538. Lubahn DB, Joseph DR, Sullivan PM, Willard HF, French FS, Wilson EM (1988): Cloning of human androgen receptor complementary DNA and localization to the X chromosome. Science 240:327-330. Marcelli M, Tilley WD, Wilson CM, Wilson JD, Griffn JE, McPhaul MJ (1990a): A single nucleotide substitution introduces a premature termination codon into the androgen receptor gene of a patient with receptor-negative androgen resistance. J Clin Invest 8515221528. Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul MJ (1990b):Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: Premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol Endocrinol 4:1105-1116. Murphy LA, Dotzlaw H (1989): Regulation of transforming growth factor Q and transforming growth factor p messenger ribonucleic acid abundance in T-47D, human breast cancer cells. Mol Endocrinol 3:611-617.

499

Page D, DeMartinville B, Barker D, Wyman A, White R, Francke U, Botstein D (1982):Single-copysequence hybridizes to polymorphic and homologous loci on human X and Y chromosomes. Proc Natl Acad Sci USA 795352-5356. Pinsky L, Trifiro M, Prior L, Sabbaghian N, Bouchard J , Bordet S, Mhatre A, Lumbroso R, Kaufman M, Gottlieb B (1990):The molecular genetics of androgen insensitivity syndromes in man. In Wachtel SS, Simpson J L (eds):“Molecular Genetics of Sex Determination.” Oxford Blackwell Scientific Publications. In press. Ris-Stalpers C, Kuiper GGJM, Faber PW, Schweikert HU, van Rooij HCJ, Zagers ND, Hodgins MB, Degenhart HJ, Trapman J, Brinkmann A0 (1990): Aberrant splicing of androgen receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity. Proc Natl Acad Sci USA 87: 7866-7870. Rundlett SE, Wu X-P, Miesfeld RL (1990):Functional characterizations of the androgen receptor confirm that the molecular basis of androgen action is transcriptional regulation. Mol Endocrinol4:708714. Rusconi S. Yamamoto K (1987): Functional dissection of the hormone and DNA binding activities of the glucocorticoid receptor. EMBO d 6:1309-1315. Sai T, Seino S, Chang C, Trifiro M, Pinsky L, Mhatre A, Kaufman M, Lambert B, Trapman J , Brinkmann AO, Rosenfeld RL, Liao S (1990):An exonic point mutation of the androgen receptor gene in a family with complete androgen insensitivity. Am J Hum Genet 46:1095-1100. Scatchard G (1949):The attractions of proteins for small molecules and ions. Ann NY Acad Sci 51:660-672. Tabor S, Richardson CG (1989): Effect of manganese ions on the incorporation of dideoxynucleotides by bacteriophage T7 DNA polymerase and Escherichia coli DNA polymerase I. Proc Natl Acad Sci USA 86:4076-4080. Tilley WD, Marcelli M, Wilson JD, McPhaul MJ (1989):Characterization and expression of a cDNA encoding the human androgen receptor. Roc Natl Acad Sci USA 86:327-331. Trapman J , Klaassen P, Kuiper GGJM, van der Korput JAGM, Faber PW, van Rooij HCJ, van Kessel AG, Voorhorst MM, Mulder E, Brinkmann A 0 (1988): Cloning, structure and expression of a cDNA encoding the human androgen receptor. Biochem Biophys Fks Commun 153:241-248.

Amber mutation creates a diagnostic MaeI site in the androgen receptor gene of a family with complete androgen insensitivity.

We have discovered in the X-linked androgen receptor gene a single nucleotide substitution that is the putative cause of complete androgen insensitivi...
686KB Sizes 0 Downloads 0 Views