THE ANATOMICAL RECORD 299:450–460 (2016)

Ameliorative Effect of Grape Seed Proanthocyanidin Extract on CadmiumInduced Meiosis Inhibition During Oogenesis in Chicken Embryos FUYIN HOU,1,2 MIN XIAO,1 JIAN LI,1 DEVIN W. COOK,3 WEIDONG ZENG,1 CAIQIAO ZHANG,1* AND YULING MI1* 1 Key Laboratory of Molecular Animal Nutrition of the Ministry of Education and Department of Veterinary Medicine, College of Animal Sciences, Zhejiang University, Hangzhou, People’s Republic of China 2 Agricultural Sciences Institute of Coastal Region of Jiangsu, Yancheng, People’s Republic of China 3 Dale Bumpers College of Agriculture, Food and Life Sciences, University of Arkansas, Fayetteville, Arkansas, USA

ABSTRACT Cadmium (Cd) is an environmental endocrine disruptor that has toxic effects on the female reproductive system. Here the ameliorative effect of grape seed proanthocyanidin extract (GSPE) on Cd-induced meiosis inhibition during oogenesis was explored. As compared with controls, chicken embryos exposed to Cd (3 mg/egg) displayed a changed oocyte morphology, decreased number of meiotic germ cells, and decreased expression of the meiotic marker protein gH2AX. Real time RT-PCR also revealed a significant down-regulation in the mRNA expressions of various meiosis-specific markers (Stra8, Spo11, Scp3, and Dmc1) together with those of Raldh2, a retinoic acid (RA) synthetase, and of the receptors (RARa and RARb). In addition, exposure to Cd increased the production of H2O2 and malondialdehyde in the ovaries and caused a corresponding reduction in glutathione and superoxide dismutase. Simultaneous supplementation of GSPE (150 mg/egg) markedly alleviated the aforementioned Cd-induced embryotoxic effects by upregulating meiosis-related proteins and gene expressions and restoring the antioxidative level. Collectively, the findings provided novel insights into the underlying mechanism of Cd-induced meiosis inhibition and indicated that GSPE might potentially ameliorate related reproductive disorders. Anat Rec, 299:450–460, C 2016 Wiley Periodicals, Inc. 2016. V

Key words: cadmium; meiosis; retinoic acid; antioxidant; chicken embryos

Grant sponsors: Program for New Century Excellent Talents in University, National Natural Science Foundation of China, and the Scientific Research Foundation for the Returned Overseas Chinese Scholars from State Education Ministry; Grant numbers: NCET-13-0519, 31001041, 31272525 and 94. *Correspondence to: Yuling Mi; College of Animal Sciences, Zhejiang University, No. 866 Yuhangtang Road, Hangzhou 310058, People’s Republic of China. Fax: 86-571-88982976. E-mail: [email protected] OR Caiqiao Zhang; College of C 2016 WILEY PERIODICALS, INC. V

Animal Sciences, Zhejiang University, No. 866 Yuhangtang Road, Hangzhou 310058, P.R. China. Fax: 86-571-88982976. E-mail: [email protected] Received 4 February 2015; Revised 24 November 2015; Accepted 18 December 2015. DOI 10.1002/ar.23320 Published online 21 January 2016 in Wiley Online Library (wileyonlinelibrary.com).

