The EMBO Journal vol.9 no.2 pp.559-566, 1990

Amino-terminal domain of NF1 binds to DNA and activates adenovirus DNA replication

Fotini Gounari, Raffaele De Francesco, Jacky Schmitt, Peter C.van der VIiet1, Riccardo Cortese and Henk Stunnenberg European Molecular Biology Laboratory, Meyerhofstrasse 1, 6900 Heidelberg, FRG and 'Laboratory for Physiological Chemistry, State University of Utrecht, Vondellaan 24a, 3521 GG Utrecht, The Netherlands Communicated by R.Cortese

NF1 is a DNA-binding protein involved in initiation of adenovirus DNA replication as well as in modulating the rate of transcription initiation of genes containing the sequence TGGCA. We show here that recombinant NF1 expressed via vaccinia virus is transported into the nucleus and binds to its cognate sequences with the same specificity as NF1 purified from HeLa cells. Furthermore, the recombinant NF1 forms oligomers in solution and binds as a dimer to palindromic as well as half-site sequences. NF1 expressed via vaccinia virus stimulates the initiation of adenovirus replication in vitro. The N-terminal 240 amino acids of the protein are sufficient for full DNA-binding activity as well as stimulation of adenovirus replication. By analysis of several NF1 mutants translated in vitro, we also define the minimal DNA-binding domain and localize the region responsible for DNA binding on the N-terminal and for oligomerization on the C-termninal side of this domain. Key words: adenovirus/DNA replication/NF1/oligomerization

Introduction Nuclear Factor 1 (NF 1) represents a family of sequencespecific DNA-binding proteins shown to serve both as a modulating factor for RNA polymerse II activity (Jones et al., 1987) and as a host initiation factor for replication of adenovirus DNA in infected cells (Nagata et al., 1983). Sequences containing binding sites for NFl were found in several gene promoters, as well as within the adenovirus origin of replication (Nagata et al., 1983; Rawlins et al., 1984; Hay, 1985). In particular, NFl was shown to stimulate initiation of adenovirus DNA replication by binding to a sequence contained within the origin of viral replication (Nagata et al., 1983; de Vries et al., 1985; Gronostajski et al., 1985; Henninghausen et al., 1985). NFl binding sites in promoter sequences of the albumin, retinol-binding protein (RBP), 3-hydroxyl-3-methyl-glutaryl CoA reductase and Apl genes were implicated in negative transcriptional regulation (Colantuoni et al., 1987; Gil et al., 1988; Angel et al., 1988; A.Nicosia, P.Monaci and R.Cortese, unpublished observations). In addition, NFl was shown to act as a transcriptional activator of the a-globin promoter in vitro (Jones et al., 1987), and to act synergistically with other transcriptional modulators such as the glucocorticoid receptor, or the yeast Gal4 protein © Oxford University Press

as a

dimer

(Lin et al., 1988; Schule et al., 1988; Strahle et al., 1988; Beato, 1989). An important biological question that arises is how NFI can perform these different functions. Analysis of NFl cDNAs indicates that several related proteins might exist, having highly conserved N termini and variable C termini (Gil et al., 1988; Paonessa et al., 1988; Santoro et al., 1988; V.De Simone and R.Cortese, unpublished observation). It was suggested that an N-terminal domain is responsible for DNA binding (Paonessa et al., 1988). Proteins with different C-terminal (putative activation) domains might be responsible for the separate functions of NF 1. In human (Santoro et al., 1988) and in rat (Paonessa et al., 1988; V.De Simone and R.Cortese, unpublished observations), the variations in cDNA stucture are likely to result from alternative splicing of the same primary transcript. In hamster, different forms of NFl might be encoded by different genes (Gil et al., 1988). The consensus NFl recognition sequence on the adenovirus origin contains a palindrome (Borgmeyer et al., 1984; Henninghausen et al., 1985). Based on the dyad symmetry of specific NFI contacts with its binding site at the adenovirus replication origin, de Vries et al. (1987) have suggested that NFl binds as a dimer. However, NFl was also shown to recognize promoter sequences of genes where the binding site resembles one-half of the palindrome (TGGCA) (Gil et al., 1988; Paonessa et al., 1988). There is at present no consensus in the literature as to whether NFl exists as a stable dimer in solution, independently from binding to DNA (Rosenfeld and Kelly, 1986; Gander et al., 1988). In order to address these questions we have expressed the rat NFl in eukaryotic cells, using a vaccinia virus expression vector. We report here that the vaccinia expressed NF- 1 (vNF1) binds specifically to NFl target sequences and induces adenovirus replication in vitro. vNF1 interacts with both palindromic and half NFl binding sites as a dimer. We further show that the 240 N-terminal amino acids of the protein are sufficient for the induction of adenovirus replication. By analysis of several deletion mutants by in vitro translation, we demonstrate that the structures involved in oligomerization of the protein are located on the carboxy-terminal side of the 240 amino acid domain.

