JIPB
Journal of Integrative Plant Biology
An auxin‐responsive endogenous peptide regulates root development in Arabidopsis Fengxi Yang1,4†, Yu Song2,3†, Hao Yang1, Zhibin Liu1, Genfa Zhu4 and Yi Yang1* 1
Abstract Auxin plays critical roles in root formation and development. The components involved in this process, however, are not well understood. Here, we newly identified a peptide encoding gene, auxin‐responsive endogenous polypeptide 1 (AREP1), which is induced by auxin, and mediates root development in Arabidopsis. Expression of AREP1 was specific to the cotyledon and to root and shoot meristem tissues. Amounts of AREP1 transcripts and AREP1‐green fluorescent protein fusion proteins were elevated in response to indoleacetic acid treatment. Suppression of AREP1 through RNAi silencing resulted in reduction of primary root length, increase of lateral root number, and expansion of adventitious roots, compared to the observations in wild‐type plants in the presence of auxin. By contrast, transgenic plants overexpressing AREP1 showed enhanced growth of the primary root under auxin treatment. Additionally, root morphology, including lateral root number and
adventitious roots, differed greatly between transgenic and wild‐ type plants. Further analysis indicated that the expression of auxin‐responsive genes, such as IAA3, IAA7, IAA17, GH3.2, GH3.3, and SAUR‐AC1, was significantly higher in AREP1 RNAi plants, and was slightly lower in AREP1 overexpressing plants than in wild‐ type plants. These results suggest that the novel endogenous peptide AREP1 plays an important role in the process of auxin‐ mediated root development.
INTRODUCTION
Recently, several studies have demonstrated the roles of polypeptide signals in auxin‐induced cell proliferation (Teale et al. 2006; Katsir et al. 2011) and cell differentiation (Teale et al. 2006; Katsir et al. 2011). For example, phytosulfokine, an endogenous sulfated pentapeptide, stimulates zinnia tracheary element differentiation and controls cell elongation in roots of Arabidopsis (Matsubayashi and Sakagami 1996). Polypeptides cassava latent virus (CLV)3, tracheary element differentiation inhibitory factor (TDIF), CLE1‐27, and CLE40 induce the termination of shoot and root meristem activity (Whitford et al. 2008; Gao and Guo 2012). The cystein‐rich epidermal patterning factor (EPF) family members, EPF1, EPF2, STOMAGEN, and EPFL9, have been characterized with respect to the stem‐cell‐like divisions of stomata development (Hunt and Gray 2009; Hunt et al. 2010). Polaris (PLS), an auxin‐ inducible polypeptide, is required for correct root growth and leaf vascular patterning (Chilley et al. 2006). All of these newly identified components have contributed extensively to our understanding of the auxin signaling network, and highlighted the importance of peptide in auxin‐mediated plant growth regulation. In this study, we identified an auxin‐induced endogenous polypeptide, auxin‐responsive endogenous polypeptide 1 (AREP1), the expression of which in cotyledons, the young leaf tip area, root tips, and the shoot apex correlates well with auxin distribution. Moreover, AREP1‐green fluorescent protein (GFP) fusion protein was observed to accumulate in the
www.jipb.net
Keywords: Auxin response; endogenous peptide; root development Citation: Yang F, Song Y, Yang H, Liu Z, Zhu G, Yang Y (2014) An auxin‐ responsive endogenous peptide regulates root development in Arabidopsis. J Integr Plant Biol 56: 635–647. doi: 10.1111/jipb.12178 Edited by: Jürgen Kleine‐Vehn, Universität für Bodenkultur Wien, Austria Received Nov. 18, 2013; Accepted Jan. 27, 2014 Available online on Jan. 30, 2014 at www.wileyonlinelibrary.com/ journal/jipb © 2014 Institute of Botany, Chinese Academy of Sciences
July 2014 | Volume 56 | Issue 7 | 635–647
Free Access
As a multifunction phytohormone, auxin plays a fundamental role in plant growth and development as well as environmental responses by promoting cell expansion, division, and differentiation (Friml 2003; Leyser 2010; Zhao 2010; Zhao et al. 2012). All of these effects are attributed to the fact that auxin functions as an important signaling molecule that activates a series of events required for plant growth and survival. In recent years, it has been well documented that auxin import, export, and flow are mediated by different signaling pathways in Arabidopsis thaliana (Vogler and Kuhlemeier 2003; Smith 2008). The best‐understood pathway from auxin perception to responsive gene expression involves three protein families: (i) the SCFTIR1/AFB ubiquitin ligase family (Santner and Estelle 2010); (ii) transcriptional repressors in the auxin (Aux)/indoleacetic acid (IAA) family (Tan et al. 2007; Notaguchi et al. 2012); and (iii) transcription factor ADP ribosylation factor (ARF) family (Guilfoyle and Hagen 2007). At the basal level of free auxin, Aux/IAA proteins bind to ARFs as inhibitors to block the activation of auxin‐responsive genes. With the elevation of endogenous auxin content, auxin acts as a molecular glue to promote Aux/IAA proteins binding to the SCFTIR1 E3 ligase complex, which results in the ubiquitination and degradation of Aux/IAA proteins by the 26S proteasome (Guilfoyle 2007; Tan et al. 2007). Consequently, the ARFs are released to regulate the expression of the downstream auxin‐ responsive genes (Chapman and Estelle 2009).
Research Article
Key Laboratory of Bio‐Resources and Eco‐Environment of Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610064, China, 2Center for Integrative Conservation, Xishuangbanna Tropical Botanical Garden, the Chinese Academy of Sciences, Mengla 666303, China, 3 Graduate School of the Chinese Academy of Sciences, Beijing 100039, China, 4Floricultural Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou, Guangdong 510640, China. †These authors contributed equally to this work. *Correspondence: [email protected]
636
Yang et al.
nucleus and the cytoplasm in response to IAA treatment. Plants overexpressing AREP1 or RNAi transgenic plants showed a decrease or increase, respectively, in lateral root formation under auxin treatment, as well as altered growth of the primary root. Correspondingly, expression of the auxin‐ responsive genes IAA3, IAA7, IAA17, GH3.2, GH3.3, and SAUR‐ AC1, were markedly elevated or slightly suppressed in AREP1 RNAi or transgenic plants overexpressing AREP1, respectively, which explained the phenotypes of transgenic plants in response to auxin treatment. However, we failed to detect notable difference in the levels of endogenous IAA between transgenic plants and wild type. These studies strongly suggested that AREP1 plays a role in plant root development through its involvement in auxin signaling transduction.
RESULTS Identification of AREP1 Peptides function in diverse aspects of plant physiology, growth, and development. Recently, a large number of peptide‐encoding genes were predicted in Arabidopsis thaliana (Lease and Walker 2006). However, for most, the biological functions remain unknown. To determine the roles of these in silico‐predicted peptide, we surveyed the DNA sequence 1.5 kb upstream of these candidates. A subset of them that contained 1 or more auxin‐responsive elements (AuXREs) was chosen for further analysis. We thereafter tested the transcript abundance of these putative peptide‐ encoding genes by quantitative real‐time polymerase chain reaction (PCR) after IAA treatment. The candidate peptide ath_mu_ch1_343top (http://www.genoportal.org/PSSP/index. do) was finally identified and designated auxin‐responsive endogenous peptide 1 (AREP1). The AREP1 gene localizes between At1g01320 and At1g01340, and is predicted to encode a polypeptide with 40 amino acids (Figure 1A). SignalP prediction detected no potential signal peptide‐cleavage sites in the amino acid sequences (Petersen et al. 2011). To confirm that the AREP1 gene is transcribed in vivo, we conducted reverse transcription PCR using RNA extracted from Arabidopsis seedlings. As expected, the open reading frame (ORF) region product of AREP1 was amplified whereas no PCR product was observed without reverse transcriptase (Figure 1B). Sequencing results suggested that the PCR product was identical to the predicted ORF region of AREP1. To further determine whether the AREP1 gene is translated in vivo, we constructed GFP‐tagged AREP1 fusion under the control of its native promoter. Translated product of the AREP1 gene was tested with protein extracted from Arabidopsis protoplasts transiently expressing AREP1: AREP1‐GFP, and AREP1:GFP as an empty control. As shown in Figure 1C, in comparison with empty GFP control, the fused protein containing 40 amino acid residues of AREP1 displayed a larger size as expected, indicating that AREP1 encodes an endogenous peptide in Arabidopsis. AREP1 is induced by auxin According to the analysis of the DNA sequence upstream of the AREP1 gene, an AuXRE is located at position 217 (Figure 1A, highlighted by blue), suggesting a possible regulatory July 2014 | Volume 56 | Issue 7 | 635–647
relationship between the auxin response and AREP1. To further confirm the response of AREP1 to auxin, the transcript abundance of AREP1 was determined over a 72 h time course after incubation with exogenous IAA. Real‐time PCR results showed that the expression level of AREP1 was enhanced up to 12 fold after IAA treatment (Figure 1D). Furthermore, the induction of AREP1 in response to auxin was identically observed in the translational level. In the absence of IAA, given the strength of AREP1 native promoter, very weak GFP fluorescence was detected in Arabidopsis protoplasts transformed with AREP1:AREP1‐GFP after 16 h incubation (Figure 1E, top panel). Contrarily, when 10 nM IAA was added and incubated for 16 h, the protoplasts showed strong GFP fluorescence in the cytosol and the nucleus (Figure 1E, middle panel), which suggested a strengthened promoter activity of AREP1 induced by IAA treatment. In contrast, fluorescence of the GFP control was only detected in the cytoplasm after IAA treatment (Figure 1E, bottom panel), indicating that AREP1 was inducible and distributed in the cytosol and the nucleus in response to auxin. Expression pattern of AREP1 Previous studies indicated that the auxin‐related polypeptide showed a tissue‐specific distribution (Topping and Lindsey 1997). We then determined the abundance of AREP1 transcripts at different developmental stages and in different tissues. As shown in Figure 2A, AREP1 was expressed at a moderate level in dissected tissues of mature plants. A higher level was detected in 3 d old seedlings, while a decrease in the level was observed in older seedlings or mature leaves, indicating that AREP1 was expressed dominantly at the plant primary developmental stage. To confirm these results, a construct containing an 800 bp DNA fragment from upstream of the AREP1 coding region was fused to a glucuronidase (GUS) reporter gene. GUS activity was observed in expanding cotyledons, newly developing leaves, and the root. Figure 2B reveals the detailed expression pattern of AREP1 during plant development. In the early developmental stage, the highest level of GUS activity was observed in the cotyledon and hypocotyls (Figure 2B: a–c), which are the locations of the prominent auxin source (Ni et al. 2001; Teale et al. 2006). With seedling growth, the GUS staining appeared in the margins of developing leaves (Figure 2B: d–f), in root tip area (Figure 2B: g, h), but disappeared in those mature leaves (Figure 2B: j), which was in accordance with the movement and distribution of auxin during early seedling development (Ni et al. 2001; Avsian‐Kretchmer et al. 2002; Ljung et al. 2005; Teale et al. 2006). At the late developmental stage, the GUS staining was observed in the shoot apical meristem (Figure 2B: i) where new leaves initiate, whereas no GUS staining was observed in mature flowers or siliques (data not shown). We also examined the response of the GUS reporter under auxin (IAA) treatment. Consistent with the observable induction of AREP1‐GFP fusion protein and AREP1 mRNA, the GUS reporter was significantly induced by 10 mM IAA (Figure 2B: k, l) and during pretreatment with naphthylphthalamic acid (NPA; an auxin transport blocker), levels of induced GUS reporter significantly decreased (Figure 2B: m). A progressively increased GUS activity was observed as the IAA concentration increased from 0 to 50 mM (Figure 2B: n–p), further confirming the induction of AREP1 by auxin. www.jipb.net
AREP1 regulates root development in Arabidopsis
637
Figure 1. Nucleotide sequence and indoleacetic acid (IAA)‐inducible expression of auxin‐responsive endogenous polypeptide 1 (AREP1) (A) Sequence of AREP1, the arrow indicates predicted translational start site for AREP1. Auxin response element, WRKY binding site, and MYB binding site found 637 bp upstream of open reading frame (ORF), highlighted by blue, green and yellow respectively. (B) Identification of AREP1 by reverse transcription polymerase chain reaction (RT‐PCR). Top band showed amplification of the 120‐ bp ORF from genome DNA (left lane) or total RNA with or without reverse transcription (middle and right lane, respectively). The ACTIN2 transcript was amplified as a control (the bottom band). (C) The presence of AREP1 was detected by immunoblotting in Arabidopsis protoplasts transiently expressing AREP1‐green fluorescent protein (GFP) fusion, using GFP antibody (right lane). AREP1:GFP as an empty control (left lane). Twenty micrograms of protein was loaded in each lane. (D) Induced transcript of AREP1 by exogenous auxin in a time course of 72 h. Seven d old wild‐type seedlings treated with 10 mM IAA for 0, 4, 8, 12, 24, and 72 h were used for analysis. (E) AREP1‐GFP fusion protein (top panel) was induced after IAA treatment (middle panel). AREP1:GFP as an empty control (bottom panel). The AREP1:GFP and AREP1:AREP1‐GFP constructs were transformed into Arabidopsis thaliana leaf protoplasts using polyethylene glycol‐mediated method, incubation with 10 nM IAA for 16 h. Localization of fusion protein was visualized by fluorescence microscopy. AREP1 is required for auxin‐mediated root development The induction of AREP1 by IAA and its tissue‐specific expression pattern implied that it may be involved in the auxin signaling pathway. To investigate the function of AREP1, we constructed www.jipb.net
AREP1 RNAi transgenic plants (Figure 3A), and used a subset of the independent transgenic lines for the determination of the AREP1 transcript level by real‐time PCR. Consequently, lines 2 and 7, which showed relatively lower expression levels of AREP1 July 2014 | Volume 56 | Issue 7 | 635–647
638
Yang et al.
