bs_bs_banner

Plant, Cell and Environment (2014) 37, 840–851

doi: 10.1111/pce.12202

Original Article

Ammonium tolerance in the cyanobacterium Synechocystis sp. strain PCC 6803 and the role of the psbA multigene family Guo-Zheng Dai1,2,3, Bao-Sheng Qiu2,3 & Karl Forchhammer1 1

Interfaculty Institute for Microbiology and Infection Medicine, Division Organismic Interactions, University of Tübingen, Auf der Morgenstelle 28, D-72076 Tübingen, Germany, 2College of Life Sciences, Central China Normal University, 430079 Wuhan, Hubei, China and 3Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, 430079 Wuhan, Hubei, China

ABSTRACT Ammonium is one of the major nutrients for plants, and a ubiquitous intermediate in plant metabolism, but it is also known to be toxic to many organisms, in particular to plants and oxygenic photosynthetic microorganisms. Although previous studies revealed a link between ammonium toxicity and photodamage in cyanobacteria under in vivo conditions, ammonium-induced photodamage of photosystem II (PSII) has not yet been investigated with isolated thylakoid membranes. We show here that ammonium directly accelerated photodamage of PSII in Synechocystis sp. strain PCC6803, rather than affecting the repair of photodamaged PSII. Using isolated thylakoid membranes, it could be demonstrated that ammonium-induced photodamage of PSII primarily occurred at the oxygen evolution complex, which has a known binding site for ammonium. Wild-type Synechocystis PCC6803 cells can tolerate relatively high concentrations of ammonium because of efficient PSII repair. Ammonium tolerance requires all three psbA genes since mutants of any of the three single psbA genes are more sensitive to ammonium than wild-type cells. Even the poorly expressed psbA1 gene, whose expression was studied in some detail, plays a detectable role in ammonium tolerance. Key-words: ammonium toxicity; photoinhibition; photosystem II; oxygen evolution complex.

INTRODUCTION Ammonium (in this communication, the term ammonium denotes both NH3 and NH4+, whereas ammonia denotes specifically NH3) is one of the major nutrients for plants, and a ubiquitous intermediate in plant metabolism (Von Wirén et al. 2000). It is energetically the most favourable nitrogen source (Bloom et al. 1992; Britto et al. 2001) but on the other hand, ammonium can be toxic to plants, algae and cyanobacteria (Britto & Kronzucker 2002; Dai et al. 2008; Drath et al. 2008; Dai et al. 2012; Li et al. 2012). By contrast, Correspondence: K. Forchhammer and B-S. Qiu. Fax:+49 7071 295843; e-mail: [email protected]; [email protected] 840

heterotrophic bacteria are highly resistant to ammonium and tolerate concentrations until they suffer osmotic stress (Müller et al. 2006). The cyanobacterium Synechocystis sp. strain PCC 6803 (hereafter called Synechocystis) used in this investigation is a model organism to study fundamental processes of oxygenic photosynthesis. Photosystem II (PSII) reaction centres catalyse oxidation of water to molecular oxygen and reduction of plastoquinone (Kashino et al. 2002). The oxygen-evolving complex (OEC) of PSII consists of a cubane-like Mn4CaO5 cluster, with five oxygen atoms linking the five metal atoms, and four bound water molecules (Diner 2001; Ferreira et al. 2004; Umena et al. 2011). In addition to powering the photochemical reactions of photosynthesis, light damages the PSII complex, causing photoinhibition (Aro et al. 2005; Takahashi & Badger 2011). To overcome photodamage of PSII, the damaged D1 protein of PSII is degraded and replaced with newly synthesized protein during the process called the ‘PSII repair cycle’ (Aro et al. 1993; Nixon et al. 2005; Murata et al. 2007; Takahashi & Badger 2011; Komenda et al. 2012). Pure photodamage can be monitored by complete inhibition of the repair process with protein synthesis inhibitors (Murata et al. 2007). The extent of photoinhibition depends on the balance between the rates of PSII photodamage and PSII repair. Several mechanisms of photodamage are under debate. According to the acceptor-side hypothesis, photodamage occurs when the capacity of metabolic processes is not sufficient to utilize the electrons produced in the primary photoreactions (Setlik et al. 1990; Vass et al. 1992). In consequence of over-reduced plastoquinone pool, electrons cannot be released from excited PSII, leading to the formation of triplet excited state P680 (3P680). This should form highly reactive singlet oxygen, which damages the PSII reaction centre protein (Krieger-Liszkay et al. 2008; Vass & Cser 2009; Vass 2011, 2012). The donor-side hypothesis suggests that photodamage occurs via a two-step process: the first step is light-dependent destruction of the Mn-cluster of OEC followed by inactivation of the photochemical reaction centre of PSII by excitation of the reaction centre chlorophyll in the absence of a functional OEC (Ohnishi et al. 2005). The latter mechanism © 2013 John Wiley & Sons Ltd

Ammonium tolerance in Synechocystis is in agreement with the action spectrum of photodamage. It is supported by the mechanism of ultraviolet (UV)-induced photodamage (Barbato et al. 1995; Hakala et al. 2005; Tyystjärvi 2008) and by further studies suggesting that the photodamage under visible light also begins with the loss of OEC activity as the first step (Sicora et al. 2003; Tyystjärvi 2008; Takahashi & Badger 2011). The PSII repair cycle requires de novo synthesis of D1 protein proportional to the rate of photodamage (Kulkarni & Golden 1994). psbA multigene families encoding D1 protein are a unique cyanobacterial characteristic (Kulkarni & Golden 1994). In Synechocystis, the D1 protein is encoded by three genes, psbA1, psbA2 and psbA3 (Jansson et al. 1987). The majority (>90%) of the total psbA transcript pool of Synechocystis is produced by the psbA2 gene and the rest by the psbA3 gene under basic growth conditions. The psbA1 gene was long thought to be silent (Jansson et al. 1987; Mohamed et al. 1993; Salih & Jansson 1997), but its expression in Synechocystis could be detected under microaerobic conditions (Sicora et al. 2009). Apparently, ‘silent’ psbA genes also exist in other cyanobacterial species (Sicora et al. 2006; Kós et al. 2008), which could play specific roles in acclimating to certain environmental conditions such as microaerobiosis (Summerfield et al. 2008; Sicora et al. 2009; Summerfield et al. 2011). Our previous studies revealed a link between ammonium toxicity and photodamage under in vivo conditions (Dai et al. 2008; Drath et al. 2008). The toxic effect of ammonium was shown to act in concert with PSII photodamage. In agreement with the donor-side hypothesis we suggested, that ammonium acts as a photosensitizer of the OEC, amplifying photodamage of PSII. Toxic ammonium concentrations would surpass the capacity of the PSII repair cycle. This suggestion is in accord with biochemical studies of PSII particles, showing that ammonia binds and inhibits the Mn cluster of the OEC (Britt et al. 1989, 2004; Boussac et al. 1990). Recent studies furthermore showed that ammonium induced a significant alteration on the core structure of the Mn4CaO5 cluster in isolated oxygen evolving PSII membranes in spinach (Hou et al. 2011; Tsuno et al. 2011) and that ammonium is incorporated into the OEC hydrogen bond network (Polander & Barry, 2012). However these in vitro studies were not linked to the physiological process of photoinhibition.A clear demonstration that ammonia/ammonium induces light-dependent photodamage of PSII in isolated thylakoid membranes of cyanobacteria and does not affect the repair from photoinhibition is missing so far. The present study was carried out to close this gap. To reveal the basis of the relatively high ammonium tolerance in the Synechocystis wild-type cells, contribution of the different psbA genes to repair of ammonium-induced photodamage was investigated.

MATERIALS AND METHODS Growth of cyanobacteria Synechocystis sp. strain PCC 6803 was used in this study. Cultures were grown photoautotrophically in liquid BG11 © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

841

medium containing 17.6 mmol L−1 NaNO3 (Rippka 1988) supplemented with 5 mmol L−1 NaHCO3 at 28 °C and under continuous light of 40 μmol photons m−2 s−1, from white fluorescent tubes (LUMILUX de Luxe Daylight, OSRAM GmbH, Munich, Germany). The cultures were constantly shaken at 140 r.p.m. in a culture room at ambient CO2 levels, resulting in doubling time of approximately 17 h. The psbA single deficient mutants and PpsbA1:luxAB strain were maintained with kanamycin (25 μg mL−1) and gentamycin (3 μg mL−1), respectively. For the preparation of isolated thylakoid membrane, three 700 mL cultures were grown in glass flasks and were aerated by air containing 2% CO2. The growth of cultures was monitored by measuring the optical density (OD) at 750 nm. Exponential phase Synechocystis cultures were used for the following experiments.The chlorophyll a (Chl a) contents in cells or thylakoid membranes were determined spectrophotometrically in 90% methanol extracts. The concentration of Chl a was calculated from the absorbance at 665 nm according to Mackinney (1941).