Results Expression of NF1 using the vaccinia virus system We have previously reproted the molecular cloning of a rat liver cDNA coding for NFl (Paonessa et al., 1988). In order to investigate the structural and functional domains of NFl, we have used a vaccinia virus expression system. The 1.7 kb cDNA (Paonessa et al., 1988) coding for rat liver NFl protein, and a shorter cDNA segment, coding for amino acids 4-240 (Paonessa et al., 1988; Ammendola et al., 1989) were fused downstrearn to the 11K vaccinia promoter, in the recombination vector p1 1K-18 (Stunnenberg et al., 1988).The details 559

F.Gounari et al.

of the constructions are described in Materials and methods. The longer cDNA construct should direct the synthesis of an NFl molecule (vNFl) containing, at the N-terminal end, nine additional amino acids coded by polylinker sequences. The construct carrying the shorter cDNA segment should synthesize a protein, referred to as vNF1BD (binding domain), containing eight additional amino acids at the N-terminal end and ending at amino acid 240. HeLa cell monolayers, infected either with wild-type (wt) or recombinant viruses expressing vNF1 or vNFIBD, were pulse-labelled with [35S]methionine and the resulting extracts were used to monitor the expression of vNF1 and vNFlBD on SDS-PAGE (Figure 1). New polypeptide species, indicated by arrows, were detected in extracts of cells infected with the recombinant viruses. vNF1 migrates as a 66 kd protein, in contrast to the 56.8 kd predicted by its amino acid sequence (Figure 1, lane 1). The discrepancy between the expected and apparent mol. wt might be due to protein posttranslational modifications (J.Schmitt and H.Stunnenberg, unpublished observations). vNFIBD migrates as a polypeptide of 32 kd apparent mol. wt while a protein of 28.5 kd was predicted (Figure 1, lane 2). Binding of vNFl and vNFlBD to palindromic and half sites We wanted to establish whether the NFl proteins expressed by the vaccinia virus system have binding properties comparable to cellular NFl. Whole cell extracts of cells infected with recombinant virus expressing vNF-1 were assayed for their capacity to form a specific complex with a double-stranded oligonucleotide containing the NFlbinding site of the retinol-binding protein gene promoter (RBP1) (Figure 2). Binding of vNFI to RBP1 oligo is completely prevented upon competition by 300 molar excess of cold RBP1 and the Alb 34 oligonucleotide, which contains an NFl-binding site of the albumin gene promoter (Figure 2, lanes 3 and 4). However, vNFl binding is not competed

Fig. 1. Detection of recombinant protein. HeLa cells mock infected (lane 3), or infected with wt virus (lane 4), recombinant vNFl (lane 1), and vNFIBD viruses (lane 2), were pulse labelled with

[35Sjmethionine

and extracts were run on a 10% SDS-polyacrylamide

gel. The position of the vNFI and vNFlBD proteins is indicated by arrows.

560

by an equivalent molar excess of a non-specific oligonucleotide (Figure 2, lane 5). It can therefore be concluded that vNFl binds specifically to NFl target sequences. The hierarchy of vNFl and vNFlBD binding affinities to four different binding sites was studied by competing the complex formed between vNFl proteins and the Alb 34 oligonucleotide in the presence of specific competitor DNAs. Four independent competition curves were obtained using synthetic double-stranded oligonucleotides containing the palindromic sequence present in the adenovirus origin of replication (Adeno ori) and the half sites Alb 34, Alb 56 (second NFl site of the albumin gene promoter) and RBP1 (Figure 3, A and B). As shown in Figure 3, binding of vNFl to the Adeno ori site is 10-fold more efficient than to RBP1 and Alb 34. The weakest binding is that of Alb 56, which showed roughly two orders of magnitude lower affinity as compared to the Adeno ori (Figure 3, A). The relative affinity of vNFlBD to the Adeno ori, Alb 34 and Alb 56 is comparable to that of vNFl. However, binding of this polypeptide to the RBPl site is 10-fold less efficient than that of vNFl (Figure 3, panel B). NFl binds to DNA as a dimer The observation that NFl binds to the Adeno ori sequence with significantly higher affinity than that of half sites, as well as the symmetrical contacts of the protein on it, led to the speculation that NFl binds to palindromic sites as a dimer (de Vries et al., 1987). On the other hand, the complexes of NFl with either palindromic or half sites show the same electrophoretic mobilities on gel retardation assays (Figure 4, lanes 4 and 5 in the two panels), suggesting the same stoichiometry of the protein in the two complexes. The vNFl and vNFlBD protein-DNA complexes yield

Fig. 2. Specificity of vNFl binding to NFI target sequences. Gel retardation was performed with 32P-labelled double-stranded oligonucleotide RBP1, using whole-cell extracts containing vNFI (lanes 2-4). The retarded complex was competed by 300-fold molar excess of cold Alb 34 (lane 3), RBP1 (lane 4) and an unrelated oligonucleotide (lane 5). Lane 1 shows the probe in the absence of extract.

Recombinant NF1 activates DNA replication

80

60 60

40-

-0o-12

m 20

-1Alb 34

RBP1 Adenoori

o12 0

10. 10

1 0- 1 1

1o0

o0

1O lo-

8

[comp] (M) 100 -

B -~ 80 0N

60 40

20-

3()nAlb 56 ()A

icm tocd dor()R

-0-RBPi

Adeno ori --

0A 1

10.1 seune.Th

10.8 10. siglble e 10hf otie 10.Alb 34olgan

(comp] (M)

o

Fig. 3. Competition bandshift of vNFI and vNFIBD with NFl target sequences. The gel shift obtained using labelled Aib 34 oligo and vNFI (A), or vNFIBD (B) was competed upon addition of 2-fold increments of cold Adeno oni (A), RBP (II), Alb 34 (0) and Alb 56 (A) oligonucleotides. The results are plotted on a semi-log scale as percentage of residual binding versus the molar concentration of the competitor oligonucleotides.