Figure 2. Expression pattern of auxin‐responsive endogenous polypeptide 1 (AREP1) (A) Transcript abundance of AREP1 in different development stages and tissues by real‐time polymerase chain reaction. (B) Glucuronidase (GUS) staining of pAREP1‐GUS transgenic plant. (a–c) Cotyledon of 1–3 d old seedlings, respectively; (d) cotyledon and leaf primordia of 4 d old seedlings; (e) leaf tip and young leaf of 6 d old seedling; (f) leaf tip and young leaf of 8 d old seedling; (g) root tips of 10 d old seedling; (h,i) detailed expression in root tip and shoot apical meristem; (j) old leaves of 14 d old seedlings; (k) GUS staining in 7 d old seedlings treated with 0 mM, (l) 10 mM indoleacetic acid (IAA) for 2 h or (m) 10 mM naphthylphthalamic acid (NPA) for 1 h followed by 10 mM IAA for 2 h; progressively increased GUS activity in 7 d old seedlings treated with (n) 0.5 mM, (o) 5 mM, and (p) 50 mM IAA for 2 h. Bars ¼ 1 mm.
(37% and 43% of that in the wild type, respectively) were chosen for the following assay (Figure 3B). Influence on root elongation caused by IAA was employed to check the response of transgenic plants to auxin. On unsupplemented medium, elongation of transgenic seedling roots was almost identical to the wild type and control vector plants. On medium supplied with IAA over a concentration range of 0.1–1,000 nM, the root July 2014 | Volume 56 | Issue 7 | 635–647
growth in AREP1 RNAi transgenic plants was more severely influenced by IAA gradient than that of wild type. For example, when 0.1 nM IAA was added, root elongation was induced up to 20% longer in RNAi transgenic seedlings, while the elongated length is not more than 10% in wild type. Contrarily, when 10 nM IAA was supplemented, root elongation inhibition reached up to 55% in RNAi transgenic seedlings, whereas it reached only www.jipb.net
AREP1 regulates root development in Arabidopsis
639
Figure 3. Generation and identification of auxin‐responsive endogenous polypeptide 1 (AREP1) transgenic plants (A) AREP1 RNAi construction. Sense and antisense AREP1 was inserted into pART27. (B, C) Transcript abundance of AREP1 in 10 independent AREP1 RNAi (B) and overexpressing transgenic lines (C).
30% in wild type. This finding suggests that suppressed AREP1 plants were more sensitive to IAA treatment (Figures 4A, S1). Mutants that accumulate a high abundance of free IAA have short, highly branched roots (Celenza et al. 1995), reflecting the inhibition of root elongation as well as the promotion of lateral root initiation by auxin. We then examined lateral root initiation and root elongation by exogenous auxin. When 3 d old seedlings grown on normal medium were transferred to media supplemented with 0.1 mM or 1 mM IAA for 4 d, RNAi transgenic plants developed almost two times more lateral roots than wild type and the vector plants did (Figure 4B, D). Correspondingly, RNAi transgenics moved to www.jipb.net
the medium with IAA added displayed a shorter primary root, as shown in Figure 4C. Lines 2 and 7 had a root length of 4.3 0.8 and 5.6 1.2 mm, respectively, compared with wild type plants grown on 0.1 mM IAA medium that had a root length of 8.4 1.1 mm (n ¼ 12). These results indicate that AREP1 RNAi plants are sensitive to IAA‐induced inhibition of root elongation and initiation of lateral roots. To examine whether AREP1 was required for other aspects of root development mediated by auxin, such as adventitious root initiation, we then measured adventitious root initiation in response to indolebutyric acid (IBA), which has been suggested to be an effective auxin for adventitious root July 2014 | Volume 56 | Issue 7 | 635–647
640
Yang et al.
Figure 4. Auxin response in auxin‐responsive endogenous polypeptide 1 (AREP1) RNAi plants (A) AREP1 RNAi seedlings are sensitive to root elongation inhibition by indoleacetic acid (IAA). Seven d old seedlings grown on medium supplemented with various concentrations of IAA were measured. Error bars represent SD (n ¼ 20). (B) Root phenotypes under various concentrations of IAA. Photos were taken after 4 d after transfer of 3 d old seedlings to the indicated medium. (C,D) Root elongation inhibition and lateral root induction by exogenous auxin. Data was recorded 4 d after transfer of 3 d old seedlings to the indicated media. Error bars represent SD (n ¼ 20). (E) Hypocotyl elongation of seedlings grown under 29 °C. Values are means SD. Mann‐Whitney U‐test significant at P < 0.01 between AREP1 RNAi plants and vector control.
initiation (Nordstrom et al. 1991). As shown in Figure 4B, transgenic plants produced more adventitious roots than did wild‐type plants under 1 mM IBA‐supplemented conditions. In addition, Arabidopsis plants grown at a high temperature (29 °C) accumulate free IAA with increased hypocotyl elongation and root elongation (Gray et al. 1998). To determine the response of AREP1 RNAi plants to endogenous IAA accumulation, we compared the root and hypocotyl length of seedlings grown July 2014 | Volume 56 | Issue 7 | 635–647
at 29 °C in the light and the dark, respectively. In the treatment of 29 °C, both the root and hypocotyl of wild‐type and AREP1 RNAi seedlings elongated more rapidly. Although they showed almost identical root elongation in response to high temperature, the hypocotyls elongated more rapidly in RNAi transgenic plants, showing 20% increase in length compared to the length of wild‐ type plants grown in the dark (Figure 4E). Taken together, our results suggest that AREP1 is a negative regulator of auxin response. www.jipb.net
AREP1 regulates root development in Arabidopsis Reduction of AREP1 enhances the expression of several auxin‐responsive genes The molecular mechanism for auxin‐regulated root development has been the subject of several studies, but the underlying genetic pathway is still largely undefined. Considerable evidence indicates that auxin promotes SCFTIR1‐dependent degradation of AUX/IAA proteins, resulting in diverse downstream effects associated with correct differentiation and initiation of root development (Gray et al. 2001). Because the above results suggest that AREP1 plays a role in root growth and in the response to auxin, we wished to elucidate whether the disruption of AREP1 affects auxin signal transduction. We then examined the expression of auxin‐ responsive Aux/IAA, GH3, and SAUR family members (Gil et al. 1994; Tian and Reed 1999; Takase et al. 2004). Real‐time PCR results showed that the expression of IAA3, IAA7, IAA17, GH3.2, GH3.3, and SAUR‐AC1 were upregulated by five to eight times in wild‐type roots after the addition of IAA (Figure 5). In contrast, the induction of these genes was apparently higher in the roots of AREP1 RNAi seedlings than in wild‐type. Under normal conditions, the expression levels of these auxin‐ responsive genes were almost identical (IAA7, SAUR‐AC1) or no
641
more than four times (IAA3, IAA17, GH3.2, GH3.3) higher in RNAi seedlings, while in the presence of exogenous IAA, gene expression levels reached up to 10–20 fold increase in RNAi seedlings, which showed more significant induction compared to that in wild‐type. These findings are in accordance with the downregulation of AREP1 resulting in hypersensitive phenotypes in response to auxin, and indicate that knockdown of AREP1 activated the auxin signaling pathway. Increased AREP1 expression negatively affects auxin response Given that a decrease in the levels of AREP1 mRNA amount has dramatic effects on root development, we wanted to determine if increase in the AREP1 transcript abundance has an opposite effect on root growth. Transgenic plants expressing AREP1 cDNA under the control of the 35S promoter were generated, and 10 independent lines were further examined. Lines 1 and 5, which showed relatively high AREP1 expression, were used for further analysis (Figure 3C). Under normal growth conditions, no obvious phenotypic differences in root development were observed between overexpression plants and wild‐type. When exogenous auxin was added, both
Figure 5. Relative mRNA levels of IAA3, IAA7, IAA17, GH3.2, GH3.3, and SUAR‐AC1 in RNAi plants Seven d old seedlings were subjected to indoleacetic acid (IAA) treatment for 24 h. Root RNA was used for real‐time polymerase chain reaction. Expression levels were normalized to ACTIN2. Each data point is a mean of three replicates and error bars represent SE of means (An‐2, An‐7, two independent auxin‐responsive endogenous polypeptide 1 (AREP1) RNAi lines). CK, cytokeratin; WT, wild type. www.jipb.net
July 2014 | Volume 56 | Issue 7 | 635–647
642
Yang et al.