Preparation of isolated thylakoid membranes Three 700 mL cultures of wild-type Synechocystis were grown in BG11 medium until the OD750 value reached 0.9–1.4. The method for preparation of isolated thylakoid membranes was described as Ohnishi et al. (2005). Cells were harvested by centrifugation at 6000 g for 20 min at 25 °C. The cell pellet was suspended in 25 mL medium A (4 °C) [1.0 mol L−1 betaine, 0.4 mol L−1 d-sorbitol, 20 mmol L−1 HEPES-NaOH (pH 7.0), 15 mmol L−1 CaCl2, 15 mmol L−1 MgCl2 and 1 mmol L−1 6-amino-n-caproic acid]. Then, the cells were passed through a French pressure cell at a pressure of 2 × 107 Pa. The homogenate was centrifuged at 4000 g for 10 min at 4 °C to remove cellular debris. Thylakoid membranes were collected by centrifugation at 20 000 g for 60 min at 4 °C and then suspended in medium B [1.0 mol L−1 betaine, 40 mmol L−1 MES-NaOH (pH 6.5), 15 mmol L−1 CaCl2, 15 mmol L−1 MgCl2 and 10 mmol L−1 NaCl].After centrifugation at 20 000 g for 60 min at 4 °C, the collected thylakoid membranes were resuspended in medium B at a concentration of 4 μg Chl a mL−1, frozen in liquid nitrogen and stored at −80 °C until use.

Vector pVLux-psbA1 construction and transformation The luxAB and psbA1 promoter fragments were obtained by PCR amplification of plasmid PBG2106 (Muñoz-Martín et al. 2011) and chromosomal template DNA of Synechocystis, respectively, by using the following primer sets: luxAB (5′CTCAGGTACCAATATAAGGACTCTCTATG-3′ forward primer and 5′-CCCCGAGCTCATAGTTATCTATGCTC CT-3′ reverse primer) and psbA1 promoter (5′-GGGC GTCGACCAGGCAGTATTTTG-3′ forward primer and 5′-GAATGGTACCGAAGTAAGATTTTGGG-3′ reverse primer). The PCR amplification products of luxAB and psbA1 promoter fragments contained (5′) KpnI/SacI (3′) and (5′) SalI/KpnI (3′) restrictable tails, respectively. The luxAB

842 G-Z. Dai et al. fragments were digested with KpnI/SacI and ligated with KpnI/SacI digested pUC19 to generate the plasmid pUC19 + luxAB. KpnI/SalI digested pUC19 + luxAB and psbA1 promoter fragments were ligated to generate the plasmid pUC19 + psbA1 promoter + luxAB. The psbA1 promoter + luxAB fragment was obtained by PCR amplification of plasmid pUC19 + psbA1 promoter + luxAB, by using the primer (5′-GTTATCGATGCTCCTGGGGATTCG-3′ forward primer and 5′-GCATGCCTGCAGGTCGACCAG-3′ reverse primer). The 5′ and 3′ ends of the psbA1 promoter fragment + luxAB contained SalI and ClaI restrictive sites, respectively, which were digested with SalI and ClaI. Plasmid pVZ322 was restricted with ClaI/XhoI, and ligated with ClaI/ SalI digested psbA1 promoter + luxAB fragment to generate the final vector pVLux-psbA1, which was subsequently transformed into Synechocystis by electroporation with Bio-Rad Gene Pulser™ (Bio-Rad, Hercules, CA, USA; 25 μF capacitor, 200 Ω and electric field 10 kV cm−1). Transformants were selected by gentamicin and proven by PCR analysis. The IncQ plasmid pVZ322 is capable of autonomous replication in the cyanobacteria of Synechocystis genus (Zinchenko et al. 1999).

Generation of mutants

Long flanking homology PCR and electroporation To construct a psbA1 inactivation mutant, a DNA fragment containing the kanamycin resistance cassette from plasmid pVZ322 flanked by the upstream and downstream sequences of the psbA1 gene was obtained by long flanking homology PCR. The upstream and downstream sequences of the psbA1 gene were obtained by PCR amplification using chromosomal DNA of Synechocystis as template with the following primer pairs: upstream (forward primer 5′-GGTTAGC ACCGTGGTTAACTCCG-3′ and reverse primer 5′-CAGC AACACCTTCTTCACGAGGCCTGTAATCCTAATTGG G-3′), downstream (5′-ATCAGAATTGGTTAATTGGTTG AAATGGTGGCCCTGAACG-3′ forward primer and 5′GCATTACGACCTTCTCCTTCTGC-3′ reverse primer). The kanamycin resistance cassette was obtained by PCR amplification of plasmid pVZ322, by the following primer sets: (5′-CCTCGTGAAGAAGGTGTTGCTGAC-3′ forward primer and 5′-CAACCAATTAACCAATTCTGA TTA-3′ reverse primer).To flank the kanamycin resistance by the upstream and downstream segments of the psbA1 gene, the psbA1 upstream-forward, and psbA1 downstreamreverse primers together with the three PCR amplification products as template were used for joining PCR. The joining PCR amplification product was finally cloned into the pJET cloning vector (Fermentas, Vilnius, Lithuania) and confirmed by sequencing. The psbA1− inactivation construct was transformed into Synechocystis by electroporation as above, and transformants were selected with kanamycin. All mutants were proven by PCR analysis. The psbA1− mutant generated here was used for the experiment of photosynthetic (Fv/Fm and photosynthetic oxygen evolution) response to high light and 40 mmol L−1 NH4Cl exposure.

Gene insertion inactivation and natural transformation Take psbA1-deficient mutant for example: a 1773 bp DNA fragment containing psbA1 gene was generated by PCR using primers (5′-GGGCAAACTTCACACAGTCAGC-3′ forward primer and 5′-GCCACCATTTGGGCATCACC-3′ reverse primer) with chromosomal DNA of Synechocystis as template, cloned into pMD18-T, and confirmed by sequencing. The kanamycin resistance cassette excised from pRL446 (NCBI GeneBank accession no Eu346690; Elhai & Wolk 1988) by XbaI was inserted into the HpaI site (inside the psbA1 fragment) of that plasmid, resulting in the final plasmid for the inactivation of psbA1 gene in wild-type Synechocystis by natural transformation (Williams 1988). The psbA2 and psbA3 genes inactivation were performed as above, except for the psbA2 gene fragment (1815 bp) generated by PCR using primers (forward primer 5′-CTTATGTC ATCTATAAGCTTCGTG-3′ and 5′-CCACACTGGGAAG TTTGC-3′ reverse primer) and the psbA3 gene fragment (1759 bp DNA) using primers (forward primer 5′-CTC ATATACATAACCGGCTCC-3′ and reverse primer 5′-GT TAGAGCTTCCTGTCCTTG-3′) and the kanamycin resistance cassette was inserted into the NcoI site. All complete segregation of these mutants was proven by PCR analysis. Three psbA mutants generated here were used for comparing different sensitivities to ammonium toxicity and survival tests.

Ammonium and light treatments For ammonium and light treatments, cultures were grown as described above to an optical density (OD750) of 0.4, and the pH was adjusted to a value of 8.8. Then, samples (5–10 mL, 1.2 μg mL−1 Chl a) were removed into glass test tubes (diameter 1.4 cm) and 40 mmol L−1 NH4Cl was added as indicated. Different light intensities were provided with a halogen lamp or white fluorescent tubes by regulating the distance between samples standing in a rack and the light source. For distinguishing the damage and repair of PSII, 30 μg mL−1 chloramphenicol (CMP) was used to prevent the repair cycle of PSII. For comparing the ammonium sensitivity among wild-type Synechocystis and three psbA single deficient mutants, all strains were grown in the pH 8.0 BG11 medium maintained with 20 mmol L−1 N-[tris(hydroxymethyl)methyl-3-amino] propanesulfonic acid (TAPS) to an optical density (OD750) of 0.4, and treated with various concentration ammonium with exposure to 100 μmol photons m−2 s−1 for 20 min. Calculations of EC50 values (concentration, at which 50% Fv/Fm inhibition occurred) and 95% confidence intervals (CIs) were performed with non-linear regression fitting using GraphPad Prism Version 5.00 for Windows (GraphPad Software, San Diego, CA, USA). For comparing the survival and growth of Synechocystis wild type and the three psbA mutants after ammonium treatment, the cells were treated for 48 h with various concentrations of NH4Cl at 100 μmol photons m−2 s−1. Subsequently, the cells were diluted 1:10 and 1:100 with fresh pH 8.0 BG11 medium, and 10 μL aliquots of undiluted and diluted samples were dropped on standard BG11 medium agarose plates. Cells were incubated under © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

Ammonium tolerance in Synechocystis 30 μmol photons m−2 s−1 for 6 d, and the plates were photographed. Isolated thylakoid membranes were treated with 200 mmol L−1 NH4Cl at pH 6.5 and 20 °C, under light intensity of 100 μmol photons m−2 s−1 from a halogen lamp. For the analysis of PpsbA1:luxAB fusion expression, exponential phase cultures with the pH value adjusted to 8.8 were exposed to different light intensities in the presence or absence of ammonium, or without nitrogen addition. For the quantification of psbA genes transcript level, exponential phase cultures (pH value adjusted to 8.8) were treated with 1 or 5 mmol L−1 NH4Cl for 1 h, under a photon flux density of 20 μmol photons m−2 s−1 or 100 μmol photons m−2 s−1 exposure. The psbA genes transcript level under 20 μmol photons m−2 s−1 exposure in the absence of ammonium were used as the control.