GSPE ALLEVIATES CD-INDUCED TOXICITY

INTRODUCTION As a prevalent environmental endocrine disruptor, the heavy metal cadmium (Cd) is easily accessed, absorbed, and accumulated in human and animal tissues (Nordberg, 2009; Johnstone et al., 2014; Mazzei et al., 2014). Exposure to nonessential Cd can adversely affect some vital organs by interfering with physiological functions, including those related to hepatic, renal, reproductive, circulatory function and that of the nervous system (Liu et al., 2009; Thompson et al., 2010; Craig et al., 2011; Diaz et al., 2014; Zhao et al., 2014a, b). Intriguingly, Cd exposure adversely affects the ovaries by decreasing the percentage of oocytes at all sub-stages of oogenesis whilst increasing the number of atretic oocytes (Lienesch et al., 2000). In addition, Cd is found to not only markedly inhibit LH-induced stimulation of ovarian steroidogenic factor but also to down-regulate pituitary hormones. This leads to ovulation failure, defective steroidogenesis and the suppression of oocyte maturation and implantation (Wan et al., 2010; Das and Mukherjee, 2013). Furthermore, being a potent metallohormone, Cd is active in dramatically decreasing the expression of genes related to ovarian follicle development (Weng et al., 2014), mediating the membrane estrogen receptor GPR30 (Yu et al., 2010), and activating the ERa signaling pathway (Liu et al., 2008). These deleterious Cdinduced effects are due at least partially, to Cd disrupting or altering the functional enzymes, ion channels, transporters, and hormones related to such genes, receptors, or pathways (Thompson and Bannigan, 2008; Thevenod, 2009; Kluxen et al., 2013). However, meiosis is critical to the differentiation of germ cells undergoing the process of haploid cell generation and to set the foundation for sexual reproduction (Hunt and Hassold, 2008). Various hormones, cytokines, and growth factors regulate this process. This includes retinoic acid (RA), which has been recognized as an important factor required for germ cells to enter meiosis (Yu et al., 2013). However, whether Cd disturbs the RA signaling pathway during meiosis inhibition still remains unclear. A growing risk of Cd exposure, especially for human germ cells, makes the discovery of an effective plantderived substance or drug to ameliorate its harmful effects all the more urgent. Studies have demonstrated that some chemicals, such as melatonin (Guo et al., 2014) or quercetin (Bu et al., 2011), can attenuate Cdinduced toxicity. However, the ameliorative effect of Cdinduced meiotic disturbance remains largely unknown. It remains necessary to further explore the mechanism of the toxicity induced by Cd and to identify some protective strategies. Grape seed proanthocyanidin extract (GSPE) is ubiquitously found in fruits and vegetables. It manifests a wide spectrum of biological, pharmacological and therapeutic activities. These include its activities in inhibiting oxidative stress, providing protective effects to the immune system, acting in an antiallergic or antitumoral capacity, and in modulating functional enzymes (Sharma and Katiyar, 2010; Vaid et al., 2012, 2013). Moreover, GSPE can also attenuate cisplatin-induced nephrotoxicity (Gao et al., 2014), steroid-induced osteonecrosis (Song et al., 2015) and indomethacin-induced small intestinal mucosal injury (Cheung et al., 2014) through scavenging free radical and rescuing the disturbance of intracellular signaling pathways.

451

Consequently, the supplementation with food-derived GSPE might be made available to ameliorate the meiosis inhibition induced by Cd. Owing to the independence of maternal influences during embryogenesis, chicken embryos have been regarded as a superior model to assess the risk of endocrine disruptors. Thus, in the present study, we explore the ameliorative effects of GSPE on Cd-induced meiotic disruption in chicken embryos. We also further reveal the underlying molecular mechanisms through the changes in meiotic marker gH2AX proteins, genes, effects upon the RA signaling pathway and of antioxidant status. The results may be helpful to identify the potential protective actions of GSPE against reproductive toxicity, in general, and meiosis inhibition induced by Cd, in particular.

MATERIALS AND METHODS Animals and Experimental Design Fertilized Hyline chicken (Gallus) eggs weighing 59.8 6 2.5 g were obtained from a local commercial hatchery and incubated in an egg incubator at 38.58C with humidity at 60% until the desired embryonic day. All procedures were performed in compliance with the Guiding Principles for the Care and Use of Laboratory Animals of Zhejiang University. The eggs were divided randomly into four groups (0.9% NaCl group, Cd group, GSPE group and Cd 1 GSPE group, n 5 55). A small hole was drilled in the air cell region of the eggshell on embryonic day 6.5 of incubation (E6.5, the day just after gonadal differentiation). About 50 mL of 0.9% NaCl solution only or containing 3 mg Cd (Aladdin Industrial Co., Shanghai, China) and/or 150 mg GSPE (JF-NATURAL Co., Tianjin, China), was injected into the egg. The eggs were then candled twice on E11.5 and E16.5 and those with dead embryos rejected. Left ovaries were collected at E17.5 (with the oocytes arrested in the Dictyotene stage of the meiotic cycle at this time) for further determination.

Histological Observation For histomorphological evaluation, left ovaries were prepared for paraffin section (5 lm thickness) and stained by hematoxylin and eosin (HE). The morphological changes were examined under an Eclipse 80i microscope (Ni-kon, Japan) and the pictures captured with a digital camera (DS-Fi1, Nikon, Japan). Compared with somatic cells, germ cells in the ovarian cortex were identified by their much larger size (diameter  20 mm). In addition, meiotic germ cells were distinguished by their pale cytoplasm and condensed, or even thread-like, chromatins, as recognized by H&E staining. The thickness of the ovarian cortex was also observed to explore overall changes.

Fluorescence Immunohistochemistry The gH2AX protein was regarded as the meiosis marker after apoptotic cells were not observed in the ovaries of all groups. Frozen ovarian sections of 10 lm were conducted with primary mouse anti-gH2AX antibody (1:400, ab26350; Abcam) overnight at 48C. A second antibody used was TRITC-conjugated goat anti-mouse IgG (1:1000; KPL Inc., Maryland). Finally, the nuclei

452

HOU ET AL.