Figure 6. Auxin response in auxin‐responsive endogenous polypeptide 1 (AREP1) overexpressing plants (A) Root elongation of seedlings grown on medium supplemented with various concentrations of indoleacetic acid (IAA). Root length of 7 d old seedlings were standardized against growth on unsupplemented medium. Error bars represent SD (n ¼ 20). (B) Root phenotypes under various concentrations of IAA. Photos were taken after 4 d after transfer of 3 d old seedlings to the indicated medium. (C,D) Lateral root number and primary root length of seedlings. Data was recorded 4 d after transfer of 3 d old seedlings to the indicated medium. Error bars represent SD (n ¼ 20). Values are means SD. Mann‐Whitney U‐test significant at P < 0.05 between AREP1 overexpressing plants and vector control. WT, wild type.
primary and lateral root growth showed enhanced tolerance in plants overexpressing AREP1 (Figures 6, S1). The transgenic seedlings grown on medium supplied with IAA over a concentration from 0.1 nM to 1 mM showed slightly longer primary root length (Figures 6A, S1). When 3 d old seedlings grown on normal medium were transferred to media supplemented with 0.1 or 1 mM IAA for 4 d, as shown in Figure 6(B–D), in comparison with the observation in the wild‐ type, lateral root initiation was 10% or 18% less (Figure 6C) and primary root elongation was 23% or 17% greater (Figure 6D) in AREP1 overexpression lines in response to 0.1 or 1 mM IAA, respectively. We further examined the expression of auxin‐ responsive genes. Under normal growth and auxin treatment conditions, expression of these auxin‐responsive genes IAA7, July 2014 | Volume 56 | Issue 7 | 635–647
IAA17, GH3.2, and SAUR‐AC1 was repressed to some extent in overexpression lines (Figure 7). These results suggest that enhancement of the expression of AREP1 has negative effect on auxin signaling response.
DISCUSSION The mechanism for auxin perception has been the subject of a larger number of studies, producing a notable increase of the components responsible for auxin sensing. Recently, several peptides have been found to play crucial roles in plant development related to auxin. For example, the CLEL (CLV3/ ESR‐related) peptide family controls the pattern of root growth www.jipb.net
AREP1 regulates root development in Arabidopsis
643
Figure 7. Expression of IAA3, IAA7, IAA17, GH3.2, GH3.3, and SUAR‐AC1 in auxin‐responsive endogenous polypeptide 1 (AREP1) overexpressing plants Seven d old seedlings were subjected to indoleacetic acid (IAA) treatment for 24 h. Root RNA was used for real‐time polymerase chain reaction. Expression levels were normalized to ACTIN2. Each data point is a mean of three replicates and error bars represent SE of means (Sn1 and Sn5 are two independent AREP1 overexpressing lines). CK, cytokeratin; WT, wild type.
and lateral root development (Meng et al. 2012), and GLVs (GOLVEN) function in the formation of auxin gradients and alter the reorientation of shoots and roots after a gravity stimulus (Whitford et al. 2012). These findings highlight the essential roles of peptide in auxin‐mediated root architecture. Here, we identified a novel peptide‐encoding gene, AREP1, which was not annotated in The Arabidopsis Information Resource. Because the peptides are encoded by short sequences, many peptide‐encoding genes are missed during annotation of genomes (Lease and Walker 2006). AREP1 was located between At1g01320 and At1g01340, the detected transcript of AREP1 and the AREP1‐GFP fusion protein that was observed from both western blotting and GFP fluorescence indicated that the putative peptide‐encoding gene AREP1 is functional in vivo. Auxin‐responsive elements (Hagen and Guilfoyle 2002) in its promoter sequence and the expression profile induced by auxin suggest a functional link between AREP1 and auxin. The subcellular localization of AREP1 further revealed the response of its native promoter to IAA treatment, which showed stronger GFP fluorescence in the nucleus and the cytosol when 10 nM IAA was added (Figure 3), while no fluorescence was observed under normal conditions, indicating the response of AREP1 to auxin. Moreover, expression analysis by real‐time PCR and GUS staining revealed that AREP1 is primarily expressed in www.jipb.net
cotyledons, leaf tips and margins, and the root apex, as well as in the shoot apical meristem, similar to the tissue‐specific expression patterns of several small peptide genes involved in auxin signaling, such as PSK5 (Kutschmar et al. 2009), GLV2 (Whitford et al. 2012), and CLE family (Whitford et al. 2012). It has been well documented that auxin is accumulated during seed germination. The cotyledon‐derived auxin is exported to the shoot apical meristem or the leaf primordium, and then transfers to the leaf tips and the margins (Avsian‐Kretchmer et al. 2002). Auxin synthesized to some extent in the roots as well. Our results indicated that the expression pattern of AREP1 is in agreement with endogenous auxin distribution, suggesting that AREP1 participates in the auxin‐regulated plant development process. Considering the accordant distribution of AREP1 and the endogenous auxin during plant different developmental stages, we further carried out auxin assay to evaluate the influence of AREP1 on auxin biosynthesis. The RNAi and over‐ expresser lines showed identical levels of free IAA, indicating that AREP1 has no direct influence on endogenous auxin accumulation (Figure S2). This result is consistent with the fact that no phenotype observed in the absence of exogenous auxin in AREP1 over‐ or down‐expressed plants. When exogenous auxin was added, our root elongation assay July 2014 | Volume 56 | Issue 7 | 635–647
644
Yang et al.
revealed that AREP1 RNAi plants were hypersensitive to IAA treatment, while overexpressing lines were hyposensitive, coupled with corresponding primary root elongation and lateral root initiation. Accordingly, the essential components involved in the IAA signaling pathway were also induced in RNAi plants and their activity reduced in overexpression plants, suggesting that AREP1 negatively mediates the auxin signaling response during the process of plant root development. The central role of auxin in orchestrating final root architecture has been highlighted by a large number of evidences (Overvoorde et al. 2010). An elevation of endogenous auxin promotes Aux/IAA proteins binding to the SCFTIR1 E3 ligase complex, resulting in the ubiquitination and degradation of Aux/IAA proteins by the 26S proteasome. The ARFs are consequently released and activate the downstream GH3, SAUR, and other auxin‐responsive genes (Figure 8, black arrowheads). AREP1 can be induced strongly by auxin and act as a negative regulator to repress the expression of the downstream auxin‐responsive genes including GH3.2, GH3.3, and SAUR‐AC (Figure 8, red arrowheads). A reduction of AREP1 in the RNAi transgenic plants leads to increased expression of auxin‐responsive genes and auxin hypersensitivity. Whereas the repressors of auxin signaling pathway (including IAA3, 7, 17), were also induced in AREP1 RNAi plants. As described above, Aux/IAA proteins are not stable and auxin
promotes their degradation. It is hard to simply define the positive or negative impact of AREP1 on AUX/IAA proteins here, for we can only detect the transcript abundance rather than the amount of the AUX/IAA proteins in this study. It is possible that AREP1 may play a positive role in the degradation of AUX/ IAA proteins (Figure 8, red dotted lines), and there may be a feedback regulation of AUX/IAA in the transcription– translation activation as generally reported for many other proteins. However, a functional model for AREP1 action in auxin response, explaining how AREP1 is transcriptionally activated by auxin and act as a negative‐feedback regulator to affect the expression of auxin‐responsive genes and suppress auxin responses, needs further determination. Promoter analysis indicated that 1 auxin‐responsive element, 1 MYB‐binding site, and 2 WRKY‐binding sites were located in the 1 kb region upstream of the AREP1 gene (highlighted by blue, yellow, and green respectively, in Figure 1A). Recent studies have suggested that several MYB and WRKY family members are involved in the auxin pathway and in the regulation of root development (Shin et al. 2007; Yu et al. 2010). We therefore supposed a potential link among AREP1, MYB, and WRKY transcription factors, and then detected the expression level of AREP1 in the mutant of WRKY75 and MYB77, both of which were reported to participate in auxin‐mediated root development (Shin et al. 2007; Yu et al. 2010). No significant difference of AREP1 transcript was detected in wild types, wrky75, and myb77. However, a reduced amount of AREP1 was notable in WRKY75 overexpression lines (Figure S3), which indicated a potential regulatory role of WRKY75 on AREP1 with respect to auxin response. Given that WRKY75 overexpression and AREP1 RNAi plants display similar auxin‐hypersensitive phenotype, it would be reasonable that the expression of AREP1 was suppressed in WRKY75 overexpressing plants. Further analysis is needed to determine the interaction and combinatory role of them for auxin response in Arabidopsis.
MATERIALS AND METHODS Plant materials and growth conditions Arabidopsis thaliana (accession Columbia, Col‐0) seeds were surface‐sterilized with 20% (v/v) bleach for 15 min and washed three times with sterile distilled water. They were then cultured for 2 weeks in a half Murashige‐Skoog (MS) medium (0.7% agar, w/v), then transferred to soil under a 16 h photoperiod at 22 °C.