different migration patterns on native gel electrophoresis according to their size (Figure 4, compare lanes 3 and 4). The different intensity of the various bands does not reflect a different affinity of the recombinant proteins toward their target sequences, but it is rather due to experimental variability in the rate of viral infection, as shown by Western blotting of the extracts (data not shown). We were able to assess whether NF1 binds to its target sequences as a monomer or as a dimer, exploiting the possibility of forming heterodimers (Hope and Struhl, 1987). If NFI interacts with the Adeno ori as a dimer, a retarded complex of intermediate mobility should be detectable as a result of heterodimer formation between vNFl and vNF1BD monomers. A new complex with intermediate mobility was indeed detected upon co-expression in HeLa cells of both vNF1 and vNFIBD (Figure 4, lanes 5 and 6). Mixing in vitro of the two proteins under various conditions did not result in a heterodimer formation (Figure 4, lanes 7), suggesting that NFl exists as an oligomer in solution and subunit exchange is either a slow process or it does not occur. Further evidence on the oligomeric nature of the NFl protein was obtained by chemical cross-linking studies on vNFIBD. Incubation of affinity-purified vNFIBD protein with the zero-length cross-linker N-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Tae, 1983) resulted in the appearance of a new protein band at about twice the mol. wt of the monomer (Figure 5, lane 2). When the cross-linking reaction was carried out with glutaraldehyde, which has a much broader specificity of reaction, two new bands appeared which are consistent with the formation of vNFIBD dimers and tetramers (Figure 5, lane 3). Western blotting of the glutaraldehyde cross-links is shown in lane 4 of Figure 5. The differences in the patterns observed with EDC versus glutaraldehyde cross-linking suggests that the surfaces of the protein involved in forming the dimers and the tetramers are physically distinct. Altogether, these results suggest that NFl can form stable dimers in solution and that the protein dimers can undergo further oligomerization in vitro to form tetramers.

Alb 34

Adeno origin

1

2

3

5

4 na#::-

6

t'

.

4

E.

t

_wmm. 4z

-

....