TABLE 1. Primers for PCR analysis Gene

Accession no.

Primer sequence (50 –30 )

Product length (bp)

Spo11

XM_001232075

177

Stra8

XM_416179

Scp3

XM_416330

Dmc1

XM_425477

Cvh

NM_204708

b-actin

NM_205518

Raldh2

NM_204995

Cyp26b1

XM_426366

RARa

NM_204536

RARb

NM_205326

TGGTCAGAAAGCTGTGGGATA TGATGTCGGGATGGAAGGAGA GTGAGGGACAGTGGAGGTAA CAGAAATGCCGCTTGTAA AT CTGTATTTCAGCAGTGGGATG TGCGAAGTTCATTTTGTGC AGATGACAACAAGACGAGCACT CAATCCCACCACCCAGAA CGGATGATGAAAGATGGTGTA ATTTGACGGATTGAATGACCT ACACCCACACCCCTGTGATGAA TGCTGCTGACACCTTCACCATTC GGCAGTTCTTGCTACTATGGA TCTGCCCAACCAGCGTAAT TTCGCCTCTTCACCCCCAT TGGAACCTGCCCTCCTTGTC TGCTTCGAGGTCGGGATG CTGTTGTTCGTGGTGTATTTGC CCTCGTGTTCACCTTTGC AGGCTTGTTGGGTCGTCT

Fig. 1. Effects of Cd and GSPE on oocyte meiosis at E17.5 by H&E staining of ovarian sections. (A) Control; (B) Cd; (C) GSPE; (D) Cd 1 GSPE. Arrowheads represent germ cells which have entered into meiosis (green) and germ cells which have not entered into meiosis (red). Scale bars: 20 lm. E, embryonic day; H&E, hematoxylin and eosin staining.

166 225 195 188 136 144 205 197 193

GSPE ALLEVIATES CD-INDUCED TOXICITY

453

Fig. 2. Effects of Cd and GSPE on the thickness of the ovarian cortex at E17.5 by H&E staining. (A) Control; (B) Cd; (C) GSPE; (D) Cd 1 GSPE. The thickness of the ovarian cortex is the distance from the green line to the edge. Scale bars: 100 lm.

were counterstained with DAPI (300 nM, Sigma Aldrich). Additionally, mounted slides were visualized using a laser-scanning confocal microscope (FV1000; Olympus, Co., Tokyo, Japan).

Giemsa Staining Left ovaries of E17.5 were manually minced, washed with HEPES, and digested twice with collagenase type II (GIBCO BRL, CA) at 378C in a shaking water bath for nearly 3 min, respectively. Dispersed cells were filtered through a 200-mesh sieve and completely dissociated using a siliconized Pasteur pipette. The sedimented cells were resuspended in 0.56% KCl solution and incubated at 378C for 35 min. Next, the suspension was centrifuged at 1000 rpm for 8 min and the cells were resuspended in an ice-cold fixative (1:3 mixture of glacial acetic acid and absolute methyl alcohol). The suspension was then centrifuged again and the cells were resuspended in a newly prepared chilled fixative, After 35 min, this ice-cold suspension was centrifuged and resuspended again in the chilled fixative. The cells were then, using air-drying, evenly coated on the slides and stained with Giemsa

(Bai bo Co., Ji Nan, China). The meiotic germ cells were classified as follows: oogonia; oocytes at the preleptotene, leptotene, zygotene, pachytene, and diplotene phases of meiosis. Additionally, germ cells were identified by their relatively larger size. Oocytes were sub-staged and counted with pairing-synapsis according to the recombination of homologous chromosomes which occurs during meiotic prophase I according to morphological descriptions in previous studies (Ge et al., 2012; He et al., 2012).

RNA Extraction and Real-Time RT-PCR Trizol reagent (Invitrogen Co., Carlsbad, CA) was used to extract total RNA from the left ovaries of E17.5. The RNA purity and concentration was determined by a Nanodrop UV–VIS spectrophotometer (Thermo Fisher Scientific, San Jose, CA) at 260/280 nm in the range of 1.8–2.0. Total RNA (2 lg) was reverse transcribed using a Fermentas One-step RT-PCR kit (MBI Fermentas, St, Leon-Rot, Germany). Real time quantitative PCR (qRTPCR) was used to assess the relative expression of the premeiotic marker Stra8 (stimulated by retinoic acid gene), the meiotic markers Spo11, Dmc1, and Scp3

454

HOU ET AL.