Figure 8. Hypothetical model for the role of auxin‐responsive endogenous polypeptide 1 (AREP1) in auxin signaling pathway Indoleacetic acid (IAA) promotes the ubiquitination and degradation of auxin (Aux)/IAA proteins to release the ADP ribosylation factors (ARFs). Free ARFs consequently activated the downstream GH3, SAUR, and other auxin‐responsive genes (black arrowheads, Teale et al. 2006). AREP1 was induced by auxin and acted as a negative regulator to repress the expression of the downstream auxin‐responsive genes (red arrowheads). July 2014 | Volume 56 | Issue 7 | 635–647
Plasmid construction Vectors used for plasmid construction included pMD‐19T (Takara, Kyoto, Japan), pBI121 for AREP1 overexpressing construct, pART27 for AREP1 RNAi construct, and pZH01 which contained a GUS reporter gene. A 120 bp fragment (predicted ORF of AREP1) was PCR‐amplified from Arabidopsis genomic DNA, using specific primers for AREP1 (50 ‐TTTTAGGGCCTCTAAAGTCGTT‐30 and 50 ‐ACTGGGCAGTTAAGTTACCATTT‐30 ) then cloned into pMD‐19T Vector (Takara, Kyoto, Japan). The sequence of the amplified DNA fragment was verified by sequencing. A Xba1‐SalI fragment from pT‐AREP1 containing the AREP1 sequence was then subcloned into the XbaI and SalI sites of modified pBI121 between the CaMV 35S promoter and www.jipb.net
AREP1 regulates root development in Arabidopsis the nitric oxide synthase 30 ‐poly(A) signal to generate the AREP1 overexpressing construct. For the AREP1 RNAi construct, a 120 bp fragment of sense and antisense AREP1 was subcloned from pH annibal, as shown in Figure 3A. An 800 bp AREP1 promoter region was amplified from Arabidopsis genomic DNA by PCR using the specific forward primer 50 ‐TTGCGGCCGCAATGAAAGATCCGGAAAGTGTAATTT‐30 and the 50 ‐TTTCTAGAGTTTCTTTGTTTCAAAGGAAAAGTT‐30 , which contain a NotI‐specific reverse primer and an XbaI restriction site, respectively. The PCR fragment was digested with NotI and XbaI, and was inserted in the frame upstream of the GUS reporter gene in pZH01 vector. Transformations of plant were performed as described by Clough and Bent (1998), and T2 transformants of the transgenic plants were used in all experiments unless otherwise indicated. GUS staining Glucuronidase activity was assayed according to the method of Chen et al. (2012). Seedlings and tissues were gently fixed by incubation in 90% acetone on ice for 20 min and were then transferred into staining solution containing 5 mmol sodium phosphate (pH 7.0), 0.5 mmol K3Fe (CN)6, 0.5 mmol K4Fe(CN)6, 0.1% v/v Triton X‐100 and 2 mmol X‐gluc (Sigma‐Aldrich, St Louis, MO, USA), vacuum infiltrated for 5 min, and incubated in darkness at 37 °C overnight, then washed with 70% ethanol. Protein localization and western blot analysis For GFP fusions driven by the promoter of AREP1, the 35S promoter in the vector pBI221 was replaced by a 1,478‐bp AREP1 promoter fragment, to construct AREP1:AREP1‐GFP fusion and AREP1:GFP in vector pBI221 (primers shown in Table S1). Transient protein expression in Arabidopsis protoplasts was performed as described by Abel and Theologis (1994). Localization assay was carried out 12 h after transformation, using a confocal laser‐scanning microscope as described elsewhere. Collecting Arabidopsis protoplast transiently expressing AREP1:AREP1‐GFP fusion or AREP1:GFP, respectively, for protein extraction, and western blot analysis using anti‐GFP, was performed as described by Xiong et al. (2013) with some modification. Briefly, total proteins were separated on a 10% sodium dodecylsulfate polyacrylamide gel electrophoresis gel, and then transferred to Immun‐Blot polyvinylidene difluoride membrane (Bio‐Rad, Hercules, CA, USA) at 110 V for 2 h. Following transfer, the membrane was then incubated with 1:10,000 dilution of GFP antibody for 2 h at room temperature. Incubated membranes were subsequently washed with 3 100 mL Tris‐buffered saline containing 1% (v/v) Tween‐20 (TBS‐T) for 10 min under constant rotational mixing. Secondary antibody incubation of membranes followed by 1:7,500 dilution goat antirabbit antibody conjugated with horseradish peroxidase (Sigma‐Aldrich, St Louis, MO, USA) in TBS‐T for 1 h at room temperature. Finally, the membrane was rinsed 4 10 min with TBS‐T, and then stained with 3,30 ‐ diaminobenzidine‐tetrachloride (Tiangen, Beijing, China) (Xiong et al. 2013). Stress tolerance tests Three d old seedlings were transferred to 1/2 MS agar plates supplemented with 0.1 mM, 1 mM IAA, and 1 mM IBA, respectively, and grown for 4 d at 22 2 °C with 16 h of light and 8 h of dark. Each assay was repeated three times. Number of lateral www.jipb.net
645
roots (>0.1 cm) was counted by using a microscope (XTL‐3A, AIRMA, Shenzhen, China) after the roots were stained in the GUS buffer solution. For root elongation assay, after 1 week of growth under light at 22 °C on medium supplemented with various concentrations of IAA, seedlings were removed from the agar, and the length of the primary root was recorded. All results were standardized against growth on unsupplemented medium. For hypocotyl elongation assay in dark‐grown Arabidopsis, length of hypocotyls was measured for 5 d old seedlings (1 d in the light, 4 d in the dark under 29 °C). Data were analyzed by SPSS (Chicago, IL, USA), and Table S2 shows the summary of P‐values among the transgenic, vector control, and wild‐type plants. Expression analysis For gene expression pattern assay, 3 and 7 d old seedlings as well as rosette leaves, roots, and stems of 21 d old Arabidopsis and mature siliques were harvested for RNA extraction. To test transcript abundance of AREP1 responding to auxin application, 7 d old seedlings grown on 1/2 MS medium were moved to 50 mL liquid MS medium containing 10 mM IAA for 0, 2, 4, 8, 12, 48, and 72 h. The primers used for real‐time PCR amplifications are listed in Table S1. For expression levels of the genes related to auxin signaling pathway, 7 d old seedlings were moved to 50 mL of liquid MS medium without sucrose with 1 mM IAA for 24 h, then the roots were harvested for RNA extraction. RNA was extracted by the use of RNAiso Plus kit (Takara). One microgram of total RNA was quantified using the Quantity one 1D Analysis software for reverse transcription (Bio‐Rad, Vilnius, Lithuania). Relative transcripts levels were determined using the iCycler IQ Real‐time PCR Detection System (Bio‐Rad) according to the manual QuantiTect SYBR Green PCR kit and analyzed by icycler real‐time detection system software (version 3.0). Expression levels were normalized using the threshold cycle values obtained for the ACTIN2 gene. All quantifications were made in duplicate on RNA samples obtained from three independent experiments. The primers used for real‐time PCR amplifications are listed in Table S3.
ACKNOWLEDGEMENTS This project research was funded by the National Natural Science Foundation of China (30971557, 30971816, and 31300996) and the Guangdong Natural Science Foundation (S2011010001433).
REFERENCES Abel S, Theologis A (1994) Transient transformation of Arabidopsis leaf protoplasts: A versatile experimental system to study gene expression. Plant J 5: 421–427 Avsian‐Kretchmer O, Cheng JC, Chen L, Moctezuma E, Sung ZR (2002) Indole acetic acid distribution coincides with vascular differentiation pattern during Arabidopsis leaf ontogeny. Plant Physiol 130: 199–209 Celenza JL, Jr., Grisafi PL, Fink GR (1995) A pathway for lateral root formation in Arabidopsis thaliana. Genes Dev 9: 2131–2142 Chapman EJ, Estelle M (2009) Mechanism of auxin‐regulated gene expression in plants. Annu Rev Genet 43: 265–285
July 2014 | Volume 56 | Issue 7 | 635–647
646
Yang et al.
Chen H, Je J, Song C, Hwang JE, Lim CO (2012) A proximal promoter region of Arabidopsis DREB2C confers tissue‐specific expression under heat stress. J Integr Plant Biol 54: 640–651
respective auxins and their conjugation with aspartic‐acid during adventitious root‐formation in pea cuttings. Plant Physiol 96: 856– 861
Chilley PM, Casson SA, Tarkowski P, Hawkins N, Wang KL, Hussey PJ, Beale M, Ecker JR, Sandberg GK, Lindsey K (2006) The POLARIS peptide of Arabidopsis regulates auxin transport and root growth via effects on ethylene signaling. Plant Cell 18: 3058–3072
Notaguchi M, Wolf S, Lucas WJ (2012) Phloem‐mobile Aux/IAA transcripts target to the root tip and modify root architecture. J Integr Plant Biol 54: 760–772
Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium‐mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 Friml J (2003) Auxin transport—shaping the plant. Curr Opin in Plant Biol 6: 7–12. Gao X, Guo Y (2012) CLE peptides in plants: Proteolytic processing, structure–activity relationship, and ligand–receptor interaction. J Integr Plant Biol 54: 738–745 Gil P, Liu Y, Orbovic V, Verkamp E, Poff KL, Green PJ (1994) Characterization of the auxin‐inducible SAUR‐AC1 gene for use as a molecular genetic tool in Arabidopsis. Plant Physiol 104: 777–784 Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M (2001) Auxin regulates SCFTIR1‐dependent degradation of AUX/IAA proteins. Nature 414: 271–276. Gray WM, Ostin A, Sandberg G, Romano CP, Estelle M (1998) High temperature promotes auxin‐mediated hypocotyl elongation in Arabidopsis. Proc Natl Acad Sci USA 95: 7197–7202 Guilfoyle T. (2007) Plant biology—Sticking with auxin. Nature 446: 621– 622 Guilfoyle TJ, Hagen G (2007) Auxin response factors. Curr Opin Plant Biol 10: 453–460 Hagen G, Guilfoyle T (2002) Auxin‐responsive gene expression: Genes, promoters and regulatory factors. Plant Mol Biol 49: 373–385 Hunt L, Bailey KJ, Gray JE (2010) The signalling peptide EPFL9 is a positive regulator of stomatal development. New Phytol 186: 609– 614
Overvoorde P, Fukaki H, Beeckman T (2010) Auxin control of root development. Cold Spring Harb Perspect Biol 2: a001537 Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat Methods 8: 785–786 Santner A, Estelle M (2010) The ubiquitin‐proteasome system regulates plant hormone signaling. Plant J 61: 1029–1040 Shin R, Burch AY, Huppert KA, Tiwari SB, Murphy AS, Guilfoyle TJ, Schachtman DP (2007) The Arabidopsis transcription factor MYB77 modulates auxin signal transduction. Plant Cell 19: 2440– 2453 Smith RS. (2008) The role of auxin transport in plant patterning mechanisms. PLoS Biol 6: 2631–2633 Takase T, Nakazawa M, Ishikawa A, Kawashima M, Ichikawa T, Takahashi N, Shimada H, Manabe K, Matsui M (2004) ydk1‐D, an auxin‐responsive GH3 mutant that is involved in hypocotyl and root elongation. Plant J 37: 471–483 Tan X, Calderon‐Villalobos LIA, Sharon M, Zheng CX, Robinson CV, Estelle M, Zheng N (2007) Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature 446: 640–645 Teale WD, Paponov IA, Palme K (2006) Auxin in action: Signalling, transport and the control of plant growth and development. Nat Rev Mol Cell Biol 7: 847–859 Tian Q, Reed JW (1999) Control of auxin‐regulated root development by the Arabidopsis thaliana SHY2/IAA3 gene. Development 126: 711– 721
Hunt L, Gray JE (2009) The signaling peptide EPF2 controls asymmetric cell divisions during stomatal development. Curr Biol 19: 864–869
Topping JF, Lindsey K (1997) Promoter trap markers differentiate structural and positional components of polar development in Arabidopsis. Plant Cell 9: 1713–1725