00 a

0

-DOb

.-Qo0

--00 c

~~~d

P

"~~~O ql,

---+

Fig. 4. Detection of vNF1 -NF1BD heterodimers. Gel-retardation analysis of vNF1 and vNFlBD binding to the Adeno ori and Alb 34 oligonucleotides. Lanes 1 are without extracts. Lanes 2 are incubated with extracts of cells infected with wt virus. Lanes 3 and 4 are incubated with extracts containing vNFlBD and vNFl respectively. Lanes 5 and 6 are extracts from cells simultaneously infected with vNFI and vNFIBD viruses at ratios 1:1 and 1:5 respectively. Lanes 7 are vNFI and vNFIBD mixed in vitro prior to incubation with the labelled oligonucleotides.

561

F.Gounari et al.

Identification of the minimal NF1 peptide capable of binding DNA The experiments presented in the previous sections allow us to conclude that the amino-terminal 240 amino acids of rat NFl contain all the information necessary and sufficient to bind DNA and to oligomerize. Next we wished to distinguish within these 240 amino acids the subregions involved in binding from those involved in oligomerization. For a more rapid analysis of the various constructions we decided to synthesize NF1 and its mutants in vitro, by means of the T7-T3 1

2

3

4 _ 90 000 66 000 -

_ 45 000

30 000

Fig. 5. Cross-linking of vNFIBD. 12.5% SDS-polyacrylamide gel showing the products of the cross-linking reactions. Lane 1, untreated vNFIBD protein (50 ng); lane 2, vNFIBD incubated with 10 mM EDC, 2 h at 37°C, lane 3, vNFIBD (100 ng) incubated with glutaraldehyde for 5 min at room temperature. The proteins in lanes 1-3 were revealed by silver staining. Lane 4, immunoblot of a sample treated as in lane 3.

5

polymerase transcription coupled with in vitro translation by rabbit reticulocyte lysate or wheat germ extracts (see Materials and methods). Full-length NFl produced in vitro binds DNA specifically (Figure 6) and is capable of oligomerization in a manner undistinguishable from that of vNF1 (see below). Mutant forms of NFl were generated either by site-directed mutagenesis of the wild-type template or simply by digestion of the template by restriction endonucleases. Carboxy-terminal deletions of the protein revealed that the minimal peptide still capable of binding DNA with full activity is the 240 amino acid peptide already characterized in the vaccinia expression system. A shorter protein of 206 amino acids (DC206), binds DNA only with 10% efficiency. A shorter protein, of 186 amino acids (DC 186), does not bind DNA. Deletions at the amino terminus were generated by site-directed mutagenesis. Removal of the first 11 amino acids (mutant Dl) did not affect DNA binding. In contrast, internal deletions, removing from residue 24 to 33 (mutant D2) or from 24 to 53 (mutant D4), generate proteins that have lost the capacity to bind DNA. These results indicate that the region essential for efficient DNA binding is localized between amino acid residues 11 and 240. Such a large domain most likely comprises the amino acid sequences essential for DNA recognition and those involved in oligomerization. Most likely oligomerization is essential for DNA binding. In an attempt to identify the regions more specifically

NF1 DC206

DC DC NF1 316 206

DC 186

_

Di

}

*

ta

'i

S.,

-.

_

n_

_4

.......

_w

-w

2

1

DNA

3

4

recognition

7

5 oDIic'n

~

4_

8

9

10

12

1

13

14

15

-

18

-: .e

:: -ler sa t

NF1

1

DC206

-

r

DC316

ZZ-.ZZ2

_-

DC186 Dl

_

D2 D4

:

X --

------------

__

--.

1 LD

_

__._

:_

a

-

-

Fig. 6. Localization of the oligomerization and DNA recognition domains of NFI. (Upper panel) Bandshift with the Adeno ori probe incubated with proteins translated using wheat germ extracts of NFI (lane 1), DC316 (lane 2), DC206 (10 times more protein with respect to the other proteins) (lane 3), DC186 (lane 4), DI (lane 5), D2 (lane 6), D4 (lane 7) and co-translations of NF1/DC206 at protein ratios 1/2 (lane 8), 1/5 (lane 9), 1/10 (lane 10) and 1/13 (lane 11); NFI/DC186 at protein ratios 1/7 (lane 12), 1/22 (lane 13) and 1/66 (lane 14); NF1/D4 at protein ratios 1/1 (lane 15), 1/2 (lane 16) and 1/9 (lane 17). B is wheat germ extracts in the absence of RNA template (lane 18). (Lower panel) Schematic representation of the NFI mutations used in the upper panel and description of their binding and oligomerization activities.

562

Recombinant NF1 activates DNA replication

involved in oligomerization we performed another series of experiments in which wt NFl was co-translated in the presence of scalar amounts of mutant templates. The rationale behind these experiments is the following: if one particular mutant has lost the capability to bind DNA target sequences because the mutation has impaired DNA recognition but not its oligomerization properties, then we expect that the protein product of this mutant can act as a dominant suppressor of binding activity upon formation of non-productive complexes with the wt protein. Conversely, a mutant whose oligomerization capability has been impaired should not affect the activity of the wt protein. Template RNA of the wt NFl was mixed with increasing amounts of mutant template RNA and translated using wheat germ extracts in presence of [35S]methionine. The molar ratios of NFl over mutant protein synthesized were quantitated by radioactivity on SDS-PAGE. Extract volumes adjusted to contain the same amount of wt NFl were used in gelretardation assays (Figure 6, lanes 8-17). Increasing the quantity of DC206 protein over NF1 leads to detection of heterodimers (Figure 6, lanes 8-10), while above 10-fold excess of DC206 is required for detection of mutant homodimers bound to DNA (Figure 6, lane 11). It is to be noted that practically all the wt molecule can be driven into the formation of an heterodimer, indicating that the heterodimer binds DNA with an efficiency comparable to that of the wt homodimer. However, in order to get the heterodimer, a considerable excess of DC206 mutant must be used, suggesting that this mutant has an impaired capacity to oligomerize with the wt molecule. The DC 186 mutant does not affect the binding activity of NFl even at 62-fold excess. Excess of D2 (data not shown) and N mutant proteins (Figure 6, lane 15-17), which