(the latter gene encoding the synaptonemal complex protein), the RA metabolism-related enzymes Raldh2 (a gene encoding retinaldehyde dehydrogenase, type 2) and Cyp26b1 (a gene encoding a RA metabolizing cytochrome P450 enzyme), and the RA receptors RARa and RARb (Table 1). The qRT-PCR was carried out on an ABI 7500 HT Real-Time PCR machine (Applied Biosystems, Foster City, CA) with the reaction volume of 20 mL consisting of a 2 mL complementary DNA template, 400 nM of each of the gene-specific forward and reverse primers, 0.4 mL ROX reference dye II, and 10 mL SYBR Premix Ex Taq (TaKaRa BioInc., Shiga, Japan). The thermal profile was 958C for 10 s and 958C for 5 s for 40 cycles, followed by 608C for 34 s each. Individual samples were analyzed in triplicate and all experiments were performed twice. All samples were normalized with the germ cell marker gene Cvh (a chicken homolog of vasa gene) or b-actin using the comparative cycle threshold method (22[䉭][䉭]Ct).

Biochemical Analysis of Antioxidant Status The left ovaries freshly collected at E17.5 were homogenized with ice-cold 0.9% NaCl. The homogenate was centrifuged for 10 min at 4000 rpm and the supernatant was used for further measurements. The biochemical parameters malondialdehyde (MDA), H2O2, superoxide dismutase (SOD), and glutathione (GSH) were examined using commercial kits which were purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

Statistical Analysis All data were expressed as the means 6 SEM and analyzed by ANOVA and Duncan’s multiple-range tests using the software of SAS 8.0. P < 0.05 was considered to indicate a statistically significant difference.

RESULTS Morphological Changes in Ovary No significant difference was observed between GSPE and the control group (Fig. 1A and C). Cd exposure markedly changed the germ cell morphology and decreased the number of germ cells that entered into meiosis. Here, less cells presented condensed, threadlike chromatin as compared with the control (Fig. 1B). However, in the Cd 1 GSPE group, increased numbers of meiotic germ cells were scattered throughout the ovarian cortex, as compared with the Cd group (Fig. 1D). In addition, the thickness of the ovarian cortex in the Cd group had been reduced to a certain extent, as compared with the control (Fig. 2A and B). However, the combination with GSPE significantly promoted the development and differentiation of germ cells in the ovarian cortex, where they displayed increased thickness, compared with Cd group (Fig. 2B and D).

Alterations of Meiosis-Specific Protein cH2AX Compared with the control, the Cd-induced meiotic inhibition (P < 0.05) was further confirmed by direct observation of the meiosis marker gH2AX (with approximately a 43.3% decrease; Fig. 3A and B). However, gH2AX positive germ cells were markedly increased in

Fig. 3. (A) Histologic sections of left ovaries at E17.5 with immunofluorescent labeling of germ cell meiosis marker (gH2AX) after treatment with Cd and GSPE. Scale bars: 20 lm. (B) Percentages of gH2AX positive cells in the ovarian cortex in four groups. Values are mean 6 SEM. Bars with different superscripts are statistically different (P < 0.05).

the Cd 1 GSPE group (P < 0.05) as compared with the Cd group (a 54.9% increase; Fig. 3). Meanwhile, in the presence of GSPE alone, the number of positive cells was approximately equal to that of the control (Fig. 3).

Alterations in the Percentages of Sub-Staged Oocytes Figure 4 illustrates, through Giemsa staining, the altered proportions of oocytes found in each of the substages of meiotic prophase I. As compared with the

GSPE ALLEVIATES CD-INDUCED TOXICITY

Fig. 4. Squash preparations of left ovaries at E17.5 after treatment with Cd and GSPE. (A) (a) oogonia; (b) oocytes at preleptotene; (c) oocytes at leptotene; (d) oocytes at zygotene; (e) oocytes at pachytene; (f) oocytes at diplotene. Scale bar: 10 lm. (B) Proportions of the sub-stages of meiotic prophase I as detected by Giemsa staining. Values are means 6 SEM. Asterisk indicates statistically different between different groups (P < 0.05).

455

456

HOU ET AL.