843

indicated time points, 1 mL samples containing thylakoid membranes with 4 μg Chl a were removed into the spectrophotometer cuvettes, 80 μmol L−1 DCIP and 0.5 mmol L−1 DPC or only 80 μmol L−1 DCIP were added and mixed, and the absorption at 580 nm was measured immediately. Then, cuvettes were rapidly exposed to 700 μmol photons m−2 s−1 of red light (filtered white light by 026 Lee Filter) for 30 s, and the absorption at 580 nm was measured immediately. The cuvette was rapidly exposed to red light for 30 s again, and the absorption was measured again. This process was repeated for several times. The absorption at 580 nm after 0, 30, 60 and 90 s light exposure was plotted against incubation time. The slopes of fitted curves were used for comparing PSII activity of isolated thylakoid membranes, in the presence or absence of 200 mmol L−1 NH4Cl or 200 mmol L−1 KCl.

Measurement of photosynthetic activity by WATER-PAM chlorophyll fluorescence

Bioluminescence measurements

PSII activity was analysed in vivo with a WATER-PAM chlorophyll fluorometer (Walz GmbH, Effeltrich, Germany). All samples were dark-adapted for 5 min before measurement. The maximal PSII quantum yield (Fv/Fm) was determined with the saturation pulse method (Genty et al. 1989; Schreiber et al. 1995). Cultures were diluted 1:20 in BG11 medium before the measurements in a final volume of 2 mL.

Culture samples of 0.5 mL with an optical density (OD750) of about 0.4 were removed into transparent plastic tubes, and then 5 μL of 0.1 mmol L−1 decanal dissolved in dimethyl sulphoxide (DMSO) was added. The sample was mixed thoroughly and the bioluminescence measurement was performed in a Sirius single tube luminometer (Berthold, Pforzheim, Germany).

Photosynthetic oxygen evolution measurement Photosynthetic oxygen evolution was measured in vivo using a Clark-type oxygen electrode (Hansatech DW1, King’s Lynn, Norfolk, UK). Light was provided from a high-intensity white light source (Hansatech L2). Oxygen evolution of 2 mL exponential phase culture at an OD750 of 0.4 was measured at room temperature using the Hill reaction (Drath et al. 2008). The culture was illuminated with 100 μmol photons m−2 s−1 in the presence of an artificial electron acceptor system of 1 mmol L−1 2,5-dimethyl-p-benzoquinone and 1 mmol L−1 potassium ferricyanide.To measure the response of photosynthetic oxygen evolution of Synechocystis wild type and psbA1− mutant to high light and ammonium treatments, the oxygen evolution rate was determined at 110 μmol photons m−2 s−1 in the presence of 10 mmol L−1 KHCO3. The respiratory activity was determined by measuring O2 consumption in the dark.All the oxygen evolution rates in the context were the true oxygen evolution rates.

Measurements of PSII activity of isolated thylakoid membranes PSII activity of isolated thylakoid membranes treated with 200 mmol L−1 NH4Cl or KCl was determined by assessing the light-induced transport of electrons from H2O to DCIP (2,6-dichloroindophenol sodium salt hydrate) or from DPC (1,5-diphenylcarbazide) to DCIP. The reduction of DCIP was monitored spectrophotometrically by measuring the decrease in absorption at 580 nm (Ohnishi et al. 2005). At the © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

qRT-PCR analyses Fifty millilitres of cultures treated with different conditions were rapidly cooled with ice and harvested by centrifugation (4000 g, 10 min, 4 °C). RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and treated with RNasefree DNaseI (Fermentas). The cDNA synthesis was performed by using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s instructions, with 1 μg of total RNA. Transcript levels of psbA genes were quantified by qRT-PCR using the CFX96 Touch™ qRTPCR detection system (Bio-Rad). Amplifications were performed using SYBR Green Real-Time PCR Master Mix (Toyobo, Osaka, Japan) and gene-specific primers of three psbA genes were set as psbA1, forward primer 5′-CAGG AACAAAGCCTGTGGTC-3′ and reverse primer 5′-GATA ATAAAACAGGTGGTAGCGG-3′; psbA2, forward primer 5′-AGTCAGTTCCAATCTGAACATCG-3′ and reverse primer 5′-CCGAACCAACCGACATAAATC-3′; psbA3, forward primer 5′-GGCTCCCAAGCAAAGAAATC-3′ and 5′-ACTGTTCCCACAATGAAGCG-3′ reverse primer. One-step cycling was performed by amplification with an initial preheating step of 3 min at 95 °C, 40 cycles at 95 °C for 10 s and 58 °C for 30 s. The level of rnpB was used as a loading control (Drath et al. 2008; Schlebusch & Forchhammer 2010), and the rnpB gene-specific primers were set as forward primer 5′-AAAGGGTAAGGGT GCAAAGG-3′ and 5′-AATTCCTCAAGCGGTTCCAC-3′ reverse primer. The relative mRNA level (normalized to the level of rnpB) of each specific transcript was determined with the Bio-Rad software according to the Pfaffl method (Pfaffl

G-Z. Dai et al.

RESULTS Effects of ammonium on photodamage and repair of PSII in Synechocystis wild-type cells

120

−NH4+ − CMP −NH4+ + CMP +NH4+ − CMP +NH4+ + CMP

(a)

100 80 60 40 20

−NH4+ − CMP −NH4+ + CMP +NH4+ − CMP +NH4+ + CMP

(b)

100 80 60 40 20 0

0 0

30

60

90

Time (min)

In a first study of ammonium toxicity in Synechocystis, ammonium-induced photodamage was investigated in a FtsH2 mutant strain that is impaired in PSII repair cycle (Drath et al. 2008). Since this strain is highly ammonium sensitive, the experiments were carried out at low (5 mmol L−1) ammonium concentrations, which are not toxic to the wildtype strain that was used as a control. The present study aimed to investigate the basis of ammonium tolerance in Synechocystis wild-type cells. In a first series of experiments, the effect of 40 mmol L−1 ammonium on PSII activity was studied at increasing light intensities with and without inhibiting PSII repair by CMP. Cells that were cultivated at a photon flux density of 40 μmol photons m−2 s−1 with ambient CO2 were removed to glass test tubes and treated as described in materials and methods. As shown in Supporting Information Fig. S1, 40 mM NH4Cl at pH 8.8 accelerated the light-dependent decrease of PSII activity by approximately twofold (as determined by PAM fluorometry). For example, exposure for 60 min with 100 μmol photons m−2 s−1 in the absence of CMP decreased the values of Fv/Fm by 31% without NH4Cl and by 66% with NH4Cl treatment. In the presence of CMP, the corresponding values, which indicate the extent of pure photodamage, were 43% in the absence of NH4Cl or 86% in presence of NH4Cl. The pure damage by 100 μmol photons m−2 s−1 in the presence of NH4Cl was similar to pure photodamage by 200 μmol photons m−2 s−1 in the absence of NH4Cl (84% damage). The results confirmed that ammonium accelerates photodamage of PSII also in wild-type Synechocystis cells. For the following experiments, a photon flux density of 100 μmol photons m−2 s−1 was chosen as treatment condition. Next, the time course of photoinhibition and pure photodamage at 100 μmol photons m−2 s−1 in the absence or presence of 40 mmol L−1 NH4Cl at pH 8.8 was investigated. PSII activity was either estimated by measuring Fv/Fm with PAM fluorometer (Fig. 1a) or by measuring PSII-dependent oxygen evolution with 2,5-dimethyl-p-benzoquinone and potassium ferricyanide artificial electron acceptors (Fig. 1b). In the absence of NH4Cl, the values of Fv/Fm decreased only slightly in the absence of CMP and decreased constantly over time in the presence of CMP, reaching a value below 5% after 150 min. By contrast, in the presence of 40 mmol L−1 NH4Cl, the values of Fv/Fm dropped down to about 50% after 30 min, but subsequently decreased only slowly. In the presence of CMP, the initial rapid decrease continued to zero level

120

Relative oxygen evolution (%)

2001). The transcript level of sample without ammonium treatment under 20 μmol photons m−2 s−1 was set to 100%. For the correct calculation of transcript abundance, the PCR efficiency was determined by dilution series with genomic DNA. To determine melting temperatures for the amplification products of the specific primers, the temperature was raised after qRT-PCR from 65 to 95 °C, and fluorescence was detected continuously.