do not bind to DNA, results in inhibition of wt NFl binding activity, suggesting that these latter mutants have conserved the capacity to form heterocomplexes with the wt protein. It is important to note that the inhibitory effect of D4 over the binding to DNA of the wt molecule is detectable already when the mutant and the wt moleucles are present in comparable amounts (Figure 6, lanes 15 and 16). This result suggests that the D4 mutant is as capable of oligomerizing as the wild-type molecule; however, the resulting heterodimer cannot bind DNA, hence the overall result is an inhibition of the DNA-binding activity of the wt molecule. For the experiments shown in Figure 6, the DNA probe was the palindromic sequence present on the Adeno ori region. However, identical results (data not shown) were obtained with the half binding site present in the albumin promoter. This suggests that DNA binding can only be obtained with a dimer of two functional subunits even when

the target DNA consists only of half of the palindromic sequence. The oligomerization properties of the various mutant proteins synthesized in vitro were studied independently by size exclusion chromatography on a Superose 12 column after partial purification on a heparin-Sepharose column. The results are summarised in Table I. Under the conditions used for this study, NFl migrated with an apparent mol. wt corresponding to that of a tetramer. 3' deletion mutants down to DC318 also migrated as tetramers, although minor amounts of dimer were occasionally observed for this latter protein. D4 was essentially undistinguishable from the wt protein with respect to its chromatographic properties, as expected from the experiments above. The only mutant protein that showed a considerable amount of monomer (consistently 50-70% of the total radioactivity) was DC206, suggesting that the oligomerization capability of this protein is severely impaired. Unfortunately analysis of DC 186 by this means was not possible, since all the labelled protein was consistently found in the exclusion volume. vNFlBD accumulates in the nudeus In order to establish whether the subcellular localization of the recombinant vNF1BD is similar to that of the endogenous protein, we carried out a gel-retardation experiment comparing cytoplasmic and nuclear extracts of cells infected with vNFIBD virus. As probes we used 32P-labelled dsDNA oligonucleotides containing either the Adeno ori or the Alb 34 sites. Binding activity in cytoplasmic extracts (Figure 7, lanes 2 and 4) is significantly less than in nuclear extracts (lanes 1 and 3). Therefore, vNFIBD accumulates in the nucleus, implicating that the signal for nuclear transport must be located within the 240 N-terminal amino acids. Analogous experiments using cells expressing vNF1 showed a similar distribution between nucleus and cytoplasm (data not shown).

Recombinant vNF1 and vNF1BD stimulate adenovirus DNA replication in vitro We used an in vitro reconstituted replication assay to test whether vNFl and vNFlBD retain the functional properties of NFl purified from HeLa cells (Pruijn et al., 1986). *i

- e F 1 J,

Table I. Mr and subunit structure of wild-type and mutant NFI proteins synthesized in vitro Protein

Subunit Mra

Apparent native Mr

Proposed

NFl

54 404 50 689 41 759 35 466 23 864

250 000 210 000 180 000 140 000 75 000/20 500

tetramer tetramer tetramer

D4 DC376 DC316 DC206

structure

tetramerb tetramer/monomer

aSubunit Mrs are calculated from primary sequences.

bOccasionally a minor peak at 70 000 was detectable

-

for this mutant.

f[j

ilIL.;

- ~,21f P et1ef nlnii

*

rnj

4.

Fig. 7. Subcellular localization of NF1BD. Retarded complexes obtained by incubating nuclear (lanes 1 and 3) or cytoplasmic extracts (lanes 2 and 4) of vNFIBD infected cells with either labelled Alb 34 oligonucleotide (lanes 1 and 2), or the Adeno ori oligonucleotides (lanes 3 and 4).

563

F.Gounari et al.

Fig. 8. The effect of vNFI and vNFIBD on adenovirus 2 DNA replication in vitro. Replication of terminal fragments of XhoI-digested DNA-TP isolated from virions was performed using cytoplasmic extracts of cells infected with wt (lanes 13-15), or recombinant viruses expressing vNF1 (lanes 5-8) and vNFIBD (lanes 9-12). Lanes 1-4, purified HeLa NFI (6 ng/,ul); lane 16, in the absence of NFI. The quantities added were 0.03 IL (lanes 1, 5, 9, 13), 0.1 Id (lanes 2, 6, 10), 0.3 I1 (lanes 3, 7, 11, 14) and 1 Id (lanes 4, 8, 12, 15).

Adenovirus genomic DNA digested wtih XhoI was used as a template. Replication was measured by the incorporation of 32P-labelled deoxyribonucleotides in the origin containing fragments (Figure 8B and C). The effect of vNF1 and vNFIBD on replication was assayed by the addition of crude cytoplasmic extracts of cells infected with vNF1 (lanes 5-8), or with vNF1BD viruses Oanes 9-12). The extent of stimulation is comparable to that obtained with NFl purified from uninfected HeLa cells (lanes 1-4). The basal level of replication in the absence of NF 1, or in the presence of extracts of cells infected with wt virus is shown in lanes 16 and 13-15 respectively. Maximum stimulation of replication was reached using 0.1 Al of vNF1 or 1 /tl of vNF1BD crude cytoplasmic extracts which correspond to 2.5 x 103 and 2.5 x 104 cells respectively. This is comparable to the activation of replication obtained with 0.3 ,1l of purified NFI from HeLa cells (6 ng/,4l). A larger amount of vNFIBD extract is required for maximal stimulation as compared to vNFI. However, a careful quantitation of the specific activity was not carried out, and therefore a meaningful comparison of the relative activity of vNF1 and vNFIBD requires further experiments. It can be concluded that the N-terminal part of NFI is capable of stimulating DNA replication in vitro. The cytoplasmic extract from HeLa cells infected with the wt virus did not have any effect on replication, ruling out the possibility that endogenous HeLa NFl might be responsible for the observed effect.