Fig. 5. Effects of Cd and GSPE on oocyte meiosis. The mRNA expression of the meiosis-specific markers Scp3, Spo11, and Dmc1 were measured by qRT-PCR in the left ovaries at E17.5. Cvh was used as the normalization control. Values are mean 6 SEM. Bars with different superscripts are statistically different (P < 0.05).

control, the percentages of oocytes at the leptotene, zygotene, and pachytene after Cd exposure were significantly decreased by 36.0%, 34.2%, and 35.6%, respectively (P < 0.05). In addition, in the Cd 1 GSPE group, the numbers of oocytes in the leptotene and zygotene both markedly increased from the Cd group to a level of 1.3fold and 1.6-fold, respectively (P < 0.05), but pachytene oocytes exhibited only a slightly elevated level (8.6% increase) (P >0.05).

Changes of Meiosis Relevant Markers After treatment with Cd, the mRNA expression of the premeiotic marker Stra8, and the meiotic markers Scp3, Spo11, and Dmc1 were all markedly decreased by 38.4%, 47.3%, 44.5%, and 37.5%, respectively, compared with the control (P < 0.05, Fig. 5). Although there was no obvious differences in the Stra8 and Dmc1 transcription levels between Cd and Cd 1 GSPE groups (P > 0.05, Fig. 5A and D), the expression of Scp3 and Spo11 in Cd 1 GSPE group were significantly higher (1.7-fold and 1.6-fold, respectively) than were those in the Cd group (P < 0.05, Fig. 5B and C).

Alterations in RA Signaling Pathway As compared with the control, the mRNA expression of the RA synthetase Ral dh2, and the RA receptors RARa and RARb in the Cd group were significantly reduced by 31.6%, 27.9%, and 43.7%, respectively (P < 0.05, Fig. 6A, C, and D), whilst the RA catabolic enzyme Cyp26b1 (P > 0.05) displayed no significant change (only a 17.3% increase, Fig. 6B). Interestingly, the combination with GSPE strikingly increased the mRNA expression of Raldh2 (P < 0.05) and RARb (P < 0.01) by 50.1% and 76.1%, respectively, along with a slight augmentation of RARa by 23.1% (P > 0.05) and with Cyp26b1 slightly decreased by 9.1% (P > 0.05) as compared with the Cd group. Moreover, GSPE alone caused no significant changes as compared with the normal levels (Fig. 6).

Changes in the Antioxidant Status As shown in Fig. 7, as compared with the control group, Cd exposure significantly increased the levels of MDA (P < 0.05) and H2O2 (P < 0.01) by approximately 39.2% and 53.1%, respectively, with an obvious reduction

GSPE ALLEVIATES CD-INDUCED TOXICITY

457

Fig. 6. Effects of Cd and GSPE on the RA signaling pathway. The RA mRNA expressions of the metabolism-related enzymes Raldh2 and Cyp26b1 and the RA receptors RARa and RARb were measured by qRT-PCR in the left ovaries at E17.5. b-actin was used as the normalization control. Values are mean6 SEM. Bars with different superscripts are statistically different (P < 0.05).

of GSH level (P < 0.05) and of antioxidant enzyme SOD activities (reduced by 27.8% and 36.1%, respectively; P < 0.05). However, compared with the control, GSPE exhibited an effective protection, with MDA (P > 0.05) and H2O2 (P < 0.05) decreased by 17.8% and 24.6%, respectively. Meanwhile, SOD in the Cd 1 GSPE group was significantly (P < 0.05) higher (1.5 fold) than that in the Cd group, and GSH (P < 0.05) increased by 31.6% as well. In addition, there were no major differences in levels of MDA, H2O2, SOD, and GSH between the control and the GSPE groups.

DISCUSSION In the present study, the ameliorative effect of GSPE on Cd-induced meiosis inhibition has been investigated by observing the morphology, meiosis-specific protein, gene expressions, and antioxidant status of chicken embryos. After preliminary experiments, we finally chose the single toxic dose (3 lg Cd, about 27 nM), which is a relatively low dosage compared with previous reports (Dzugan et al., 2011, 2012). HE staining showed that Cd exposure inhibited the development of germ

cells and resulted in an alteration of their morphology. This consequently reduced the number of germ cells that entered into meiosis. However, GSPE attenuated the Cdinduced toxicity where more meiotic germ cells appeared in the ovarian cortex displaying obviously condensed chromatin. Additionally, the Cd-induced thickness of the ovarian cortex increased when Cd was combined with GSPE. Therefore, the changes in ovarian germ cells and cortex thickness induced by Cd may affect primordial follicle formation and where GSPE will tend to promote the development of oocytes. It has been reported that meiotic prophase I sets the stage for segregating chromosomes which are marked by the gH2AX protein, regarded as one of the earliest signaling responses to the formation of DSBs at the leptotene for initiating meiotic recombination (FernandezCapetillo et al., 2004; Rockmill et al., 2013). In the current study, GSPE protected against the Cd-induced meiosis inhibition exhibited by the gH2AX protein (Fig. 3). Coincidently, the gH2AX positive cells were consistent with meiotic germ cells present in H&E staining (Figs. 1 and 3). Furthermore, the expression pattern of the gH2AX protein was parallel to the changes in the

458

HOU ET AL.