Katsir L, Davies KA, Bergmann DC, Laux T (2011) Peptide signaling in plant development. Curr Biol 21: R356–R364
Vogler H, Kuhlemeier C (2003) Simple hormones but complex signalling. Curr Opin Plant Biol 6: 51–56
Kutschmar A, Rzewuski G, Stuhrwohldt N, Beemster GT, Inze D, Sauter M (2009) PSK‐alpha promotes root growth in Arabidopsis. New Phytol 181: 820–831
Whitford R, Fernandez A, De Groodt R, Ortega E, Hilson P (2008) Plant CLE peptides from two distinct functional classes synergistically induce division of vascular cells. Proc Natl Acad Sci USA 105: 18625– 18630
Lease KA, Walker JC (2006) The Arabidopsis unannotated secreted peptide database, a resource for plant peptidomics. Plant Physiol 142: 831–838 Leyser O. (2010) The power of auxin in plants. Plant Physiol 154: 501– 505 Ljung K, Hull AK, Celenza J, Yamada M, Estelle M, Normanly J, Sandberg G (2005) Sites and regulation of auxin biosynthesis in Arabidopsis roots. Plant Cell 17: 1090–1104 Matsubayashi Y, Sakagami Y (1996) Phytosulfokine, sulfated peptides that induce the proliferation of single mesophyll cells of Asparagus officinalis L. Proc Natl Acad Sci USA 93: 7623–7627 Meng L, Buchanan BB, Feldman LJ, Luan S (2012) CLE‐like (CLEL) peptides control the pattern of root growth and lateral root development in Arabidopsis. Proc Natl Acad Sci USA 109: 1760– 1765 Ni DA, Wang LJ, Ding CH, Xu ZH (2001) Auxin distribution and transport during embryogenesis and seed germination of Arabidopsis. Cell Res 11: 273–278 Nordstrom AC, Jacobs FA, Eliasson L (1991) Effect of exogenous indole‐ 3‐acetic‐acid and indole‐3‐butyric acid on internal levels of the
July 2014 | Volume 56 | Issue 7 | 635–647
Whitford R, Fernandez A, Tejos R, Perez AC, Kleine‐Vehn J, Vanneste S, Drozdzecki A, Leitner J, Abas L, Aerts M, Hoogewijs K, Baster P, De Groodt R, Lin YC, Storme V, Van de Peer Y, Beeckman T, Madder A, Devreese B, Luschnig C, Friml J, Hilson P (2012) GOLVEN secretory peptides regulate auxin carrier turnover during plant gravitropic responses. Dev Cell 22: 678–685 Xiong X, Xu D, Yang Z, Huang H, Cui X (2013) A single amino‐acid substitution at lysine 40 of an Arabidopsis thalianaalpha‐tubulin causes extensive cell proliferation and expansion defects. J Integr Plant Biol 55: 209–220 Yu S, Ligang C, Liping Z, Diqiu Y (2010) Overexpression of OsWRKY72 gene interferes in the abscisic acid signal and auxin transport pathway of Arabidopsis. J Biosci 35: 459–471 Zhao Y (2010) Auxin biosynthesis and its role in plant development. Annu Rev of Plant Biol 61: 49 Zhao FY, Han MM, Zhang SY, Wang K, Zhang CR, Liu T, Liu W (2012) Hydrogen peroxide‐mediated growth of the root system occurs via auxin signaling modification and variations in the expression of cell‐cycle genes in rice seedlings exposed to cadmium stress. J Integr Plant Biol 54: 991–1006
www.jipb.net
AREP1 regulates root development in Arabidopsis
SUPPORTING INFORMATION Additional supporting information can be found in the online version of this article: Figure S1. Primary root elongation of seedlings grown on media supplemented with 0–10 nM indoleacetic acid (IAA) Primary root elongation of seedlings grown on media supplemented with 0 nM (A), 0.1 nM (B), 1 nM (C), 10 nM (D) IAA. Photos were taken after 7 d growth Figure S2. Indoleacetic acid (IAA) content measurement Two week old seedlings of wild‐type (col), auxin‐responsive endogenous polypeptide 1 (AREP1) RNAi (An2, An7), and overexpressors (Sn1, Sn5) grown on 1/2 Murashige–Skoog medium were weighed, and the auxin assay was carried out
www.jipb.net
647
using an enzyme‐linked immunoassay kit (HengYuan Biological Technology, Shanghai, China). Figure S3. Auxin‐responsive endogenous polypeptide 1 (AREP1) expression level was suppressed by WRKY75 overexpression Transcript of AREP1 was not altered in myb77 and wrky75 while significantly decreased in two independent WRKY75 overexpression lines. One microgram of RNA extracted from 7 d old seedlings of the identified myb77, wrky75, two independent WRKY75 overexpressing lines 3, 6, and wild‐type for reverse transcription (Bio‐Rad, Vilnius, Lithuania) with 30 oligo dT primer. Table S1. Primers for plasmid construction Table S2. Summary of P‐values among the transgenic, vector control, and wild‐type plants Table S3. Primers of auxin‐responsive genes for real‐time polymerase chain reaction (PCR)
July 2014 | Volume 56 | Issue 7 | 635–647
Journal of Integrative Plant Biology
An auxin‐responsive endogenous peptide regulates root development in Arabidopsis Fengxi Yang1,4†, Yu Song2,3†, Hao Yang1, Zhibin Liu1, Genfa Zhu4 and Yi Yang1* 1
Abstract Auxin plays critical roles in root formation and development. The components involved in this process, however, are not well understood. Here, we newly identified a peptide encoding gene, auxin‐responsive endogenous polypeptide 1 (AREP1), which is induced by auxin, and mediates root development in Arabidopsis. Expression of AREP1 was specific to the cotyledon and to root and shoot meristem tissues. Amounts of AREP1 transcripts and AREP1‐green fluorescent protein fusion proteins were elevated in response to indoleacetic acid treatment. Suppression of AREP1 through RNAi silencing resulted in reduction of primary root length, increase of lateral root number, and expansion of adventitious roots, compared to the observations in wild‐type plants in the presence of auxin. By contrast, transgenic plants overexpressing AREP1 showed enhanced growth of the primary root under auxin treatment. Additionally, root morphology, including lateral root number and
adventitious roots, differed greatly between transgenic and wild‐ type plants. Further analysis indicated that the expression of auxin‐responsive genes, such as IAA3, IAA7, IAA17, GH3.2, GH3.3, and SAUR‐AC1, was significantly higher in AREP1 RNAi plants, and was slightly lower in AREP1 overexpressing plants than in wild‐ type plants. These results suggest that the novel endogenous peptide AREP1 plays an important role in the process of auxin‐ mediated root development.
INTRODUCTION
Recently, several studies have demonstrated the roles of polypeptide signals in auxin‐induced cell proliferation (Teale et al. 2006; Katsir et al. 2011) and cell differentiation (Teale et al. 2006; Katsir et al. 2011). For example, phytosulfokine, an endogenous sulfated pentapeptide, stimulates zinnia tracheary element differentiation and controls cell elongation in roots of Arabidopsis (Matsubayashi and Sakagami 1996). Polypeptides cassava latent virus (CLV)3, tracheary element differentiation inhibitory factor (TDIF), CLE1‐27, and CLE40 induce the termination of shoot and root meristem activity (Whitford et al. 2008; Gao and Guo 2012). The cystein‐rich epidermal patterning factor (EPF) family members, EPF1, EPF2, STOMAGEN, and EPFL9, have been characterized with respect to the stem‐cell‐like divisions of stomata development (Hunt and Gray 2009; Hunt et al. 2010). Polaris (PLS), an auxin‐ inducible polypeptide, is required for correct root growth and leaf vascular patterning (Chilley et al. 2006). All of these newly identified components have contributed extensively to our understanding of the auxin signaling network, and highlighted the importance of peptide in auxin‐mediated plant growth regulation. In this study, we identified an auxin‐induced endogenous polypeptide, auxin‐responsive endogenous polypeptide 1 (AREP1), the expression of which in cotyledons, the young leaf tip area, root tips, and the shoot apex correlates well with auxin distribution. Moreover, AREP1‐green fluorescent protein (GFP) fusion protein was observed to accumulate in the
www.jipb.net
Keywords: Auxin response; endogenous peptide; root development Citation: Yang F, Song Y, Yang H, Liu Z, Zhu G, Yang Y (2014) An auxin‐ responsive endogenous peptide regulates root development in Arabidopsis. J Integr Plant Biol 56: 635–647. doi: 10.1111/jipb.12178 Edited by: Jürgen Kleine‐Vehn, Universität für Bodenkultur Wien, Austria Received Nov. 18, 2013; Accepted Jan. 27, 2014 Available online on Jan. 30, 2014 at www.wileyonlinelibrary.com/ journal/jipb © 2014 Institute of Botany, Chinese Academy of Sciences
July 2014 | Volume 56 | Issue 7 | 635–647
Free Access
As a multifunction phytohormone, auxin plays a fundamental role in plant growth and development as well as environmental responses by promoting cell expansion, division, and differentiation (Friml 2003; Leyser 2010; Zhao 2010; Zhao et al. 2012). All of these effects are attributed to the fact that auxin functions as an important signaling molecule that activates a series of events required for plant growth and survival. In recent years, it has been well documented that auxin import, export, and flow are mediated by different signaling pathways in Arabidopsis thaliana (Vogler and Kuhlemeier 2003; Smith 2008). The best‐understood pathway from auxin perception to responsive gene expression involves three protein families: (i) the SCFTIR1/AFB ubiquitin ligase family (Santner and Estelle 2010); (ii) transcriptional repressors in the auxin (Aux)/indoleacetic acid (IAA) family (Tan et al. 2007; Notaguchi et al. 2012); and (iii) transcription factor ADP ribosylation factor (ARF) family (Guilfoyle and Hagen 2007). At the basal level of free auxin, Aux/IAA proteins bind to ARFs as inhibitors to block the activation of auxin‐responsive genes. With the elevation of endogenous auxin content, auxin acts as a molecular glue to promote Aux/IAA proteins binding to the SCFTIR1 E3 ligase complex, which results in the ubiquitination and degradation of Aux/IAA proteins by the 26S proteasome (Guilfoyle 2007; Tan et al. 2007). Consequently, the ARFs are released to regulate the expression of the downstream auxin‐ responsive genes (Chapman and Estelle 2009).
Research Article
Key Laboratory of Bio‐Resources and Eco‐Environment of Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610064, China, 2Center for Integrative Conservation, Xishuangbanna Tropical Botanical Garden, the Chinese Academy of Sciences, Mengla 666303, China, 3 Graduate School of the Chinese Academy of Sciences, Beijing 100039, China, 4Floricultural Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou, Guangdong 510640, China. †These authors contributed equally to this work. *Correspondence: [email protected]
636
Yang et al.
nucleus and the cytoplasm in response to IAA treatment. Plants overexpressing AREP1 or RNAi transgenic plants showed a decrease or increase, respectively, in lateral root formation under auxin treatment, as well as altered growth of the primary root. Correspondingly, expression of the auxin‐ responsive genes IAA3, IAA7, IAA17, GH3.2, GH3.3, and SAUR‐ AC1, were markedly elevated or slightly suppressed in AREP1 RNAi or transgenic plants overexpressing AREP1, respectively, which explained the phenotypes of transgenic plants in response to auxin treatment. However, we failed to detect notable difference in the levels of endogenous IAA between transgenic plants and wild type. These studies strongly suggested that AREP1 plays a role in plant root development through its involvement in auxin signaling transduction.