Discussion In this paper we demonstrate that rat NFl can be efficiently expressed in HeLa cells, using a recombinant vaccinia virus. The vaccinia expression system offers a number of advantages. First, the virus is able to infect and replicate in a wide range of mammalian cultured cells (for review see Smith et al., 1984). Second, overexpression of transcription factors does not appear to interfere with the infectious cycle of the virus (De Magistris and Stunnenberg, 1988; Vos and Stunnenberg, 1988). Third, several proteins produced using recombinant vaccinia viruses have been shown to be biologically active (Stunnenberg et al., 1988; Sap et al., 1989; Schmid et al., 1989). It was also shown that proteins synthesized in this way are post-translationally modified (Guizani et al., 1988). This is an important point, in the light of the recent observations that post-translational modifications and especially phosphorylation of DNA-binding proteins might

564

be essential for function (Montminy and Belezikjian, 1987; Sen and Baltimore, 1986; Yamamoto et al., 1988; Jones and Jones, 1989). The level of the recombinant NFl protein in vaccinia-infected HeLa cells is - 100-fold higher as compared to the endogenous HeLa protein (data not shown). We show that the DNA-binding domain of NFI is located within the first 240 amino acids. This is the region of highest homology among the various NF1 molecules cloned from human (Santoro et al., 1988), rat (Paonessa et al., 1988; V.De Simone and R.Cortese, unpublished data), pig (Meisterernst et al., 1988) and hamster (Gil et al., 1988). The relative binding affinity of vNF1 and vNF1BD for all four different NFl recognition sites is similar, with the exception of the RBP1 site, for which the vNFl displays higher affinity than the vNF1BD. This observation has not been explored further. Comparison of the DNA-binding activity present in nuclear and cytoplasmic extracts indicates that both vNF1 and vNFlBD accumulate in the nucleus. This observation confirms that nuclear transport is still active in vaccinia-infected cells. Moreover, it reveals that the information for nuclear transport is also contained within the first 240 amino acids. Inspection of the sequence of these 240 amino acids sufficient for DNA binding does not reveal any obvious feature associated with well-characterized DNA-binding domains (for review see Struhl, 1989). There are several regions within vNFlBD that exhibit a potential to fold into an a-helix, although none of them displays the specific features of the helix-turn-helix motif characteristic of the cro-like proteins (Dodd and Egan, 1987). vNF1 and vNFlBD bind with higher affinity to a palindromic NFl recognition site than to half sites. We have shown here that NFl exists as an oligomer and binds to both palindromic and half sites as a dimer. Thus, the much higher affinity for the former is most likely due to the larger contact area between DNA and the protein dimer, consistent with the twofold axis of symmetry shown by the contact points between the protein and DNA on the adenovirus origin of replication (de Vries et al., 1987). There is no obvious sequence associated with oligomerization, such as regularly spaced leucine residues (Landschutz et al., 1988). Our finding that the mutants D2 and D4 do not bind to DNA but are still able to oligomerize suggests that these mutations occur in a region of the protein whose integrity is necessary in order to recognize the target DNA. Computeraided analysis of this portion of NFl shows that there are clusters of positively charged amino acids, in a region with

Recombinant NF1 activates DNA replication

propensity to fold in an a-helical structure. Furthermore, a projection of this region of the protein as a helical net reveals that the most of the positive charges would occur only on one face of the putative helix. The C-terminal part of vNFlBD (first 240 amino acids) is probably involved in the oligomerization of the protein, since a C-terminal truncation of an additional 34 amino acids (DC206) shows reduced DNA-binding activity as well as an altered quatemary structure. Deletion of a further 20 amino acids generates the mutant DC186, which is inactive with respect to both DNA binding and ability to form heterocomplexes with the wt protein. The region of NFl represented by this latter mutant is encoded by a single exon and is strikingly conserved throughout the NFl gene family. It is therefore likely that the region comprised between amino acids 12 and 186 of rat liver NFl represents a modular unit whose integrity is needed for DNA binding, but yet not sufficient. An additional, more variable region in the rat protein represented by amino acids 187-240 is required in order to guide efficient oligomerization of the protein. Thus a bipartite binding site may be formed by bringing in close proximity and in the appropriate orientation the regions of NFl that are involved in DNA recognition and binding. This architecture is somewhat reminiscent of that of several other DNA-binding proteins, like C/EBP, Jun, cFos and GCN4, in which the C-terminal leucine zippers hold together the basic-residue-rich regions, probably involved in contacting the DNA (Landschulz et al., 1989; Turner and Tjian, 1989). Of the two known functions of NFl, namely transcriptional factor and DNA replication factor, only the latter has been tested in this paper. vNFl as well as the N-terminal 240 amino acids contained within vNFIBD are both capable of stimulating adenovirus DNA replication in vitro. It should be noted that transcriptional activation appears to require a specific activation domain located further downstream towards the C-terminal end of the molecule (Mermod et al., 1989; A.Nicosia, P.Monaci and R.Cortese, manuscript in preparation). Thus, activation of DNA replication is mediated by a physically separated domain, distinct from that conferring transcriptional activation. It will be interesting to establish whether the DNA-binding domain can be physically separated from the DNA replication domain. It is likely that mere binding to DNA is sufficient to stimulate DNA replication, possibly through a conformational change in the DNA structure as proposed for SV40 large T antigen (Dean et al., 1987; Wold et al., 1987).