Fig. 7. Changes in the level of MDA, H2O2 and GSH and in the activity of SOD after treatments with Cd and GSPE. Values are mean 6 SEM. Bars with different superscripts are statistically different (P < 0.05).

premeiotic marker Stra8 and the meiotic markers Scp3, Spo11, and Dmc1 (Figs. 3 and 5). As expected, the adverse down-regulation was attenuated by combined GSPE treatment. The Cd-induced adverse effect on the ovaries was similar to the toxicity of other environmental endocrine disruptors, such as di-(2-ethylhexyl) phthalate (Liu et al., 2014b) and biphenol A (BPA) (Zhang et al., 2012). Therefore, we speculate that Cd might induce sterility through disturbing DSBs formation and chromosome synapsis in meiosis. However, the underlying pathways require further clarification. Importantly, the process of oogenesis in the chicken embryos is similar to that in mammalian systems (like human and mouse). Our results show that Cd apparently decreased the percentage of oocytes at the leptotene, zygotene, and pachytene as compared with the control group. Similar observations were made on BPA exposure which inhibited meiosis initiation at the early stage of oogenesis via decreasing the expression of the gH2AX protein (Liu et al., 2014a). RA, as a vitamin A metabolite, plays a pivotal role in controlling Stra8 expression and initiating meiosis (Li and Clagett-Dame, 2009; Le Bouffant et al., 2010; Yu

et al., 2013). However, the disruption caused by Cd exposure in the RA signaling pathway mechanism remains largely unexplored. In the present study, RA synthetase (Raldh2) and RA receptors (RARa and RARb) were markedly suppressed by Cd exposure. Therefore, we speculated that Cd might disturb the RA signaling pathway and consequently inhibit meiotic initiation. On the contrary, GSPE manifested protective effects to reverse the Cd-induced toxicity on meiosis (Fig. 5). As a natural antioxidant (Sharma and Katiyar, 2010; Cheung et al., 2014), GSPE may promote the function of vitamin A, and indirectly regulate the RA signaling pathway. This, in turn, may open the novel involvement of the RA signaling pathway in Cd-induced meiotic inhibition. This, indicates a potential method for rescuing this adverse effect. Interestingly, Cd induced no obvious direct damage to the ovary but decreased antioxidant activity. This harmful effect was partially reversed in the combination with GSPE (Fig. 7). Previous studies also found that GSPE ameliorated DDP-induced testicular toxicity in rats (Zhao et al., 2014b). A similar natural antioxidant, quercetin, has also been seen to provide effective protection for germ cells (Mi et al., 2013). Thus, these results implied that the ameliorative effect of GSPE on meiosis

GSPE ALLEVIATES CD-INDUCED TOXICITY

inhibition might be associated with the suppression of oxidative stress. In summary, Cd exposure in chicken embryos did inhibit meiotic progression at the early stage of oogenesis. GSPE alleviated Cd-induced meiotic abnormalities by elevating the expression of the meiosis-specific markers of the gH2AX protein and related genes. More importantly, GSPE might decrease the adverse effects through regulating the RA signaling pathway and intracellular antioxidative system. Therefore, these results indicated that daily use of sufficient quantity of GSPE may potentially provide some protection against Cdinduced reproductive toxicity.

ACKNOWLEDGEMENT Authors appreciate the generous help of Imdad Leghari, Dr. Xun Tan (Zhejiang University) and Dr. Chris Wood (Zhejiang University) for English improvement in the manuscript.