RESULTS Identification of AREP1 Peptides function in diverse aspects of plant physiology, growth, and development. Recently, a large number of peptide‐encoding genes were predicted in Arabidopsis thaliana (Lease and Walker 2006). However, for most, the biological functions remain unknown. To determine the roles of these in silico‐predicted peptide, we surveyed the DNA sequence 1.5 kb upstream of these candidates. A subset of them that contained 1 or more auxin‐responsive elements (AuXREs) was chosen for further analysis. We thereafter tested the transcript abundance of these putative peptide‐ encoding genes by quantitative real‐time polymerase chain reaction (PCR) after IAA treatment. The candidate peptide ath_mu_ch1_343top (http://www.genoportal.org/PSSP/index. do) was finally identified and designated auxin‐responsive endogenous peptide 1 (AREP1). The AREP1 gene localizes between At1g01320 and At1g01340, and is predicted to encode a polypeptide with 40 amino acids (Figure 1A). SignalP prediction detected no potential signal peptide‐cleavage sites in the amino acid sequences (Petersen et al. 2011). To confirm that the AREP1 gene is transcribed in vivo, we conducted reverse transcription PCR using RNA extracted from Arabidopsis seedlings. As expected, the open reading frame (ORF) region product of AREP1 was amplified whereas no PCR product was observed without reverse transcriptase (Figure 1B). Sequencing results suggested that the PCR product was identical to the predicted ORF region of AREP1. To further determine whether the AREP1 gene is translated in vivo, we constructed GFP‐tagged AREP1 fusion under the control of its native promoter. Translated product of the AREP1 gene was tested with protein extracted from Arabidopsis protoplasts transiently expressing AREP1: AREP1‐GFP, and AREP1:GFP as an empty control. As shown in Figure 1C, in comparison with empty GFP control, the fused protein containing 40 amino acid residues of AREP1 displayed a larger size as expected, indicating that AREP1 encodes an endogenous peptide in Arabidopsis. AREP1 is induced by auxin According to the analysis of the DNA sequence upstream of the AREP1 gene, an AuXRE is located at position 217 (Figure 1A, highlighted by blue), suggesting a possible regulatory July 2014 | Volume 56 | Issue 7 | 635–647
relationship between the auxin response and AREP1. To further confirm the response of AREP1 to auxin, the transcript abundance of AREP1 was determined over a 72 h time course after incubation with exogenous IAA. Real‐time PCR results showed that the expression level of AREP1 was enhanced up to 12 fold after IAA treatment (Figure 1D). Furthermore, the induction of AREP1 in response to auxin was identically observed in the translational level. In the absence of IAA, given the strength of AREP1 native promoter, very weak GFP fluorescence was detected in Arabidopsis protoplasts transformed with AREP1:AREP1‐GFP after 16 h incubation (Figure 1E, top panel). Contrarily, when 10 nM IAA was added and incubated for 16 h, the protoplasts showed strong GFP fluorescence in the cytosol and the nucleus (Figure 1E, middle panel), which suggested a strengthened promoter activity of AREP1 induced by IAA treatment. In contrast, fluorescence of the GFP control was only detected in the cytoplasm after IAA treatment (Figure 1E, bottom panel), indicating that AREP1 was inducible and distributed in the cytosol and the nucleus in response to auxin. Expression pattern of AREP1 Previous studies indicated that the auxin‐related polypeptide showed a tissue‐specific distribution (Topping and Lindsey 1997). We then determined the abundance of AREP1 transcripts at different developmental stages and in different tissues. As shown in Figure 2A, AREP1 was expressed at a moderate level in dissected tissues of mature plants. A higher level was detected in 3 d old seedlings, while a decrease in the level was observed in older seedlings or mature leaves, indicating that AREP1 was expressed dominantly at the plant primary developmental stage. To confirm these results, a construct containing an 800 bp DNA fragment from upstream of the AREP1 coding region was fused to a glucuronidase (GUS) reporter gene. GUS activity was observed in expanding cotyledons, newly developing leaves, and the root. Figure 2B reveals the detailed expression pattern of AREP1 during plant development. In the early developmental stage, the highest level of GUS activity was observed in the cotyledon and hypocotyls (Figure 2B: a–c), which are the locations of the prominent auxin source (Ni et al. 2001; Teale et al. 2006). With seedling growth, the GUS staining appeared in the margins of developing leaves (Figure 2B: d–f), in root tip area (Figure 2B: g, h), but disappeared in those mature leaves (Figure 2B: j), which was in accordance with the movement and distribution of auxin during early seedling development (Ni et al. 2001; Avsian‐Kretchmer et al. 2002; Ljung et al. 2005; Teale et al. 2006). At the late developmental stage, the GUS staining was observed in the shoot apical meristem (Figure 2B: i) where new leaves initiate, whereas no GUS staining was observed in mature flowers or siliques (data not shown). We also examined the response of the GUS reporter under auxin (IAA) treatment. Consistent with the observable induction of AREP1‐GFP fusion protein and AREP1 mRNA, the GUS reporter was significantly induced by 10 mM IAA (Figure 2B: k, l) and during pretreatment with naphthylphthalamic acid (NPA; an auxin transport blocker), levels of induced GUS reporter significantly decreased (Figure 2B: m). A progressively increased GUS activity was observed as the IAA concentration increased from 0 to 50 mM (Figure 2B: n–p), further confirming the induction of AREP1 by auxin. www.jipb.net
AREP1 regulates root development in Arabidopsis
637
Figure 1. Nucleotide sequence and indoleacetic acid (IAA)‐inducible expression of auxin‐responsive endogenous polypeptide 1 (AREP1) (A) Sequence of AREP1, the arrow indicates predicted translational start site for AREP1. Auxin response element, WRKY binding site, and MYB binding site found 637 bp upstream of open reading frame (ORF), highlighted by blue, green and yellow respectively. (B) Identification of AREP1 by reverse transcription polymerase chain reaction (RT‐PCR). Top band showed amplification of the 120‐ bp ORF from genome DNA (left lane) or total RNA with or without reverse transcription (middle and right lane, respectively). The ACTIN2 transcript was amplified as a control (the bottom band). (C) The presence of AREP1 was detected by immunoblotting in Arabidopsis protoplasts transiently expressing AREP1‐green fluorescent protein (GFP) fusion, using GFP antibody (right lane). AREP1:GFP as an empty control (left lane). Twenty micrograms of protein was loaded in each lane. (D) Induced transcript of AREP1 by exogenous auxin in a time course of 72 h. Seven d old wild‐type seedlings treated with 10 mM IAA for 0, 4, 8, 12, 24, and 72 h were used for analysis. (E) AREP1‐GFP fusion protein (top panel) was induced after IAA treatment (middle panel). AREP1:GFP as an empty control (bottom panel). The AREP1:GFP and AREP1:AREP1‐GFP constructs were transformed into Arabidopsis thaliana leaf protoplasts using polyethylene glycol‐mediated method, incubation with 10 nM IAA for 16 h. Localization of fusion protein was visualized by fluorescence microscopy. AREP1 is required for auxin‐mediated root development The induction of AREP1 by IAA and its tissue‐specific expression pattern implied that it may be involved in the auxin signaling pathway. To investigate the function of AREP1, we constructed www.jipb.net
AREP1 RNAi transgenic plants (Figure 3A), and used a subset of the independent transgenic lines for the determination of the AREP1 transcript level by real‐time PCR. Consequently, lines 2 and 7, which showed relatively lower expression levels of AREP1 July 2014 | Volume 56 | Issue 7 | 635–647
638
Yang et al.
Figure 2. Expression pattern of auxin‐responsive endogenous polypeptide 1 (AREP1) (A) Transcript abundance of AREP1 in different development stages and tissues by real‐time polymerase chain reaction. (B) Glucuronidase (GUS) staining of pAREP1‐GUS transgenic plant. (a–c) Cotyledon of 1–3 d old seedlings, respectively; (d) cotyledon and leaf primordia of 4 d old seedlings; (e) leaf tip and young leaf of 6 d old seedling; (f) leaf tip and young leaf of 8 d old seedling; (g) root tips of 10 d old seedling; (h,i) detailed expression in root tip and shoot apical meristem; (j) old leaves of 14 d old seedlings; (k) GUS staining in 7 d old seedlings treated with 0 mM, (l) 10 mM indoleacetic acid (IAA) for 2 h or (m) 10 mM naphthylphthalamic acid (NPA) for 1 h followed by 10 mM IAA for 2 h; progressively increased GUS activity in 7 d old seedlings treated with (n) 0.5 mM, (o) 5 mM, and (p) 50 mM IAA for 2 h. Bars ¼ 1 mm.
(37% and 43% of that in the wild type, respectively) were chosen for the following assay (Figure 3B). Influence on root elongation caused by IAA was employed to check the response of transgenic plants to auxin. On unsupplemented medium, elongation of transgenic seedling roots was almost identical to the wild type and control vector plants. On medium supplied with IAA over a concentration range of 0.1–1,000 nM, the root July 2014 | Volume 56 | Issue 7 | 635–647
growth in AREP1 RNAi transgenic plants was more severely influenced by IAA gradient than that of wild type. For example, when 0.1 nM IAA was added, root elongation was induced up to 20% longer in RNAi transgenic seedlings, while the elongated length is not more than 10% in wild type. Contrarily, when 10 nM IAA was supplemented, root elongation inhibition reached up to 55% in RNAi transgenic seedlings, whereas it reached only www.jipb.net
AREP1 regulates root development in Arabidopsis
639
Figure 3. Generation and identification of auxin‐responsive endogenous polypeptide 1 (AREP1) transgenic plants (A) AREP1 RNAi construction. Sense and antisense AREP1 was inserted into pART27. (B, C) Transcript abundance of AREP1 in 10 independent AREP1 RNAi (B) and overexpressing transgenic lines (C).
30% in wild type. This finding suggests that suppressed AREP1 plants were more sensitive to IAA treatment (Figures 4A, S1). Mutants that accumulate a high abundance of free IAA have short, highly branched roots (Celenza et al. 1995), reflecting the inhibition of root elongation as well as the promotion of lateral root initiation by auxin. We then examined lateral root initiation and root elongation by exogenous auxin. When 3 d old seedlings grown on normal medium were transferred to media supplemented with 0.1 mM or 1 mM IAA for 4 d, RNAi transgenic plants developed almost two times more lateral roots than wild type and the vector plants did (Figure 4B, D). Correspondingly, RNAi transgenics moved to www.jipb.net
the medium with IAA added displayed a shorter primary root, as shown in Figure 4C. Lines 2 and 7 had a root length of 4.3 0.8 and 5.6 1.2 mm, respectively, compared with wild type plants grown on 0.1 mM IAA medium that had a root length of 8.4 1.1 mm (n ¼ 12). These results indicate that AREP1 RNAi plants are sensitive to IAA‐induced inhibition of root elongation and initiation of lateral roots. To examine whether AREP1 was required for other aspects of root development mediated by auxin, such as adventitious root initiation, we then measured adventitious root initiation in response to indolebutyric acid (IBA), which has been suggested to be an effective auxin for adventitious root July 2014 | Volume 56 | Issue 7 | 635–647
640
Yang et al.
Figure 4. Auxin response in auxin‐responsive endogenous polypeptide 1 (AREP1) RNAi plants (A) AREP1 RNAi seedlings are sensitive to root elongation inhibition by indoleacetic acid (IAA). Seven d old seedlings grown on medium supplemented with various concentrations of IAA were measured. Error bars represent SD (n ¼ 20). (B) Root phenotypes under various concentrations of IAA. Photos were taken after 4 d after transfer of 3 d old seedlings to the indicated medium. (C,D) Root elongation inhibition and lateral root induction by exogenous auxin. Data was recorded 4 d after transfer of 3 d old seedlings to the indicated media. Error bars represent SD (n ¼ 20). (E) Hypocotyl elongation of seedlings grown under 29 °C. Values are means SD. Mann‐Whitney U‐test significant at P < 0.01 between AREP1 RNAi plants and vector control.
initiation (Nordstrom et al. 1991). As shown in Figure 4B, transgenic plants produced more adventitious roots than did wild‐type plants under 1 mM IBA‐supplemented conditions. In addition, Arabidopsis plants grown at a high temperature (29 °C) accumulate free IAA with increased hypocotyl elongation and root elongation (Gray et al. 1998). To determine the response of AREP1 RNAi plants to endogenous IAA accumulation, we compared the root and hypocotyl length of seedlings grown July 2014 | Volume 56 | Issue 7 | 635–647
at 29 °C in the light and the dark, respectively. In the treatment of 29 °C, both the root and hypocotyl of wild‐type and AREP1 RNAi seedlings elongated more rapidly. Although they showed almost identical root elongation in response to high temperature, the hypocotyls elongated more rapidly in RNAi transgenic plants, showing 20% increase in length compared to the length of wild‐ type plants grown in the dark (Figure 4E). Taken together, our results suggest that AREP1 is a negative regulator of auxin response. www.jipb.net
AREP1 regulates root development in Arabidopsis Reduction of AREP1 enhances the expression of several auxin‐responsive genes The molecular mechanism for auxin‐regulated root development has been the subject of several studies, but the underlying genetic pathway is still largely undefined. Considerable evidence indicates that auxin promotes SCFTIR1‐dependent degradation of AUX/IAA proteins, resulting in diverse downstream effects associated with correct differentiation and initiation of root development (Gray et al. 2001). Because the above results suggest that AREP1 plays a role in root growth and in the response to auxin, we wished to elucidate whether the disruption of AREP1 affects auxin signal transduction. We then examined the expression of auxin‐ responsive Aux/IAA, GH3, and SAUR family members (Gil et al. 1994; Tian and Reed 1999; Takase et al. 2004). Real‐time PCR results showed that the expression of IAA3, IAA7, IAA17, GH3.2, GH3.3, and SAUR‐AC1 were upregulated by five to eight times in wild‐type roots after the addition of IAA (Figure 5). In contrast, the induction of these genes was apparently higher in the roots of AREP1 RNAi seedlings than in wild‐type. Under normal conditions, the expression levels of these auxin‐ responsive genes were almost identical (IAA7, SAUR‐AC1) or no
641
more than four times (IAA3, IAA17, GH3.2, GH3.3) higher in RNAi seedlings, while in the presence of exogenous IAA, gene expression levels reached up to 10–20 fold increase in RNAi seedlings, which showed more significant induction compared to that in wild‐type. These findings are in accordance with the downregulation of AREP1 resulting in hypersensitive phenotypes in response to auxin, and indicate that knockdown of AREP1 activated the auxin signaling pathway. Increased AREP1 expression negatively affects auxin response Given that a decrease in the levels of AREP1 mRNA amount has dramatic effects on root development, we wanted to determine if increase in the AREP1 transcript abundance has an opposite effect on root growth. Transgenic plants expressing AREP1 cDNA under the control of the 35S promoter were generated, and 10 independent lines were further examined. Lines 1 and 5, which showed relatively high AREP1 expression, were used for further analysis (Figure 3C). Under normal growth conditions, no obvious phenotypic differences in root development were observed between overexpression plants and wild‐type. When exogenous auxin was added, both
Figure 5. Relative mRNA levels of IAA3, IAA7, IAA17, GH3.2, GH3.3, and SUAR‐AC1 in RNAi plants Seven d old seedlings were subjected to indoleacetic acid (IAA) treatment for 24 h. Root RNA was used for real‐time polymerase chain reaction. Expression levels were normalized to ACTIN2. Each data point is a mean of three replicates and error bars represent SE of means (An‐2, An‐7, two independent auxin‐responsive endogenous polypeptide 1 (AREP1) RNAi lines). CK, cytokeratin; WT, wild type. www.jipb.net
July 2014 | Volume 56 | Issue 7 | 635–647
642
Yang et al.