Materials and methods Preparation of vaccinia recombinant viruses An EcoRl fragment of 1.7 kb containing the rat NFI cDNA (Paonessa et al., 1988) was inserted into the vaccinia recombination vector pl1K-18 downstream the 11K late viral promoter (Stunnenberg et al., 1988). The first nine amino acids consisted of Met-Asn-Trp-Ile-Glu-Leu-Glu-Glu-Phe. A fragment coding for the N-terminal 240 amino acids of NFl was inserted into the vaccinia recombination vector. The first eight amino acids consisted of Met-Asn-Trp-Ile-Leu-Ala-Gly-Arg. These plasmids were used to prepare recombinant viruses essentially according to the procedure described by Kieny et al. (1984).

[35S]Methionine labelling of vaccinia-infected cells Semi-confluent monolayer of HeLa cells were infected with wt (strain wr) or with recombinant viruses at a m.o.i. of 5 and incubated overnight at 370C. The cells were washed with PBS and incubated in methionine-free medium which was replaced after 1 h by 0.75 ml of fresh methionine-free medium

containing 75 ACi of [35S]methionine and the incubation was continued for an additional hour. Cell lysates were then prepared and the labelled polypeptides were anlaysed by SDS-PAGE and fluorography.

Adenovirus replication assay HeLa cells in suspension were infected at a concentration of 3 x 106 cells/ml in PBS at m.o.i. of 5 and diluted 10-fold with fresh medium after 50 min at 37°C. Sixteen hours later the infected cells were harvested, washed twice with cold PBS, 0.5 mM MgCl2 and suspended in 20 mM HEPES, pH 7.5, 5 mM dithiothreitol (DTT) at a density of 5 x 107 cells/ml. All further procedures were at 4°C. After 10 min cells were dounce homogenized and nuclei were spun down at low speed. The supematant was centrifuged for 30 min in an Eppendorf centrifuge and supplemented with 20% glycerol, 10% sucrose, 2 mM DTT (final concentrations) and stored frozen at -80°C. Replication of terminal fragments of XhoI-digested DNA-TP (terminal protein) isolated from virions was performed as described previously (Pruijn et al., 1986) using cytoplasmic extracts of cells infected with wt or recombinant viruses expressing vNFI and vNFlBD. The adenovirus DNA polymerase and the pre-terminal protein (pTP) used in these experiments were purified from cytoplasmic extracts of HeLa cells simultaneously infected with recombinant viruses expressing the two proteins (Stunnenberg et al., 1988; P.C.van der Vliet, unpublished data). NFI (6 ng/ul) purified from uninfected HeLa cells (Pruijn et al., 1986) or cytoplasmic extracts (soluble proteins from 2.5 x 104 cells/il) of recombinant virus infected HeLa cells were added as indicated in the figure legends. Mobility retardation assay Extracts were pre-incubated on ice in a 20 IL reaction mixture containing 20 mM Tris, pH 7.6, 8% Ficoll, 50 mM KCI, 0.2 mM DTT, 1 yg poly(dI-dC), 3 mM MgCl2 and 3 mM spermidine. After 15 min, 10 000-20 000 c.p.m. of end-labelled double-stranded oligonucleotide in 1 ,gl was added, and the incubation continued for a further 15 min at room temperature. Free DNA and protein-DNA complexes were resolved on a 6% polyacrylamide gel in 0.5 x TBE (45 mM Tris-borate, pH 8.3, 2 mM EDTA). After the run the gel was dried onto Whatman DE 52 paper and exposed. In the competition experiments, competitor oligos were added in geometrically increasing concentrations to the reaction mixture, prior to the addition of the labelled oligo.

Protein cross-linking Glutaraldehyde cross-linking was carried out on a pure preparation of vNFIBD protein (protein concentration 5 uM) in 20 mM HEPES/NaOH, pH 8, 100 mM NaCl, 2 mM MgCl2, 0.5 mM EDTA, 10% glycerol. The reaction was started by addition of glutaraldehyde to a final concentration of 3 mM and allowed to proceed at room temperature for up to 30 min. The unreacted glutaraldehyde was then neutralized by addition of ethanolamine to a final concentration of 10 mM. Cross-linking with N-ethyl-3-(3dimethylaminopropyl)carbodiimide was carried out on the same protein preparation after dialysis in 20 mM MES/NaOH, pH 6.5, 100 mM NaCl, 2 mM MgCl2, 0.5 mM EDTA, 10% glycerol. EDC was added to a fmnal concentration of 10 mM and allowed to react for 2 h at 37°C. The reaction was then quenched by addition of a molar excess of ammonium acetate. The reaction products were analysed on a 12.5% SDS-PAGE according to Laemmli (1970), and revealed for silver staining. Alternatively the gel was electroblotted onto Immobilon membrane (Millipore) and subsequently immunostained as previously reported by Paonessa et al. (1988) using the polyclonal antibodies against peptide 6 therein described.

Preparation of cell extracts and purification of proteins Whole-cell extracts of infected cells were prepared according to Zimarino and Wu (1987), while the method described by Dignam et al. (1983) was used for the preparation of nuclear and cytoplasmic extracts. vNF1 and vNFlBD proteins used for cross-linking experiments were purified from nuclear extracts of virus-infected HeLa cells by means of gel-filtration chromatography on Sephacryl S-300 (Pharmacia) and DNA affinity chromatography. A detailed purification scheme will be reported elsewhere. HeLa NFl used in the activation of adenovirus replication experiment was purified according to the published procedures (Leegwater et al., 1985). Mutagenesis The 3' deletion mutants DC376 and DC316 were created by restriction of the full-length cDNA using the restriction endonucleases BstXl and SphI respectively. The other NFl mutants were generated by site-directed mutagenesis according to Venkitaraman (1989). The mutagenesis oligo-

nucleotides were GACCAGCCAGCCATGCTCTAGAGGTT for DC206, GTACATGCAGCATGAATTCAAGTCAAT for DC186, CGGCAGT-

565