Relative Fv/Fm (%)

844

120 150

0

30

60

90

120 150

Time (min)

Figure 1. Effect of ammonium on photosystem II (PSII) damage and repair in wild-type Synechocystis. Cultures of Synechocystis were incubated in the absence or presence of 40 mmol L−1 NH4Cl and 30 μg mL−1 chloramphenicol (CMP) under 100 μmol photons m−2 s−1. Samples were removed at the indicated time points for determination of PSII activity by determining two parameters. (a) Measurements of Fv/Fm values by PAM chlorophyll fluorometer as described in ‘Materials and Methods’. (b) Measurements of oxygen evolution rates (H2O→2,5-dimethylp-benzoquinone) under 100 μmol photons m−2 s−1. White and black circle symbols represent treatments without and with 30 μg mL−1 CMP, in the absence of NH4Cl, respectively. White and black triangle symbols represent treatments without and with 30 μg mL−1 CMP, in the presence of 40 mmol L−1 NH4Cl, respectively. The 100% values corresponded to the values at time zero. The values represent the mean of three independent experiments, with error bars showing the standard deviation.

after 90 min (Fig. 1a). A qualitatively similar result was obtained by oxygen evolution measurement: in the absence of 40 mmol L−1 NH4Cl, oxygen evolution rates decreased without CMP and decreased moderately in the presence of CMP. In the presence of 40 mmol L−1 NH4Cl, a rapid initial decrease of oxygen evolution to approximately 40% was followed by a slow decrease. In the presence of CMP, oxygen evolution decreased steadily (Fig. 1b). The difference between the absence and presence of CMP represents the contribution of PSII repair. The difference value (delta) between CMP-free and CMP-treated sample can thus be used to estimate of the rate of PSII repair in the presence or absence of ammonium. After 60 min exposure to 100 μmol photons m−2 s−1,the Fv/Fm measurement yielded a similar delta of 35 or 33% for ammonium-free and ammonium-treated sample, respectively (Fig. 1a); determination of oxygen evolution yielded a delta of 12% for ammonium-free and ammonium-treated sample (Fig. 1b). These results indicated that the rate of PSII repair is independent of the presence of ammonium, whereas ammonium clearly accelerated photodamage of PSII. In principle, both, determination of Fv/Fm and of oxygen evolution showed the same trend. However, the Fv/Fm parameter is more sensitive to ammonium stress than oxygen evolution measurement. To investigate, whether the difference between Fv/Fm and of oxygen evolution determination was due to non-photochemical fluorescence quenching (NPQ), the NPQ parameter was investigated upon ammonium treatment. As shown in Supporting © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

Ammonium tolerance in Synechocystis

120 (a)

120 (b)

100

100

Relative Fv/Fm (%)

+CMP, light intensity (µmol photons m−2 s−1)

High light + CMP Low light − CMP, −NH4+

80

80

60

60

40

40

20 0 0

−NH4+ (dark)

+NH4+ (dark)

−NH4+ (5)

+NH4+ (5)

−NH4+ (10)

+NH4+ (10)

−NH4+ (20)

+NH4+ (20)

50

100 150 200 250

Time (min)

20

−NH4+ +NH4+

0 0 60 120 180 240 300 360 420

Time (min)

Figure 2. Effect of low light on photosystem II (PSII) photodamage in the presence or absence of ammonium, and the recovery of photodamaged PSII in wild-type Synechocystis under low light after ammonium-induced photodamage with 150 min exposure to high light. (a) Ammonium causes photodamage under low light intensities. Cultures of Synechocystis were incubated with or without 40 mmol L−1 NH4Cl, in the presence of 30 μg mL−1 chloramphenicol (CMP) under different photon fluence rates [5 (triangles), 10 (squares), 20 (diamonds) μmol photons m−2 s−1] or in darkness (circles). Aliquots were removed at the indicated time points for measuring Fv/Fm. White and black symbols represent treatments without and with 40 mmol L−1 NH4Cl, respectively. (b) Recovery of Synechocystis after ammonium-induced photodamage compared with photodamage in the absence of ammonium. At time 0, cultures were incubated with or without 40 mmol L−1 NH4Cl, in the presence of 30 μg mL−1 CMP and exposed to a photon fluence rate of 100 μmol photons m−2 s−1 for 150 min. During this treatment, the values of Fv/Fm decreased nearly to zero. Subsequently, the damaged cells were washed twice by centrifugation at 6000 g for 5 min and resuspended in fresh BG11 medium. Then, the cells were incubated under a photon fluence rate of 20 μmol photons m−2 s−1, and aliquots were removed at the indicated time points for measuring Fv/Fm. The 100% values corresponded to the values at time point zero. The values represent the mean of three independent experiments, with error bars showing the standard deviation.

Information Fig. S2, ammonium did not induce NPQ.Whether the quantitative difference between Fv/Fm and of oxygen evolution measurement is due to atypical chlorophyll quenching or variable oxygen evolution remains to be elucidated. Since variable fluorescence turned out to be a highly sensitive indicator of ammonium-induced damage, this method was used to study the photosensitizing effect of ammonium at low light intensities (Fig. 2a). In the presence of 30 μg mL−1 CMP and 40 mmol L−1 NH4Cl, the PSII parameter Fv/Fm decreased over time even at dim light (5 μmol photons m−2 s−1). Increasing the light intensity to 10 and 20 μmol photons m−2 s−1 further accelerated destruction of PSII in the presence of ammonium, whereas no damage occurred at these low light intensities in the absence of ammonium within a time span of 240 min. To study in more detail the recovery from photodamage that occurred in the absence or presence of 40 mmol L−1 NH4Cl, cells were first treated with 30 μg mL−1 CMP in the absence or presence of 40 mmol L−1 NH4Cl under 100 μmol photons m−2 s−1 exposure for 150 min, © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

845

until the Fv/Fm was nearly zero.Then, the cells were allowed to recover in the absence of CMP and ammonium. CMP is a very lipophilic, small, uncharged and non-polar molecule that can move freely through cell membranes (Stratton 2002) and inhibits bacterial protein synthesis. Since it binds weekly to ribosomes, it can be easily removed by washing the cells (Hurwitz & Braun 1967). Therefore, in order to investigate PSII recovery, damaged cells were washed twice (centrifuged at 6000 g for 5 min and resuspended in fresh BG11 medium) to completely remove CMP and ammonium. Finally, cells were allowed to recover at 20 μmol photons m−2 s−1 (Fig. 2b).Under these recovery conditions, no photodamage occurs (Fig. 2a). An identical recovery rate was observed, whether the cells were photodamaged in the absence or presence of ammonium, indicating that the damage in the presence of ammonium does not impair the capacity to subsequently repair PSII.

Ammonium treatment of isolated thylakoid membranes Whereas in vitro inhibition of PSII by ammonium is well established (Britt et al. 1989, 2004; Boussac et al. 1990), subsequent photodamage caused by ammonium has not been demonstrated so far with isolated thylakoid membranes. According to the purification protocol, the isolated thylakoid membranes have to be incubated in a buffer adjusted to pH 6.5, where the free ammonia (NH3) content is very low because of the pKs (9.2) of NH4+/NH3 equilibrium.Assuming free diffusion of NH3 through membranes, the free extracellular NH3 concentration should be equal to the cellular concentration. Since the damaging molecule is ammonia, the concentration of NH4Cl had to be increased for these experiments as far as possible to achieve reasonable NH3 concentrations. At a concentration of 200 mmol L−1 NH4Cl, which was used for this experiment, the free NH3 concentration at pH 6.5 is 0.4 mmol L−1, compared with a free NH3 concentration of 11.1 mmol L−1 in the in vivo treatment using 40 mmol L−1 NH4Cl at pH 8.8. PSII activity was assayed in isolated thylakoids by measuring PSII dependent DCIP reduction with either H2O as electron donor involving OEC activity or bypassing OEC by using the artificial electron donor DPC. In the presence of NH4Cl, OEC-dependent PSII activity (H2O→DCIP) of isolated thylakoid membranes decreased significantly more than in the control without ammonium addition or where NH4Cl was replaced by an equimolar concentration of KCl (Fig. 3a).To reveal the electron transport through PSII without the involvement of OEC, DPC was used as electron donor to PSII.As shown in Fig. 3b, after exposure to 100 μmol photons m−2 s−1, the samples treated with NH4Cl for 60 min had only approximately 30% less DPC→DCIP electron transport activity than the ammonium-free control samples, which is less reduction than when water was used as electron donor (more than 50% reduction).

Involvement of psbA genes in ammonium tolerance Repair of PSII from photodamage occurs by de novo synthesis of reaction centre D1 protein. In Synechocystis, D1

G-Z. Dai et al.

60 30 0

Relative PSII activity (%) (DPC DCIP)

0

30

60

(b)

90 Control 200 mmol L−1 NH4Cl

120 90 60 30 0 0

30

60

90

Time (min) Figure 3. Effect of ammonium on photosystem II (PSII) activity [estimated by light-dependent DCIP (2,6-dichloroindophenol sodium salt hydrate) reduction] of isolated thylakoid membranes from wild-type Synechocystis. Cells were grown in BG11 medium at 28 °C under continuous light of 40 μmol photons m−2 s−1 and thylakoid membranes were prepared as described in ‘Materials and Methods’. Isolated thylakoid membranes were treated with 200 mmol L−1 NH4Cl or 200 mmol L−1 KCl, under 100 μmol photons m−2 s−1 exposure at 20 °C. Samples without 200 mmol L−1 NH4Cl addition was used as the control. Samples were removed at the indicated time points, and the PSII activity was measured by the assessment of light-induced transport of electrons from H2O or DPC (1,5-diphenylcarbazide) to DCIP, as described in ‘Materials and Methods’. (a) PSII activity (from H2O to DCIP) of isolated thylakoid membranes treated with either 200 mmol L−1 NH4Cl or KCl, or without salt addition. The 100% activity determined in the absence of NH4Cl, in the presence of 200 mmol L−1 NH4Cl or 200 mmol L−1 KCl at the time point zero corresponds to a slope of (−1.76 ± 0.19), (−1.60 ± 0.08) and (−1.58 ± 0.07) OD580 mg Chl a−1 s−1, respectively. (b) Response of PSII activity (from DPC to DCIP) of isolated thylakoid membranes towards 200 mmol L−1 NH4Cl treatment in the presence of 100 μmol photons m−2 s−1. The 100% activity determined in the absence of NH4Cl and in the presence of 200 mmol L−1 NH4Cl at the time point zero corresponds to a slop of (−2.00 ± 0.27) and (−1.65 ± 0.10) OD580 mg Chl a−1 s−1, respectively. The values represent the mean of two to five independent experiments, with error bars showing the standard deviation.