Figure 6. Auxin response in auxin‐responsive endogenous polypeptide 1 (AREP1) overexpressing plants (A) Root elongation of seedlings grown on medium supplemented with various concentrations of indoleacetic acid (IAA). Root length of 7 d old seedlings were standardized against growth on unsupplemented medium. Error bars represent SD (n ¼ 20). (B) Root phenotypes under various concentrations of IAA. Photos were taken after 4 d after transfer of 3 d old seedlings to the indicated medium. (C,D) Lateral root number and primary root length of seedlings. Data was recorded 4 d after transfer of 3 d old seedlings to the indicated medium. Error bars represent SD (n ¼ 20). Values are means SD. Mann‐Whitney U‐test significant at P < 0.05 between AREP1 overexpressing plants and vector control. WT, wild type.
primary and lateral root growth showed enhanced tolerance in plants overexpressing AREP1 (Figures 6, S1). The transgenic seedlings grown on medium supplied with IAA over a concentration from 0.1 nM to 1 mM showed slightly longer primary root length (Figures 6A, S1). When 3 d old seedlings grown on normal medium were transferred to media supplemented with 0.1 or 1 mM IAA for 4 d, as shown in Figure 6(B–D), in comparison with the observation in the wild‐ type, lateral root initiation was 10% or 18% less (Figure 6C) and primary root elongation was 23% or 17% greater (Figure 6D) in AREP1 overexpression lines in response to 0.1 or 1 mM IAA, respectively. We further examined the expression of auxin‐ responsive genes. Under normal growth and auxin treatment conditions, expression of these auxin‐responsive genes IAA7, July 2014 | Volume 56 | Issue 7 | 635–647
IAA17, GH3.2, and SAUR‐AC1 was repressed to some extent in overexpression lines (Figure 7). These results suggest that enhancement of the expression of AREP1 has negative effect on auxin signaling response.
DISCUSSION The mechanism for auxin perception has been the subject of a larger number of studies, producing a notable increase of the components responsible for auxin sensing. Recently, several peptides have been found to play crucial roles in plant development related to auxin. For example, the CLEL (CLV3/ ESR‐related) peptide family controls the pattern of root growth www.jipb.net
AREP1 regulates root development in Arabidopsis
643
Figure 7. Expression of IAA3, IAA7, IAA17, GH3.2, GH3.3, and SUAR‐AC1 in auxin‐responsive endogenous polypeptide 1 (AREP1) overexpressing plants Seven d old seedlings were subjected to indoleacetic acid (IAA) treatment for 24 h. Root RNA was used for real‐time polymerase chain reaction. Expression levels were normalized to ACTIN2. Each data point is a mean of three replicates and error bars represent SE of means (Sn1 and Sn5 are two independent AREP1 overexpressing lines). CK, cytokeratin; WT, wild type.
and lateral root development (Meng et al. 2012), and GLVs (GOLVEN) function in the formation of auxin gradients and alter the reorientation of shoots and roots after a gravity stimulus (Whitford et al. 2012). These findings highlight the essential roles of peptide in auxin‐mediated root architecture. Here, we identified a novel peptide‐encoding gene, AREP1, which was not annotated in The Arabidopsis Information Resource. Because the peptides are encoded by short sequences, many peptide‐encoding genes are missed during annotation of genomes (Lease and Walker 2006). AREP1 was located between At1g01320 and At1g01340, the detected transcript of AREP1 and the AREP1‐GFP fusion protein that was observed from both western blotting and GFP fluorescence indicated that the putative peptide‐encoding gene AREP1 is functional in vivo. Auxin‐responsive elements (Hagen and Guilfoyle 2002) in its promoter sequence and the expression profile induced by auxin suggest a functional link between AREP1 and auxin. The subcellular localization of AREP1 further revealed the response of its native promoter to IAA treatment, which showed stronger GFP fluorescence in the nucleus and the cytosol when 10 nM IAA was added (Figure 3), while no fluorescence was observed under normal conditions, indicating the response of AREP1 to auxin. Moreover, expression analysis by real‐time PCR and GUS staining revealed that AREP1 is primarily expressed in www.jipb.net
cotyledons, leaf tips and margins, and the root apex, as well as in the shoot apical meristem, similar to the tissue‐specific expression patterns of several small peptide genes involved in auxin signaling, such as PSK5 (Kutschmar et al. 2009), GLV2 (Whitford et al. 2012), and CLE family (Whitford et al. 2012). It has been well documented that auxin is accumulated during seed germination. The cotyledon‐derived auxin is exported to the shoot apical meristem or the leaf primordium, and then transfers to the leaf tips and the margins (Avsian‐Kretchmer et al. 2002). Auxin synthesized to some extent in the roots as well. Our results indicated that the expression pattern of AREP1 is in agreement with endogenous auxin distribution, suggesting that AREP1 participates in the auxin‐regulated plant development process. Considering the accordant distribution of AREP1 and the endogenous auxin during plant different developmental stages, we further carried out auxin assay to evaluate the influence of AREP1 on auxin biosynthesis. The RNAi and over‐ expresser lines showed identical levels of free IAA, indicating that AREP1 has no direct influence on endogenous auxin accumulation (Figure S2). This result is consistent with the fact that no phenotype observed in the absence of exogenous auxin in AREP1 over‐ or down‐expressed plants. When exogenous auxin was added, our root elongation assay July 2014 | Volume 56 | Issue 7 | 635–647
644
Yang et al.
revealed that AREP1 RNAi plants were hypersensitive to IAA treatment, while overexpressing lines were hyposensitive, coupled with corresponding primary root elongation and lateral root initiation. Accordingly, the essential components involved in the IAA signaling pathway were also induced in RNAi plants and their activity reduced in overexpression plants, suggesting that AREP1 negatively mediates the auxin signaling response during the process of plant root development. The central role of auxin in orchestrating final root architecture has been highlighted by a large number of evidences (Overvoorde et al. 2010). An elevation of endogenous auxin promotes Aux/IAA proteins binding to the SCFTIR1 E3 ligase complex, resulting in the ubiquitination and degradation of Aux/IAA proteins by the 26S proteasome. The ARFs are consequently released and activate the downstream GH3, SAUR, and other auxin‐responsive genes (Figure 8, black arrowheads). AREP1 can be induced strongly by auxin and act as a negative regulator to repress the expression of the downstream auxin‐responsive genes including GH3.2, GH3.3, and SAUR‐AC (Figure 8, red arrowheads). A reduction of AREP1 in the RNAi transgenic plants leads to increased expression of auxin‐responsive genes and auxin hypersensitivity. Whereas the repressors of auxin signaling pathway (including IAA3, 7, 17), were also induced in AREP1 RNAi plants. As described above, Aux/IAA proteins are not stable and auxin
promotes their degradation. It is hard to simply define the positive or negative impact of AREP1 on AUX/IAA proteins here, for we can only detect the transcript abundance rather than the amount of the AUX/IAA proteins in this study. It is possible that AREP1 may play a positive role in the degradation of AUX/ IAA proteins (Figure 8, red dotted lines), and there may be a feedback regulation of AUX/IAA in the transcription– translation activation as generally reported for many other proteins. However, a functional model for AREP1 action in auxin response, explaining how AREP1 is transcriptionally activated by auxin and act as a negative‐feedback regulator to affect the expression of auxin‐responsive genes and suppress auxin responses, needs further determination. Promoter analysis indicated that 1 auxin‐responsive element, 1 MYB‐binding site, and 2 WRKY‐binding sites were located in the 1 kb region upstream of the AREP1 gene (highlighted by blue, yellow, and green respectively, in Figure 1A). Recent studies have suggested that several MYB and WRKY family members are involved in the auxin pathway and in the regulation of root development (Shin et al. 2007; Yu et al. 2010). We therefore supposed a potential link among AREP1, MYB, and WRKY transcription factors, and then detected the expression level of AREP1 in the mutant of WRKY75 and MYB77, both of which were reported to participate in auxin‐mediated root development (Shin et al. 2007; Yu et al. 2010). No significant difference of AREP1 transcript was detected in wild types, wrky75, and myb77. However, a reduced amount of AREP1 was notable in WRKY75 overexpression lines (Figure S3), which indicated a potential regulatory role of WRKY75 on AREP1 with respect to auxin response. Given that WRKY75 overexpression and AREP1 RNAi plants display similar auxin‐hypersensitive phenotype, it would be reasonable that the expression of AREP1 was suppressed in WRKY75 overexpressing plants. Further analysis is needed to determine the interaction and combinatory role of them for auxin response in Arabidopsis.
MATERIALS AND METHODS Plant materials and growth conditions Arabidopsis thaliana (accession Columbia, Col‐0) seeds were surface‐sterilized with 20% (v/v) bleach for 15 min and washed three times with sterile distilled water. They were then cultured for 2 weeks in a half Murashige‐Skoog (MS) medium (0.7% agar, w/v), then transferred to soil under a 16 h photoperiod at 22 °C.