F.Gounari et al. TATGTACTCTTCGTTTCATCCTTT for Dl, TTCTGCCCCATGTCTCTTCGCAGGCCCGAAA for D2 and TTCTGCCCCATGTCTCTTCGAGGGCTGTGAA for D4. In vitro transcription using T3 or T7 polymerase In vitro transcription reactions of the NFl cDNAs cloned in Bluescript vectors were performed essentially according to the recommendation of the manufacturer (Stratagene) using either T3 or T7 RNA polymerase. Thus, 1 Ag of restricted RNase-free DNA template was incubated for 1 h at 37°C in a 10 Al volume containing 2 l1 of 5 x transcription buffer (200 mM Tris, pH 8, 40 mM MgCl2, 10 mM spermidine, 250 mM NaCI), 2 Al NTPs (2.5 mM each), 1 11 RNase-Block (25 U/1l), 0.25 Al T3 or T7 RNA polymerase (50 U/pl). In vitro translation using rabbit reticulocyte and wheat germ extract Wheat germ or rabbit reticulocyte extacts for in vtro translations were obtaind from Promega. Translations using the wheat germ extracts were carried out as recommended by the manufactrr, while 10 yA of rabbit reticulocyte extracts were incubated in a total volume of 25 1l, containing 3 1l of amino acids minus methionine (1 mM each) 2 i1 methionine (1200 Ci/mmol), and 0.5 /tg RNA template, at 30°C for 90 min.

Analysis of subunit composition of in vitro translated proteins by size exclusion chromatography Freshly translated [35S]methionine-labelled proteins were partially purified on a heparin-Sepharose column in the condition described by Paonessa et al. (1988). About 1 000 000 c.p.m. were then loaded onto a Superose 12 column (Pharmacia) previously equilibrated in a buffer containing 20 mM HEPES/NaOH, 250 mM NaCI, 0.05 % CHAPS and 1 mM DTT. The proteins were eluted at a flow rate of 0.4 ml/min, fractions of 200 1l collected and counted at the scintillation counter. A reference curve was built using apofenitin (Mr 440 000), fl-amilase (Mr 200 000), alcohol dehydrogenase (Mr 150 000), bovine serum albumin (Mr 66 000), egg albumin (Mr 45 000), carbonic anhydrase (Mr 30 000) and cytochrome c (Mr 12 500) as mol. wt standards.

Acknowledgements We gratefully acknowledge A.Lamond for critical reading of the manuscript. We thank C.P.Verryzer for his assistance in the replication experiments. F.G. was supported by a Boehringer Ingelheim post-doctoral fellowship. R.D.F. is a recipient of a long-term EMBO postdoctoral fellowship. This work was in part supported by the Netherlands Foundation of Chemical Research (SON) with financial support from the Netherlands Organization of Scientific Research

(NWO).

References Ammendola,R., Gounari,F., Piaggio,G., De Simone,V. and Cortese,R. (1989) Mol. Cell. Biol., in press. Angel,P., Imagawa,M., Chiu,R., Stein,B., Imbra,R.J., Rhamsdorf,H.J., Jonat,C., Herrlich,P. and Karin,M. (1988) Cell, 49, 729-739. Beato,M. (1989) Cell, 56, 335-344. Borgmeyer,U., Nowock,J. and Sippel,A.E. (1984) Nucleic Acids Res., 12, 4295-4311. Colantuoni,V., Pirrozi,A., Blance,C. and Cortese,R. (1987) EMBO J., 6, 631-636. Dean,F.B., Bullock,D., Murakami,Y., Wobbe,C.R., Weissbach,L. and Hurvitz,J. (1987) Proc. Natl. Acad. Sci. USA, 84, 16-20. De Magistris,L. and Stunnenberg,H.G. (1988) Nucleic Acids Res., 16, 3141-3156. de Vries,E., van Driel,W., Tromp,M., van Boom,J. and van der Vliet,P.C. (1985) Nucleic Acids Res., 13, 4935-4952. de Vries,E., van Driel,W., van den Heuvel,S.J.L. and van der Vliet,P.C. (1987) EMBO J., 6, 161-168. Dignam,J.D., Lebovitz,R.M. and Roeder,R.G. (1983) Nucleic Acids Res., 11, 1475-1489. Dodd,I.B. and Egan,J.B. (1987) Trends Genet., 4, 214-219. Gander,I., Foelker,R., Rogge,L., Meisterernst,M., Schneider,R., Merzt,R., Lottspeich,F. and Winnacker,E.-L. (1988) Biochim. Biophys. Acta, 951, 411-418. Gi],G., Smith,J.R., Goldstein,J.L., Slaughter,C.A., Orth,K., Brown,M.S. and Osborne,T. (1988) Proc. Natl. Acad. Sci. USA, 85, 8963-8967. Gronostajski,R.M., Adya,S., Nagata,K., Guggenheimer,R.A. and Hurwitz,J. (1985) Mol. Cell. Biol., 5, 964-971. Guizani,I., Kieny,M.P., Lathe,R. and Clertant,R. (1988) Gene, 73, 163-173.

566

Hay,R.T. (1985) EMBO J., 4, 421-426. Henninghuasen,L., Siebenlist,U., Danner,D., Leder,P., Rawlins,D., Rosenfeld,P. and Kelly,T. (1985) Nature, 314, 289-292. Hope,I.A. and Struhl,K. (1987) EMBO J., 6, 2781-2784. Jones,K.A., Yamamoto,K.R. and Tjian,R. (1985) Cell, 42, 559-572. Jones,K.A., Kadonaga,J.T., Rosenfeld,P.J., Kelly,T.J. and Tjian,R. (1987) Cell, 48, 79-89. Jones,R.H. and Jones,N.C. (1989) Proc. Natl. Acad. Sci. USA, 86, 2176-2180. Kieny,M.P., Lathe,R., Drillien,R., Spehner,D., Scory,S., Schmitt,D., Wictor,T., Korpowsky,H. and Lecocq,J.P. (1984) Nature, 312, 163-166. Laemrnli,U.K. (1970) Nature, 277, 680-685. Landschulz,W.H., Johnson,P.F. and McKnight,S.L. (1988) Science, 240, 1759-1764. Landschulz,W.H., Johnson,P.F. and McKnight,S.L. (1989) Science, 243, 1681-1698. Leegwater,P.A.J., van Driel,W. and van der Vliet,P.C. (1985) EMBO J., 4, 1515-1521. Lin,Y.-S., Carey,M.F., Ptashne,M. and Green,M. (1988) Cell, 54, 659-664. Meisterernst,M., Donath,C., Lottspeich,F., Mertz,R., Dobner,T., Fockler,R. and, Stelzer,G. (1988) FEBS Lent., 236, 27-32. Montminy,M.R. and Bilezikjian,L.M. (1987) Nature, 328, 175-178. Nagata,K., Guggenheimer,R.A. and Hurwitz,J. (1983) Proc. Natl. Acad. Sci. USA, 80, 6177-6181. Paonessa,G., Gounari,F., Frank,R. and Cortese,R. (1988) EMBO J., 7, 3115-3123. Pruijn,G.J.M., Kusters,H.G., Gmelig Myeling,F.H.J. and van der Vliet,P.C. (1986) Eur. J. Biochem., 154, 363-370. Rawlins,D.R., Rosenfeld,P.J., Wides,R.J., Challberg,M.D. and Kelly,T.J. (1984) Cell, 37, 309-319. Rosenfeld,P.J. and Kelly,T.J. (1986) J. Biol. Chem., 261, 1398-1408. Santoro,C., Mermod,N., Andrews,P.C. and Tjian,R. (1988) Nature, 334, 218-224. Sap,J., Munoz,A., Schmitt,J., Stunnenberg,H. and Vennstrom,B. (1989) Nature, 340, 242-244. Schule,R., Muller,M., Kaitschmidt,C. and Renkawitz,R. (1988) Science, 242, 1418-1420. Schmid,W., Strahle,U., Schutz,G., Schmitt,J. and Stunnenberg,H. (1989) EMBO J., 8, 2257-2263. Sen,R. and Baltimore,D. (1986) Cell, 47, 921-928. Smith,G.L., Mackett,M. and Moss,B. (1984) Biotechnol. Genet. Engng. Rev., 2, 383-407. Strahle,U., Schmid,W. and Schutz,G. (1988) EMBO J., 7, 3389-3395. Struhl,K. (1989) Trends Biochem.Sci., 14, 137-140. Stunnenberg,H.G., Lange,H., Philipson,L., van Mitenburg,R.T. and van der Vliet,P.C. (1988) Nucleic Acids Res., 16, 2431-2444. Tae,H.J. (1983) Methods Enzymol., 91, 580-609. Turner,R. and Tjian,R. (1989) Science, 243, 1689-1694. Venkitaram,A.R. (1989) Nucleic Acids Res., 17, 3314. Vos,J.C. and Stunnenberg,H.G. (1988) EMBO J., 7, 3487-3492. Yamamoto,K.K., Gonzales,G.A., Biggs,W.H. and Montminy,M.R. (1988) Nature, 334, 494-498. Wold,M.S., Li,J.J. and Kelly,T.J. (1987) Proc. Natl. Acad. Sci. USA, 84, 3643-3647. Zimarino,V. and Wu,C. (1987) Nature, 327, 727-730. Received on July 20, 1989; revised on October 30, 1989