protein is encoded by three psbA orthologs (psbA1, 2, 3). To reveal the role of three psbA genes in ammonium tolerance, three psbA orthologues were individually mutated by targeted mutagenesis and the sensitivities of the respective single psbA mutants towards ammonium were investigated subsequently. Wild-type Synechocystis and three single psbA mutants were grown in nitrate-supplemented medium at pH 8.0 at a photon fluence rate of 40 μmol photons m−2 s−1 and were treated with various concentrations of NH4Cl under 100 μmol photons m−2 s−1 for 20 min. Then, the Fv/Fm

(a) WT

(b) psbA1 −

0.4 0.3 0.2

EC 50 = 18.8 0.1 95% CI: 13.6–26.0

−4 −3 −2 −1

0.4 0.3

Fv/Fm

90

0.2

EC50 = 14.2 0.1 95% CI: 10.7–18.8

0

1

2

3

4

−4 −3 −2 −1

0

(c) psbA2 − 0.4

(d) psbA3 − 0.4

0.3

0.3

Fv/Fm

200 mmol L−1 KCl

parameter was determined as an indicator of PSII activity. The values were plotted against the ammonium concentration and fitted by non-linear regression to determine the EC50 value of ammonium. As shown in Fig. 4, all three psbA single mutants were more sensitive to ammonium than wild-type Synechocystis. The apparent EC50 value of wild-type cells, psbA1, psbA2 and psbA3 mutants were 18.8, 14.2, 9.3 and 9.8 mmol L−1, respectively. This result indicated that all psbA orthologues contribute to ammonium tolerance. The mutants of psbA2 and psbA3 showed higher sensitivity to ammonium toxicity than psbA1 mutant. Nevertheless, psbA1 mutant was significantly more sensitive than the wild type (Fig. 4). To corroborate these findings, survival and growth of Synechocystis wild type and the three psbA mutants after ammonium treatment was examined. The cells were treated for 48 h with various concentrations of NH4Cl at 100 μmol photons m−2 s−1. Subsequently, the cells were diluted 1:10 and 1:100 with fresh pH 8.0 BG11 medium, and 10 μL aliquots of undiluted and diluted samples were dropped on standard BG11 medium agarose plates. Cells were incubated under 30 μmol photons m−2 s−1 for 6 d, and the plates were photographed. As shown in Fig. 5, all three Synechocystis psbA mutants were more sensitive to ammonium than the wild type, which could grow well even after having been treated with 40 mmol L−1 ammonium. The result corroborated the above finding that all psbA genes contribute to ammonium tolerance of Synechocystis. To reveal whether the psbA orthologues differentially respond to ammonium treatment, expression of the three

Fv/Fm

Control 200 mmol L−1 NH4Cl

(a)

120

Fv/Fm

Relative PSII activity (%) (H2O DCIP)

846

0.2

0

2

3

4

1

2

3

4

0.2

EC 50 = 9.8 0.1 95% CI: 7.5–12.9

EC 50 = 9.3 0.1 95% CI: 7.5–11.6

−4 −3 −2 −1

1

1

2

lg[NH4Cl] (mmol L −1)

3

4

−4 −3 −2 −1

0

lg[NH4Cl] (mmol L−1)

Figure 4. Comparison of ammonium sensitivity among wild-type Synechocystis (a) and three psbA genes single deficient mutants (b–d). Wild-type Synechocystis and three psbA genes single deficient mutants were grown in the pH 8.0 BG11 medium maintained with 20 mM TAPS at a photon fluence rate of 40 μmol photons m−2 s−1 to an OD750 of 0.4, then were treated with various concentrations (0, 5, 10, 20, 40, 80, 200, 500 mmol L−1) of NH4Cl under 100 μmol photons m−2 s−1 for 20 min. The Fv/Fm was measured with PAM chlorophyll fluorometer as described in ‘Materials and Methods’. Each point represents the mean of seven independent experiments. © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

Ammonium tolerance in Synechocystis

0

10

20

30

40

50

0

10

WT

psbA1−

psbA2−

psbA3−

20

30

40

50

100 10−1 10−2

100 10−1 10−2

Figure 5. Survival and growth of Synechocystis wild type and three psbA genes single deficient mutants treated with different concentrations of ammonium under the photon fluence rate of 100 μmol photons m−2 s−1. Synechocystis cells were grown under 40 μmol photons m−2 s−1 until an OD750 of 0.4 in the pH 8.0 BG11 medium maintained with 20 mmol L−1 TAPS. Then, 5 mL cultures were removed into the glass tubes, and exposed to 100 μmol photons m−2 s−1 for 48 h in the presence of different concentrations of ammonium. After that, 1 mL aliquots were removed and diluted 10-fold and 100-fold with fresh pH 8.0 BG11 medium, and 10 μL of each sample was dropped on the standard BG11 agarose plates without kanamycin. After 6 d growth under 30 μmol photons m−2 s−1, pictures were taken.

psbA genes was analysed by qRT-PCR in cells that were treated with 1 or 5 mmol L−1 NH4Cl and 20 (LL) or 100 μmol photons m−2 s−1 (HL) for 1 h. As shown in Fig. 6, the three psbA genes did not respond to NH4Cl addition at low light (20 μmol photons m−2 s−1). By contrast, under high light exposure, the transcript level of psbA2 and psbA3 increased in an ammonium-dependent manner, with the psbA3 transcript responding most strongly to ammonium in a dose-dependent manner. This response is hence no nutritional effect, but a response to the combined high light-ammonium stress. The psbA1 gene was thought to be an apparently ‘silent’ gene (Jansson et al. 1987; Mohamed et al. 1993; Salih & Jansson 1997; Mulo et al. 2009), except under microaerobic condition (Summerfield et al. 2008, 2011; Sicora et al. 2009). It was therefore surprising that this gene might contribute to ammonium tolerance. To address this issue, the psbA1 gene was studied in more detail. A luxAB reporter gene was fused to the psbA1 promoter. The expression of psbA1 promoter was evaluated by the bioluminescence of the PpsbA1:luxAB fusion. As shown in Fig. 7a, the expression of psbA1 promoter was induced by higher light intensities, with an optimum at 100 μmol photons m−2 s−1, confirming that the observed slight induction of psbA1 detected by qRT-PCR was not an artefact. Furthermore, nitrogen deprivation condition could transiently induce the expression of psbA1 promoter at both 40 μmol photons m−2 s−1 and 100 μmol photons m−2 s−1 (Fig. 7b). By contrast, ammonium addition had obviously no specific effect on the expression of psbA1 promoter (Fig. 7c). © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

The sensitivity of the psbA1-deficient mutant towards ammonium was studied in more detail by exposing cells to 100 μmol photons m−2 s−1 for 60, 120 or 240 min in the presence or absence of 40 mmol L−1 ammonium. Subsequently, performance of PSII was estimated by determining the Fv/Fm parameter using PAM fluorometry. As shown in Fig. 8a, under conditions of ammonium photoinhibition for 60, 120 and 240 min, the Fv/Fm value of Synechocystis wild type decreased to 47, 33 and 27%, and that of the psbA1− mutant to 43, 25 and 16% of the respective initial value. The stronger decline in the Fv/Fm value indicated that the psbA1− mutant was more sensitive to high light and ammonium exposure than the wild type. These results were corroborated by measuring oxygen evolution (Fig. 8b). Under the same conditions of ammonium photoinhibition for 60, 120 and 240 min, the photosynthetic oxygen evolution rates of Synechocystis wild type decreased to 51, 44 and 38%, and that of the psbA1− mutant to 47, 38 and 31 of the respective initial value (Fig. 8b).Together, these data confirmed that the psbA1 gene, despite its low expression level, contributes to ammonium tolerance of Synechocystis.

DISCUSSION Environmental stress can enhance the extent of photoinhibition, a process that is determined by the balance between the rate of photodamage to PSII and the rate of its

Levels of transcripts of three psbA genes (normalized to rnpB gene)

+ NH4Cl (mmol L−1)

847

24

Low light, +NH4Cl

20

High light, +NH4Cl

psbA1 psbA2 psbA3

16 12 8 4 0 0

1

5

0

1

5

−1

NH4Cl concentration (mmol L )

Figure 6. Transcript levels of three psbA genes in Synechocystis wild-type cells in the absence or presence of 1 or 5 mmol L−1 NH4Cl, and exposed to 20 μmol photons m−2 s−1 or 100 μmol photons m−2 s−1. Synechocystis cells were grown at a photon fluence rate of 40 μmol photons m−2 s−1 to an OD750 of 0.4, and the pH was adjusted to 8.8. Then, 50 mL aliquots were removed into 100 mL Erlenmeyer flasks and exposed to a photon fluence rate of 20 μmol photons m−2 s−1 or 100 μmol photons m−2 s−1 for 1 h in the absence or presence of 1 or 5 mmol L−1 NH4Cl. After that, samples were harvested for RNA isolation, and the relative psbA mRNA level (normalized to the level of rnpB) of each specific transcript was determined with the Bio-Rad software according to the Pfaffl method. The level of rnpB was used as a loading control. The transcript level at 20 μmol photons m−2 s−1 without ammonium treatment was set to 100%. The values represent the mean of four or five independent experiments, with error bars showing the standard deviation.