LITERATURE CITED Bu T, Mi Y, Zeng W, Zhang C. 2011. Protective effect of quercetin on cadmium-induced oxidative toxicity on germ cells in male mice. Anat Rec 294:520–526. Cheung DY, Kim JI, Park SH, Kim JK. 2014. Proanthocyanidin from grape seed extracts protects indomethacin-induced small intestinal mucosal injury. Gastroenterol Res Pract 2014:618068 Craig ZR, Wang W, Flaws JA. 2011. Endocrine-disrupting chemicals in ovarian function: effects on steroidogenesis, metabolism and nuclear receptor signaling. Reproduction 142:633–646. Das S, Mukherjee D. 2013. Effect of cadmium chloride on secretion of 17beta-estradiol by the ovarian follicles of common carp, Cyprinus carpio. Gen Comp Endocrinol 181:107–114. Diaz MD, Gonzalez N, Gomez S, Quiroga M, Najle R, Barbeito C. 2014. Effect of a single dose of cadmium on pregnant wistar rats and their offspring. Reprod Domest Anim 49:1049–1056. Dzugan M, Lis M, Droba M, Niedziolka JW. 2011. Effect of cadmium injected in ovo on hatching results and the activity of plasma hydrolytic enzymes in newly hatched chicks. Acta Vet Hung 59:337–347. Dzugan M, Lis MW, Droba M, Niedziolka JW. 2012. Protective effect of zinc on cadmium embryotoxicity and antioxidant status of blood plasma in newly hatched chicks. J Environ Sci Health A Tox Hazard Subst Environ Eng 47:1288–1293. Fernandez-Capetillo O, Lee A, Nussenzweig M, Nussenzweig A. 2004. H2AX: the histone guardian of the genome. DNA Repair 3: 959–967. Gao Z, Liu G, Hu Z, Li X, Yang X, Jiang B, Li X. 2014. Grape seed proanthocyanidin extract protects from cisplatin-induced nephrotoxicity by inhibiting endoplasmic reticulum stress-induced apoptosis. Mol Med Rep 9:801–807. Ge C, Yu M, Zhang C. 2012. G protein-coupled receptor 30 mediates estrogen-induced proliferation of primordial germ cells via EGFR/ Akt/beta-catenin signaling pathway. Endocrinology 153:3504– 3516. Guo P, Pi H, Xu S, Zhang L, Li Y, Li M, Cao Z, Tian L, Xie J, Li R, He M, Lu Y, Liu C, Duan W, Yu Z, Zhou Z. 2014. Melatonin improves mitochondrial function by promoting mt1/sirt1/pgc-1 alphadependent mitochondrial biogenesis in cadmium-induced hepatotoxicity in vitro. Toxicol Sci 142:182–195. He B, Lin J, Li J, Mi Y, Zeng W, Zhang C. 2012. Basic fibroblast growth factor suppresses meiosis and promotes mitosis of ovarian germ cells in embryonic chickens. Gen Comp Endocrinol 176: 173–181. Hunt PA, Hassold TJ. 2008. Human female meiosis: what makes a good egg go bad? Trends Genet 24:86–93.