5

1.6×10

(a)

Light intensity (µmol photons m−2 s−1)

5

1.2×10

4

4

4.0×10

Bioluminescence (RLUs)

5

0.5

1

2

−

0

−

40, −NO3

−

100, +NO3

5

1.2×10 8.0×10

4

4.0×10

0.0 0

1

2

3

4

NH4Cl (mmol L−1)

(c)

4

60 120 Time (min)

240

1500 (b)

WT, −NH4+ WT, +NH4+ psbA1−, −NH4+ psbA1−, +NH4+

1200

900

600

300

0 0

60 120 Time (min)

240

−

100, −NO3

4

8.0×10

0.1 0.0

40, +NO3

5

5

0.3

4

(b) Light intensity, +/− 17.6 mmol L −1 NO3−

1.6×10

1.2×10

psbA1−, +NH4+

0.2

0.0

2.0×10

WT, +NH4+

0.4

FV/Fm

8.0×10

WT, −NH4+ psbA1−, −NH4+

0.5

0

Bioluminescence (RLUs)

0.6 (a)

10 20 50 100 150

Oxygen evolution rate (µmol O2 mg Cha−1 h−1)

G-Z. Dai et al.

Bioluminescence (RLUs)

848

0 0.2 0.5 1 5

4

4.0×10

0.0 0

1

2

Time (h)

3

4

Figure 7. Time course of PpsbA1:luxAB expression in Synechocystis pVLux-psbA1 under different light intensities, nitrogen limitation and ammonium treatment conditions. Synechocystis cultures were grown with a photon fluence rate of 40 μmol photons m−2 s−1 until an OD750 of 0.4, then the pH of the medium was adjusted to 8.8 and aliquots of the culture were used for different treatments. (a) Samples were exposed to different light intensities (10, 20, 50, 100 or 150 μmol photons m−2 s−1). At the indicated time points, 0.5 mL samples from the different treatments were taken for measuring bioluminescence of luxAB. (b) Samples were exposed at a photon fluence rate of 40 or 100 μmol photons m−2 s−1 in BG11 medium with or without NaNO3. The 100 mL culture was harvested by centrifugation (4000 g, 10 min, 28 °C), and resuspended twice with fresh BG11 medium (pH 8.8) with or without NO3-. Then 15 mL cultures were removed into 50 mL Erlenmeyer flasks and exposed to 40 or 100 μmol photons m−2 s−1 and shaken at 100 r.p.m. At the indicated time points, 0.5 mL culture samples of different treatments were removed for measuring bioluminescence of luxAB. (c) Samples were exposed to 100 μmol photons m−2 s−1 in the presence of different concentrations of ammonium (0, 0.1, 0.2, 0.5, 1, 5 mmol L−1). Culture aliquots of 5 mL were removed into glass tubes and used for the ammonium treatment. At the indicated time points, 0.5 mL samples of different treatments were taken for measuring bioluminescence of luxAB. The values represent the mean of three independent experiments, with error bars showing the standard deviation.

Figure 8. Responses of Fv/Fm and photosynthetic oxygen evolution to 100 μmol photons m−2 s−1 in the absence or presence of ammonium in Synechocystis wild type and psbA1− mutant. Synechocystis cells were grown with a photon fluence rate of 40 μmol photons m−2 s−1 until an OD750 of 0.4, and then the pH of the medium was adjusted to 8.8. The 10 mL aliquots were removed into the glass tubes and exposed to 100 μmol photons m−2 s−1 in the absence or presence of 40 mmol L−1 NH4Cl. (a) The time course of Fv/Fm in Synechocystis wild type and psbA1− mutant. At the indicated time points, 100 μL samples were removed and diluted in 2 mL of BG11 medium. All samples were dark-adapted for 5 min before the measurement. (b) The time course of photosynthetic oxygen evolution in Synechocystis wild type and psbA1− mutant. At the indicated time points, the photosynthetic oxygen evolution rate was determined at a photon fluence rate of 110 μmol photons m−2 s−1 in the presence of 10 mmol L−1 KHCO3. The values represent the mean of three independent experiments, with error bars showing the standard deviation.

repair (Takahashi & Murata 2008). Previous studies suggested that some environmental stresses, such as salt (Allakhverdiev et al. 2002), low temperature (Gombos et al. 1994; Wada et al. 1994), moderate heat (Takahashi et al. 2004) and oxidative stress (Nishiyama 2005) do not affect photodamage but inhibit the repair of PSII through suppression of the de novo synthesis of D1 protein. Ammonium was recently shown to accelerate the rate of photodamage of PSII (Dai et al. 2008; Drath et al. 2008). The first molecular study of Synechocystis was performed with a highly ammoniumsensitive mutant, deficient in the FtsH2 protease, which plays a key role in PSII repair cycle (Drath et al. 2008). The molecular basis of the relatively high ammonium tolerance of wild-type cells and the role of repair from photodamage in ammonium toxicity of wild-type cells was not addressed in this study. The present study showed that the rate of PSII repair that occurred at 100 μmol photons m−2 s−1 in the presence and absence of 40 mmol L−1 NH4Cl was almost identical (Fig. 1).The fact that cells, which were photoinhibited by high light in the absence or presence of ammonium displayed the same recovery rate of PSII, indicated that ammonium did not injure a component required for the repair of photodamage. Therefore, the decrease of PSII activity in Synechocystis induced by ammonium was specific to the process of photodamage, which is an important difference to the stimulation of photoinhibition by other environment stresses. © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

Ammonium tolerance in Synechocystis In the absence of PSII repair (CMP treatment), ammonium induced photodamage even at dim light. Our previous investigations on whole cells suggested that the OEC was the site of ammonium damage in cyanobacteria (Dai et al. 2008; Drath et al. 2008). The fact that ammonium is an inhibitor of PSII is known since long (Britt et al. 1989, 2004; Boussac et al. 1990) and recent studies clearly showed that ammonia binds to the core structure of the Mn cluster of the OEC (Hou et al. 2011;Tsuno et al. 2011).However,the issue of ammonium-induced photodamage and ammonium toxicity was not addressed in these studies. Therefore, it remained to be proven that ammonium-induced photoinhibition of PSII is indeed initiated by the reaction of ammonium with the OEC. The present experiments clearly demonstrate that PSII in isolated thylakoids is damaged by ammonium in the presence of light.The reason that 200 mmol L−1 NH4Cl had to be used to achieve ammonium damage is due to the fact that the harmful molecule is NH3 rather than NH4+. At pH 6.5, the free NH3 concentration at 200 mmol L−1 NH4Cl is only 0.4 mmol L−1, but this was sufficient to have a detectable effect. It has to be emphasized that the real free NH3 concentration in living cells is not safely predictable because of uncertain assumptions, such as assuming unlimited membrane permeability of NH3. Measurement of free NH3 in cells is not feasible, neither. Therefore,a quantitative comparison of the in vivo and in vitro data is not possible, but qualitatively, the data match. When the PSII activity was measured bypassing the OEC (DPC→DCIP), the damage to PSII activity by ammonium was lower than testing the OEC-dependent PSII reaction (H2O→DCIP).This indicates that part of the PSII centres are still intact but have lost the OEC function. From this, it can be concluded that ammonium damaged the OEC of isolated Synechocystis thylakoid membranes in a first step, without immediately damaging the entire PSII complex. This is in perfect agreement with the studies of Tsuno et al. (2011) and Hou et al. (2011) showing that ammonium binds to the Mn-cluster of the OEC. According to the data shown here, ammonium-triggered photoinhibition follows the donor-site mechanism, where the initial photodamage occurs at the donor site of PSII, the OEC. After photodamage of PSII, damaged D1 protein replaced in the PSII repair cycle by newly synthesized D1 protein (Aro et al. 1993; Nixon et al. 2005; Takahashi & Badger 2011). Expression of two different forms of D1, encoded by psbA multigene families, is a unique cyanobacterial characteristic (Kulkarni & Golden 1994). Previous investigations revealed different numbers of psbA genes in various cyanobacterial species (Mohamed & Jansson 1989; Vrba & Curtis 1989; Bouyoub et al. 1993; Kulkarni & Golden 1994; Sicora et al. 2006). In Synechocystis PCC 6803, the D1 protein is encoded by three genes, psbA1, psbA2 and psbA3 (Jansson et al. 1987). However, only one form of the D1 polypeptide, encoded by psbA2 and psbA3 was revealed so far. The expression of both psbA2 and psbA3 is under light control (Mohamed & Jansson 1989). The third psbA gene, psbA1, encodes a slightly different D1 protein, but which is barely expressed in wild-type cells (Jansson et al. 1987; Salih & Jansson 1997), except under microaerobic conditions © 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

849

(Summerfield et al. 2008, 2011; Sicora et al. 2009). In the present study, Synechocystis cells were cultured in BG11 medium without removing the dissolved oxygen, thus the concentration of oxygen dissolved in the medium would be nearly saturated, which is far from microaerobic conditions. Nevertheless, transiently induced expression of psbA1 could be revealed at various stress conditions, such as high light and nitrogen deprivation. This result suggests that psbA1 gene expression is involved in transient stress acclimation by rendering Synechocystis cells more resistant to photoinhibition, which is in agreement with the increased sensitivity of the psbA1-deficient mutant: Synechocystis wild type was more resistant towards ammonium under 100 μmol photons m−2 s−1 than the psbA1− mutant (Fig. 8), proving that the psbA1 gene is not redundant but helps to cope with photodamage. The ability to resist elevated ammonium concentration in wild-type Synechocystis seems to depend on all three psbA genes, although the amount of psbA2 and psbA3 mRNA constituted almost the total of psbA mRNA. From the sensitivity of PSII activity (measured by Fv/Fm parameter) in single psbA-deficient mutants upon ammonium treatment, the ability to resist to ammonium appears as follows: wild-type Synechocystis > psbA1-deficient mutant > psbA3deficient mutant ≈ psbA2-deficient mutant (Fig. 4). The higher sensitivity of the psbA2-deficient mutant is in agreement with the higher abundance of psbA2 transcripts. In conclusion, this study demonstrated that ammonium induced the photodamage of PSII in Synechocystis, rather than the repair of damaged PSII. The OEC was the site of ammonium-induced photodamage not only in vivo, but also in isolated thylakoid membranes. In addition to psbA2 and psbA3 genes, psbA1 expression in Synechocystis plays also a role in ammonium tolerance by rendering PSII repair more efficient or PSII more stress resistant. Further studies should elucidate whether the psbA1 product has other beneficial properties for Synechocystis, such as aiding in nitrogen starvation acclimation. The high sensitivity of some cyanobacterial species to ammonium toxicity might be related to the lack of certain psbA orthologues.

ACKNOWLEDGMENTS The authors are grateful to Iris Maldener for helpful suggestions and to Maximilian Schlebusch, Su Jiyong and Ismael Rodea-Palomares for providing technical helps. This work was supported by the DFG Research Training Group GRK 1708/1, National Basic Research Program (No. 2008CB418004) and a fellowship of the China Scholarship Council.

REFERENCES Allakhverdiev S.I., Nishiyama Y., Miyairi S., Yamamoto H., Inagaki N., Kanesaki Y. & Murata N. (2002) Salt stress inhibits the repair of photodamaged photosystem II by suppressing the transcription and translation of psbA genes in Synechocystis. Plant Physiology 130, 1443–1453. Aro E.M., Virgin I. & Andersson B. (1993) Photoinhibition of photosystem II. Inactivation, protein damage and turnover. Biochimica et Biophysica Acta 1143, 113–134.

850

G-Z. Dai et al.

Aro E.M., Suorsa M., Rokka A., Allahverdiyeva Y., Paakkarinen V., Saleem A., . . . Rintamäki E. (2005) Dynamics of photosystem II: a proteomic approach to thylakoid protein complexes. Journal of Experimental Botany 56, 347–356. Barbato R., Frizzo A., Friso G., Rigoni F. & Giacometti G.M. (1995) Degradation of the D1 protein of photosystem-I1 reaction centre by ultraviolet-B radiation requires the presence of functional manganese on the donor side. European Journal of Biochemistry 227, 723–729. Bloom A.J., Sukrapanna S.S. & Warner R.L. (1992) Root respiration associated with ammonium and nitrate absorption and assimilation by barley. Plant Physiology 99, 1294–1301. Boussac A., Rutherford A.W. & Styring S. (1990) Interaction of ammonia with the water splitting enzyme of photosystem II. Biochemistry 29, 24–32. Bouyoub A., Vernotte C. & Astier C. (1993) Functional analysis of the two homologous psbA gene copies in Synechocystis PCC 6714 and PCC 6803. Plant Molecular Biology 21, 249–258. Britt R.D., Zimmermann J.L., Sauer K. & Klein M.P. (1989) Ammonia binds to the catalytic Mn of the oxygen-evolving complex of photosystem II: evidence by electron spin-echo envelope modulation spectroscopy. Journal of the American Chemical Society 111, 3522–3532. Britt R.D., Campbella K.A., Peloquin J.M., Gilchrist M.L., Aznara C.P., Dicus M.M., . . . Messinger J. (2004) Recent pulsed EPR studies of the Photosystem II oxygen-evolving complex: implications as to water oxidation mechanisms. Biochimica et Biophysica Acta 1655, 158–171. Britto D.T. & Kronzucker H.J. (2002) NH4+ toxicity in higher plants: a critical review. Journal of Plant Physiology 159, 567–584. Britto D.T., Siddiqi M.Y., Glass A.D.M. & Kronzucker H.J. (2001) Futile transmembrane NH4+ cycling: a cellular hypothesis to explain ammonium toxicity in plants. Proceedings of the National Academy of Sciences of the United States of America 98, 4255–4258. Dai G.Z., Deblois C.P., Liu S.W., Juneau P. & Qiu B.S. (2008) Differential sensitivity of five cyanobacterial strains to ammonium toxicity and its inhibitory mechanism on the photosynthesis of rice-field cyanobacterium Ge-Xian-Mi (Nostoc). Aquatic Toxicology 89, 113–121. Dai G.Z., Shang J.L. & Qiu B.S. (2012) Ammonia may play an important role in the succession of cyanobacterial blooms and the distribution of common algal species in shallow freshwater lakes. Global Change Biology 18, 1571– 1581. Diner B.A. (2001) Amino acid residues involved in the coordination and assembly of the manganese cluster of photosystem II. Proton-coupled electron transport of the redox-active tyrosines and its relationship to water oxidation. Biochimica et Biophysica Acta 1503, 147–163. Drath M., Kloft N., Batschauer A., Marin K., Novak J. & Forchhammer K. (2008) Ammonia triggers photodamage of photosystem II in the cyanobacterium Synechocystis sp. strain PCC 6803. Plant Physiology 147, 206–215. Elhai J. & Wolk C.P. (1988) Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology 167, 747–754. Ferreira K.N., Iverson T.M., Maghlaoui K., Barber J. & Iwata S. (2004) Architecture of the photosynthetic oxygen-evolving center. Science 303, 1831–1838. Genty B., Briantais J.M. & Baker N.R. (1989) The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochimica et Biophysica Acta 990, 87–92. Gombos Z., Wada H. & Murata N. (1994) The recovery of photosynthesis from low-temperature photoinhibition is accelerated by the unsaturation of membrane lipids: a mechanism of chilling tolerance. Proceedings of the National Academy of Sciences of the United States of America 91, 8787–8791. Hakala M., Tuominen I., Keränen M., Tyystjärvi T. & Tyystjärvi E. (2005) Evidence for the role of the oxygen-evolving manganese complex in photoinhibition of photosystem II. Biochimica et Biophysica Acta 1706, 68–80. Hou L.H., Wu C.M., Huang H.H. & Chu H.A. (2011) Effects of ammonia on the structure of the oxygen-evolving complex in Photosystem II as revealed by light-induced FTIR difference spectroscopy. Biochemistry 50, 9248–9254. Hurwitz C. & Braun C.B. (1967) Measurement of binding of chloramphenicol by intact cells. Journal of Bacteriology 93, 1671–1676. Jansson C., Debus R.J., Osiewacz H.D., Gurevitz M. & McIntosh L. (1987) Construction of an obligate photoheterotrophic mutant of the cyanobacterium Synechocystis 6803. Plant Physioloy 85, 1021–1025. Kashino Y., Lauber W.M., Carroll J.A., Wang Q.J., Whitmarsh J., Satoh K. & Pakrasi H.B. (2002) Proteomic analysis of a highly active photosystem II preparation from the cyanobacterium Synechocystis sp. PCC 6803 reveals the presence of novel polypeptides. Biochemistry 41, 8004–8012.