459

Johnstone EB, Louis GM, Parsons PJ, Steuerwald AJ, Palmer CD, Chen Z, Sun L, Hammoud AO, Dorais J, Peterson CM. 2014. Increased urinary cobalt and whole blood concentrations of cadmium and lead in women with uterine leiomyomata: Findings from the ENDO Study. Reprod Toxicol 49C:27–32. Kluxen FM, Diel P, Hofer N, Becker E, Degen GH. 2013. The metallohormone cadmium modulates AhR-associated gene expression in the small intestine of rats similar to ethinyl-estradiol. Arch Toxicol 87:633–643. Le Bouffant R, Guerquin MJ, Duquenne C, Frydman N, Coffigny H, Rouiller-Fabre V, Frydman R, Habert R, Livera G. 2010. Meiosis initiation in the human ovary requires intrinsic retinoic acid synthesis. Hum Reprod 25:2579–2590. Li H, Clagett-Dame M. 2009. Vitamin A deficiency blocks the initiation of meiosis of germ cells in the developing rat ovary in vivo. Biol Reprod 81:996–1001. Lienesch LA, Dumont JN, Bantle JA. 2000. The effect of cadmium on oogenesis in Xenopus laevis. Chemosphere 41:1651–1658. Liu Z, Yu X, Shaikh ZA. 2008. Rapid activation of ERK1/2 and AKT in human breast cancer cells by cadmium. Toxicol Appl Pharmacol 228:286–294. Liu J, Qu W, Kadiiska MB. 2009. Role of oxidative stress in cadmium toxicity and carcinogenesis. Toxicol Appl Pharmacol 238: 209–214. Liu C, Duan W, Zhang L, Xu S, Li R, Chen C, He M, Lu Y, Wu H, Yu Z, et al. 2014a. Bisphenol A exposure at an environmentally relevant dose induces meiotic abnormalities in adult male rats. Cell Tissue Res 355:223–232. Liu T, Li N, Zhu J, Yu G, Guo K, Zhou L, Zheng D, Qu X, Huang J, Chen X, et al. 2014b. Effects of di-(2-ethylhexyl) phthalate on the hypothalamus-pituitary-ovarian axis in adult female rats. Reprod Toxicol 46:141–147. Mazzei V, Longo G, Brundo MV, Sinatra F, Copat C, Oliveri Conti G, Ferrante M. 2014. Bioaccumulation of cadmium and lead and its effects on hepatopancreas morphology in three terrestrial isopod crustacean species. Ecotoxicol Environ Saf 110C:269–279. Mi Y, Tu L, Wang H, Zeng W, Zhang C. 2013. Supplementation with quercetin attenuates 4-nitrophenol-induced testicular toxicity in adult male mice. Anat Rec 296:1650–1657. Nordberg GF. 2009. Historical perspectives on cadmium toxicology. Toxicol Appl Pharmacol 238:192–200. Rockmill B, Lefrancois P, Voelkel-Meiman K, Oke A, Roeder GS, Fung JC. 2013. High throughput sequencing reveals alterations in the recombination signatures with diminishing Spo11 activity. PLoS Genet 9:e1003932. Sharma SD, Katiyar SK. 2010. Dietary grape seed proanthocyanidins inhibit UVB-induced cyclooxygenase-2 expression and other inflammatory mediators in UVB-exposed skin and skin tumors of SKH-1 hairless mice. Pharm Res 27:1092–1102. Song Q, Shi Z, Bi W, Liu R, Zhang C, Wang K, Dang X. 2015. Beneficial effect of grape seed proanthocyanidin extract in rabbits with steroid-induced osteonecrosis via protecting against oxidative stress and apoptosis. J Orthop Sci 20:196–204. Thevenod F. 2009. Cadmium and cellular signaling cascades: to be or not to be? Toxicol Appl Pharmacol 238:221–239. Thompson J, Bannigan J. 2008. Cadmium: toxic effects on the reproductive system and the embryo. Reprod Toxicol 25:304–315. Thompson J, Doi T, Power E, Balasubramanian I, Puri P, Bannigan J. 2010. Evidence against a direct role for oxidative stress in cadmium-induced axial malformation in the chick embryo. Toxicol Appl Pharmacol 243:390–398. Vaid M, Prasad R, Singh T, Jones V, Katiyar SK. 2012. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators. Toxicol Appl Pharmacol 263:122–130. Vaid M, Singh T, Prasad R, Elmets CA, Xu H, Katiyar SK. 2013. Bioactive grape proanthocyanidins enhance immune reactivity in UV-irradiated skin through functional activation of dendritic cells in mice. Cancer Prev Res 6:242–252. Wan X, Zhu J, Zhu Y, Zhu Y, Ma X, Zheng Y, Wang F, Liu Z, Zhang T. 2010. Rat ovarian follicle bioassay reveals adverse effects of

460

HOU ET AL.

cadmium chloride (CdCl2) exposure on follicle development and oocyte maturation. Toxicol Ind Health 26:609–618. Weng S, Wang W, Li Y, Li H, Lu X, Xiao S, Wu T, Xie M, Zhang W. 2014. Continuous cadmium exposure from weaning to maturity induces downregulation of ovarian follicle developmentrelated SCF/c-kit gene expression and the corresponding changes of DNA methylation/microRNA pattern. Toxicol Lett 225:367–377. Yu X, Filardo EJ, Shaikh ZA. 2010. The membrane estrogen receptor GPR30 mediates cadmium-induced proliferation of breast cancer cells. Toxicol Appl Pharmacol 245:83–90. Yu M, Yu P, Leghari IH, Ge C, Mi Y, Zhang C. 2013. RALDH2, the enzyme for retinoic acid synthesis, mediates meiosis initiation in

germ cells of the female embryonic chickens. Amino Acids 44: 405–412. Zhang HQ, Zhang XF, Zhang LJ, Chao HH, Pan B, Feng YM, Li L, Sun XF, Shen W. 2012. Fetal exposure to bisphenol A affects the primordial follicle formation by inhibiting the meiotic progression of oocytes. Mol Biol Rep 39:5651–5657. Zhao W, Liu W, Chen X, Zhu Y, Zhang Z, Yao H, Xu S. 2014a. Four endoplasmic reticulum resident selenoproteins may be related to the protection of selenium against cadmium toxicity in chicken lymphocytes. Biol Trace Elem Res 161:328–333. Zhao YM, Gao LP, Zhang HL, Guo JX, Guo PP. 2014b. Grape seed proanthocyanidin extract prevents DDP-induced testicular toxicity in rats. Food Funct 5:605–611.

Ameliorative Effect of Grape Seed Proanthocyanidin Extract on Cadmium-Induced Meiosis Inhibition During Oogenesis in Chicken Embryos.

Cadmium (Cd) is an environmental endocrine disruptor that has toxic effects on the female reproductive system. Here the ameliorative effect of grape s...
566B Sizes 1 Downloads 11 Views