Komenda J., Sobotka R. & Nixon P.J. (2012) Assembling and maintaining the photosystem II complex in chloroplasts and cyanobacteria. Current Opinion in Plant Biology 15, 245–251. Kós P.B., Deák Z., Cheregi O. & Vass I. (2008) Differential regulation of psbA and psbD gene expression, and the role of the different D1 protein copies in the cyanobacterium Thermosynechococcus elongatus BP-1. Biochimica et Biophysica Acta 1777, 74–83. Krieger-Liszkay A., Fufezan C. & Trebst A. (2008) Singlet oxygen production in photosystem II and related protection mechanism. Photosynthesis Research 98, 551–564. Kulkarni R.D. & Golden S.S. (1994) Adaptation to high light intensity in Synechococcus sp. strain PCC 7942: regulation of three psbA genes and two forms of the D1 protein. Journal of Bacteriology 176, 959–965. Li G., Dong G., Li B., Li Q., Kronzucker H.J. & Shi W. (2012) Isolation and characterization of a novel ammonium overly sensitive mutant, amos2, in Arabidopsis thaliana. Planta 235, 239–252. Mackinney G. (1941) Absorption of light by chlorophyll solution. Journal of Biological Chemistry 140, 315–322. Mohamed A. & Jansson C. (1989) Influence of light on accumulation of photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803. Plant Molecular Biology 13, 693–700. Mohamed A., Eriksson J., Osiewacz H.D. & Jansson C. (1993) Differential expression of the psbA genes in the cyanobacterium Synechocystis 6803. Molecular and General Genetics 238, 161–168. Müller T., Walter B., Wirtz A. & Burkovski A. (2006) Ammonium toxicity in bacteria. Current Microbiology 52, 400–406. Mulo P., Sicora C. & Aro E.M. (2009) Cyanobacterial psbA gene family: optimization of oxygenic photosynthesis. Cellular and Molecular Life Science 66, 3697–3710. Muñoz-Martín M.A., Mateo P., Leganés F. & Fernández-Piñas F. (2011) Novel cyanobacterial bioreporters of phosphorus bioavailability based on alkaline phosphatase and phosphate transporter genes of Anabaena sp. PCC 7120. Analytical and Bioanalytical Chemistry 400, 3573–3584. Murata N., Takahashi S., Nishiyama Y. & Allakhverdiev S.I. (2007) Photoinhibition of photosystem II under environmental stress. Biochimica et Biophysica Acta 1767, 414–421. Nishiyama Y., Allakhverdiev S.I. & Murata N. (2005) Inhibition of the repair of photosystem II by oxidative stress in cyanobacteria. Photosynthesis Research 84, 1–7. Nixon P.J., Barker M., Boehm M., de Vries R. & Komenda J. (2005) FtsH mediated repair of the photosystem II complex in response to light stress. Journal of Experimental Botany 56, 357–363. Ohnishi N., Allakhverdiev S.I., Takahashi S., Higashi S., Watanabe M., Nishiyama Y. & Murata N. (2005) Two-step mechanism of photodamage to photosystem II: step 1 occurs at the oxygen-evolving complex and step 2 occurs at the photochemical reaction center. Biochemistry 44, 8494– 8499. Pfaffl M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29, 2002–2007. Polander B.C. & Barry B.A. (2012) A hydrogen-bonding network plays a catalytic role in photosynthetic oxygen evolution. Proceedings of the National Academy of Sciences of the United States of America 109, 6112–6117. Rippka R. (1988) Isolation and purification of cyanobacteria. Methods in Enzymology 167, 3–27. Salih G.F. & Jansson C. (1997) Activation of the silent psbA1 gene in the cyanobacterium Synechocystis sp strain 6803 produces a novel and functional D1 protein. The Plant Cell 9, 869–878. Schlebusch M. & Forchhammer K. (2010) Requirement of the nitrogen starvation-induced protein Sll0783 for polyhydroxybutyrate accumulation in Synechocystis sp. strain PCC 6803. Applied and Environmental Microbiology 76, 6101–6107. Schreiber U., Endo T., Mi H. & Asada K. (1995) Quenching analysis of chlorophyll fluorescence by the saturation pulse method: particular aspects relating to the study of eukaryotic algae and cyanobacteria. Plant & Cell Physiology 36, 873–882. Setlik I., Allakhverdiev S.I., Nedbal L., Setlikova E. & Klimov V.V. (1990) Three types of photosystem II photoinactivation. I. damaging processes on the acceptor side. Photosynthesis Research 23, 39–48. Sicora C.I., Máté Z. & Vass I. (2003) The interaction of visible and UV-B light during photodamage and repair of photosystem II. Photosynthesis Research 75, 127–137. Sicora C.I., Appleton S.E., Brown C.M., Chung J., Chandler J., Cockshutt A.M., . . . Campbell D.A. (2006) Cyanobacterial psbA families in Anabaena and

© 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

Ammonium tolerance in Synechocystis Synechocystis encode trace, constitutive and UVB-induced D1 isoforms. Biochimica et Biophysica Acta 1757, 47–56. Sicora C.I., Ho F.M., Salminen T., Styring S. & Aro E.M. (2009) Transcription of a ‘silent’ cyanobacterial psbA gene is induced by microaerobic conditions. Biochimica et Biophysica Acta 1787, 105–112. Stratton C.W. (2002) Chloramphenicol. Antimicrobics and Infectious Diseases Newsletter 18, 89–91. Summerfield T.C., Toepel J. & Sherman L.A. (2008) Low-oxygen induction of normally cryptic psbA genes in cyanobacteria. Biochemistry 47, 12939– 12941. Summerfield T.C., Nagarajan S. & Sherman L.A. (2011) Gene expression under low-oxygen conditions in the cyanobacterium Synechocystis sp. PCC 6803 demonstrates Hik31-dependent and -independent responses. Microbiology 157, 301–312. Takahashi S. & Badger M.R. (2011) Photoprotection in plants: a new light on photosystem II damage. Trends in Plant Science 16, 53–60. Takahashi S. & Murata N. (2008) How do environmental stresses accelerate photoinhibition? Trends in Plant Science 13, 178–182. Takahashi S., Nakamura T., Sakamizu M., Woesik R. & Yamasaki H. (2004) Repair machinery of symbiotic photosynthesis as the primary target of heat stress for reef-building corals. Plant & Cell Physiology 45, 251–255. Tsuno M., Suzuki H., Kondo T., Mino H. & Noguchi T. (2011) Interaction and inhibitory effect of ammonium cation in the oxygen evolving center of photosystem II. Biochemistry 50, 2506–2514. Tyystjärvi E. (2008) Photoinhibition of photosystem II and photodamage of the oxygen evolving manganese cluster. Coordination Chemistry Reviews 252, 361–376. Umena Y., Kawakami K., Shen J.R. & Kamiya N. (2011) Crystal structure of oxygen-evolving photosystem II at a resolution of 1.9 Å. Nature 473, 55–61. Vass I. (2011) Role of charge recombination processes in photodamage and photoprotection of the photosystem II complex. Physiologia Plantarum 142, 6–16. Vass I. (2012) Molecular mechanisms of photodamage in the photosystem II complex. Biochimica et Biophysica Acta 1817, 209–217. Vass I. & Cser K. (2009) Janus-faced charge recombinations in photosystem II photoinhibition. Trends in Plant Science 14, 200–205. Vass I., Styring S., Hundal T., Koivuniemi A., Aro E.M. & Andersson B. (1992) Reversible and irreversible intermediates during photoinhibition of photosystem II: stable reduced QA species promote chlorophyll triplet formation. Proceedings of the National Academy of Sciences of the United States of America 89, 1408–1412. Von Wirén N., Gazzarrini S., Gojon A. & Frommer W.B. (2000) The molecular physiology of ammonium uptake and retrieval. Current Opinion in Plant Biology 3, 254–261. Vrba J.M. & Curtis S.E. (1989) Characterization of a four-member psbA gene family from the cyanobacterium Anabaena PCC 7120. Plant Molecular Biology 14, 81–92. Wada H., Gombos Z. & Murata N. (1994) Contribution of membrane lipids to the ability of the photosynthetic machinery to tolerate temperature stress. Proceedings of the National Academy of Sciences of the United States of America 91, 4273–4277. Williams J.G.K. (1988) Construction of specific mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803. Methods in Enzymology 167, 766–778. Zinchenko V.V., Piven I.V., Melnik V.A. & Shestakov S.V. (1999) Vectors for the complementation analysis of cyanobacterial mutants. Russian Journal of Genetics 35, 228–232.

Received 10 March 2013; received in revised form 10 September 2013; accepted for publication 12 September 2013

© 2013 John Wiley & Sons Ltd, Plant, Cell and Environment, 37, 840–851

851

SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Figure S1. Effects of ammonium and chloramphenicol (CMP) on relative quantum yield as a parameter of PSII activity in wild-type Synechocystis exposed for 30 or 60 min under different light intensities. Cultures of Synechocystis were grown in BG11 medium illuminated with 40 μmol photons m−2 s−1 of white fluorescent light to an OD750 of 0.4, then the pH value of the culture was adjusted to 8.8, and incubated in the absence or presence of 40 mmol L−1 NH4Cl and 30 μg mL−1 CMP under different light intensities (5, 10, 20, 40, 100, 150 and 200 μmol photons m−2 s−1) for 30 and 60 min. Samples were removed for determination of Fv/Fm values with WATER-PAM chlorophyll fluorometer as described in ‘materials and methods’. A. Cells were treated with or without 30 μg mL−1 CMP for 30 and 60 min in the absence of NH4Cl. B. Cells were treated with or without 30 μg mL−1 CMP for 30 and 60 minutes in the presence of 40 mmol L−1 NH4Cl. White and black circle symbols represent treatments in the absence or presence of CMP for 30 min, respectively. White and black triangle symbols represent treatments in the absence or presence of CMP for 60 min, respectively. The 100% values corresponded to the values of samples exposed to 5 μmol photons m−2 s−1 for 30 min, in the absence of both NH4Cl and CMP. The values represent the mean of three independent experiments, with error bars showing the SD. Figure S2. Effects of ammonium on non-photochemical quenching (NPQ) in wild-type Synechocystis. Cultures of Synechocystis were grown in BG11 medium illuminated with 40 μmol photons m−2 s−1 of white fluorescent light to an OD750 of 0.4, then the pH value of the culture was adjusted to 8.8, and incubated in the absence or presence of 40 mmol L−1 NH4Cl under 100 μmol photons m−2 s−1. Samples were removed at the indicated time points for determination of NPQ by WATER-PAM chlorophyll fluorometer. The actinic light intensity and each pulse interval were 108 μmol photons m−2 s−1 and 30 seconds, respectively. Samples were darkadapted for 5 min before measurements, and the estimation of Fm was done by adding 10 μmol L−1 DCMU at the end of measurements. The quantification of NPQ was as follows: NPQ = (Fm-Fm′)/Fm′. The values represent the mean of three independent experiments, with error bars showing the SD.