Figure 8. Hypothetical model for the role of auxin‐responsive endogenous polypeptide 1 (AREP1) in auxin signaling pathway Indoleacetic acid (IAA) promotes the ubiquitination and degradation of auxin (Aux)/IAA proteins to release the ADP ribosylation factors (ARFs). Free ARFs consequently activated the downstream GH3, SAUR, and other auxin‐responsive genes (black arrowheads, Teale et al. 2006). AREP1 was induced by auxin and acted as a negative regulator to repress the expression of the downstream auxin‐responsive genes (red arrowheads). July 2014 | Volume 56 | Issue 7 | 635–647
Plasmid construction Vectors used for plasmid construction included pMD‐19T (Takara, Kyoto, Japan), pBI121 for AREP1 overexpressing construct, pART27 for AREP1 RNAi construct, and pZH01 which contained a GUS reporter gene. A 120 bp fragment (predicted ORF of AREP1) was PCR‐amplified from Arabidopsis genomic DNA, using specific primers for AREP1 (50 ‐TTTTAGGGCCTCTAAAGTCGTT‐30 and 50 ‐ACTGGGCAGTTAAGTTACCATTT‐30 ) then cloned into pMD‐19T Vector (Takara, Kyoto, Japan). The sequence of the amplified DNA fragment was verified by sequencing. A Xba1‐SalI fragment from pT‐AREP1 containing the AREP1 sequence was then subcloned into the XbaI and SalI sites of modified pBI121 between the CaMV 35S promoter and www.jipb.net
AREP1 regulates root development in Arabidopsis the nitric oxide synthase 30 ‐poly(A) signal to generate the AREP1 overexpressing construct. For the AREP1 RNAi construct, a 120 bp fragment of sense and antisense AREP1 was subcloned from pH annibal, as shown in Figure 3A. An 800 bp AREP1 promoter region was amplified from Arabidopsis genomic DNA by PCR using the specific forward primer 50 ‐TTGCGGCCGCAATGAAAGATCCGGAAAGTGTAATTT‐30 and the 50 ‐TTTCTAGAGTTTCTTTGTTTCAAAGGAAAAGTT‐30 , which contain a NotI‐specific reverse primer and an XbaI restriction site, respectively. The PCR fragment was digested with NotI and XbaI, and was inserted in the frame upstream of the GUS reporter gene in pZH01 vector. Transformations of plant were performed as described by Clough and Bent (1998), and T2 transformants of the transgenic plants were used in all experiments unless otherwise indicated. GUS staining Glucuronidase activity was assayed according to the method of Chen et al. (2012). Seedlings and tissues were gently fixed by incubation in 90% acetone on ice for 20 min and were then transferred into staining solution containing 5 mmol sodium phosphate (pH 7.0), 0.5 mmol K3Fe (CN)6, 0.5 mmol K4Fe(CN)6, 0.1% v/v Triton X‐100 and 2 mmol X‐gluc (Sigma‐Aldrich, St Louis, MO, USA), vacuum infiltrated for 5 min, and incubated in darkness at 37 °C overnight, then washed with 70% ethanol. Protein localization and western blot analysis For GFP fusions driven by the promoter of AREP1, the 35S promoter in the vector pBI221 was replaced by a 1,478‐bp AREP1 promoter fragment, to construct AREP1:AREP1‐GFP fusion and AREP1:GFP in vector pBI221 (primers shown in Table S1). Transient protein expression in Arabidopsis protoplasts was performed as described by Abel and Theologis (1994). Localization assay was carried out 12 h after transformation, using a confocal laser‐scanning microscope as described elsewhere. Collecting Arabidopsis protoplast transiently expressing AREP1:AREP1‐GFP fusion or AREP1:GFP, respectively, for protein extraction, and western blot analysis using anti‐GFP, was performed as described by Xiong et al. (2013) with some modification. Briefly, total proteins were separated on a 10% sodium dodecylsulfate polyacrylamide gel electrophoresis gel, and then transferred to Immun‐Blot polyvinylidene difluoride membrane (Bio‐Rad, Hercules, CA, USA) at 110 V for 2 h. Following transfer, the membrane was then incubated with 1:10,000 dilution of GFP antibody for 2 h at room temperature. Incubated membranes were subsequently washed with 3 100 mL Tris‐buffered saline containing 1% (v/v) Tween‐20 (TBS‐T) for 10 min under constant rotational mixing. Secondary antibody incubation of membranes followed by 1:7,500 dilution goat antirabbit antibody conjugated with horseradish peroxidase (Sigma‐Aldrich, St Louis, MO, USA) in TBS‐T for 1 h at room temperature. Finally, the membrane was rinsed 4 10 min with TBS‐T, and then stained with 3,30 ‐ diaminobenzidine‐tetrachloride (Tiangen, Beijing, China) (Xiong et al. 2013). Stress tolerance tests Three d old seedlings were transferred to 1/2 MS agar plates supplemented with 0.1 mM, 1 mM IAA, and 1 mM IBA, respectively, and grown for 4 d at 22 2 °C with 16 h of light and 8 h of dark. Each assay was repeated three times. Number of lateral www.jipb.net
645
roots (>0.1 cm) was counted by using a microscope (XTL‐3A, AIRMA, Shenzhen, China) after the roots were stained in the GUS buffer solution. For root elongation assay, after 1 week of growth under light at 22 °C on medium supplemented with various concentrations of IAA, seedlings were removed from the agar, and the length of the primary root was recorded. All results were standardized against growth on unsupplemented medium. For hypocotyl elongation assay in dark‐grown Arabidopsis, length of hypocotyls was measured for 5 d old seedlings (1 d in the light, 4 d in the dark under 29 °C). Data were analyzed by SPSS (Chicago, IL, USA), and Table S2 shows the summary of P‐values among the transgenic, vector control, and wild‐type plants. Expression analysis For gene expression pattern assay, 3 and 7 d old seedlings as well as rosette leaves, roots, and stems of 21 d old Arabidopsis and mature siliques were harvested for RNA extraction. To test transcript abundance of AREP1 responding to auxin application, 7 d old seedlings grown on 1/2 MS medium were moved to 50 mL liquid MS medium containing 10 mM IAA for 0, 2, 4, 8, 12, 48, and 72 h. The primers used for real‐time PCR amplifications are listed in Table S1. For expression levels of the genes related to auxin signaling pathway, 7 d old seedlings were moved to 50 mL of liquid MS medium without sucrose with 1 mM IAA for 24 h, then the roots were harvested for RNA extraction. RNA was extracted by the use of RNAiso Plus kit (Takara). One microgram of total RNA was quantified using the Quantity one 1D Analysis software for reverse transcription (Bio‐Rad, Vilnius, Lithuania). Relative transcripts levels were determined using the iCycler IQ Real‐time PCR Detection System (Bio‐Rad) according to the manual QuantiTect SYBR Green PCR kit and analyzed by icycler real‐time detection system software (version 3.0). Expression levels were normalized using the threshold cycle values obtained for the ACTIN2 gene. All quantifications were made in duplicate on RNA samples obtained from three independent experiments. The primers used for real‐time PCR amplifications are listed in Table S3.
ACKNOWLEDGEMENTS This project research was funded by the National Natural Science Foundation of China (30971557, 30971816, and 31300996) and the Guangdong Natural Science Foundation (S2011010001433).
REFERENCES Abel S, Theologis A (1994) Transient transformation of Arabidopsis leaf protoplasts: A versatile experimental system to study gene expression. Plant J 5: 421–427 Avsian‐Kretchmer O, Cheng JC, Chen L, Moctezuma E, Sung ZR (2002) Indole acetic acid distribution coincides with vascular differentiation pattern during Arabidopsis leaf ontogeny. Plant Physiol 130: 199–209 Celenza JL, Jr., Grisafi PL, Fink GR (1995) A pathway for lateral root formation in Arabidopsis thaliana. Genes Dev 9: 2131–2142 Chapman EJ, Estelle M (2009) Mechanism of auxin‐regulated gene expression in plants. Annu Rev Genet 43: 265–285
July 2014 | Volume 56 | Issue 7 | 635–647
646
Yang et al.
Chen H, Je J, Song C, Hwang JE, Lim CO (2012) A proximal promoter region of Arabidopsis DREB2C confers tissue‐specific expression under heat stress. J Integr Plant Biol 54: 640–651
respective auxins and their conjugation with aspartic‐acid during adventitious root‐formation in pea cuttings. Plant Physiol 96: 856– 861
Chilley PM, Casson SA, Tarkowski P, Hawkins N, Wang KL, Hussey PJ, Beale M, Ecker JR, Sandberg GK, Lindsey K (2006) The POLARIS peptide of Arabidopsis regulates auxin transport and root growth via effects on ethylene signaling. Plant Cell 18: 3058–3072
Notaguchi M, Wolf S, Lucas WJ (2012) Phloem‐mobile Aux/IAA transcripts target to the root tip and modify root architecture. J Integr Plant Biol 54: 760–772
Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium‐mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 Friml J (2003) Auxin transport—shaping the plant. Curr Opin in Plant Biol 6: 7–12. Gao X, Guo Y (2012) CLE peptides in plants: Proteolytic processing, structure–activity relationship, and ligand–receptor interaction. J Integr Plant Biol 54: 738–745 Gil P, Liu Y, Orbovic V, Verkamp E, Poff KL, Green PJ (1994) Characterization of the auxin‐inducible SAUR‐AC1 gene for use as a molecular genetic tool in Arabidopsis. Plant Physiol 104: 777–784 Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M (2001) Auxin regulates SCFTIR1‐dependent degradation of AUX/IAA proteins. Nature 414: 271–276. Gray WM, Ostin A, Sandberg G, Romano CP, Estelle M (1998) High temperature promotes auxin‐mediated hypocotyl elongation in Arabidopsis. Proc Natl Acad Sci USA 95: 7197–7202 Guilfoyle T. (2007) Plant biology—Sticking with auxin. Nature 446: 621– 622 Guilfoyle TJ, Hagen G (2007) Auxin response factors. Curr Opin Plant Biol 10: 453–460 Hagen G, Guilfoyle T (2002) Auxin‐responsive gene expression: Genes, promoters and regulatory factors. Plant Mol Biol 49: 373–385 Hunt L, Bailey KJ, Gray JE (2010) The signalling peptide EPFL9 is a positive regulator of stomatal development. New Phytol 186: 609– 614
Overvoorde P, Fukaki H, Beeckman T (2010) Auxin control of root development. Cold Spring Harb Perspect Biol 2: a001537 Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat Methods 8: 785–786 Santner A, Estelle M (2010) The ubiquitin‐proteasome system regulates plant hormone signaling. Plant J 61: 1029–1040 Shin R, Burch AY, Huppert KA, Tiwari SB, Murphy AS, Guilfoyle TJ, Schachtman DP (2007) The Arabidopsis transcription factor MYB77 modulates auxin signal transduction. Plant Cell 19: 2440– 2453 Smith RS. (2008) The role of auxin transport in plant patterning mechanisms. PLoS Biol 6: 2631–2633 Takase T, Nakazawa M, Ishikawa A, Kawashima M, Ichikawa T, Takahashi N, Shimada H, Manabe K, Matsui M (2004) ydk1‐D, an auxin‐responsive GH3 mutant that is involved in hypocotyl and root elongation. Plant J 37: 471–483 Tan X, Calderon‐Villalobos LIA, Sharon M, Zheng CX, Robinson CV, Estelle M, Zheng N (2007) Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature 446: 640–645 Teale WD, Paponov IA, Palme K (2006) Auxin in action: Signalling, transport and the control of plant growth and development. Nat Rev Mol Cell Biol 7: 847–859 Tian Q, Reed JW (1999) Control of auxin‐regulated root development by the Arabidopsis thaliana SHY2/IAA3 gene. Development 126: 711– 721
Hunt L, Gray JE (2009) The signaling peptide EPF2 controls asymmetric cell divisions during stomatal development. Curr Biol 19: 864–869
Topping JF, Lindsey K (1997) Promoter trap markers differentiate structural and positional components of polar development in Arabidopsis. Plant Cell 9: 1713–1725
Katsir L, Davies KA, Bergmann DC, Laux T (2011) Peptide signaling in plant development. Curr Biol 21: R356–R364
Vogler H, Kuhlemeier C (2003) Simple hormones but complex signalling. Curr Opin Plant Biol 6: 51–56
Kutschmar A, Rzewuski G, Stuhrwohldt N, Beemster GT, Inze D, Sauter M (2009) PSK‐alpha promotes root growth in Arabidopsis. New Phytol 181: 820–831
Whitford R, Fernandez A, De Groodt R, Ortega E, Hilson P (2008) Plant CLE peptides from two distinct functional classes synergistically induce division of vascular cells. Proc Natl Acad Sci USA 105: 18625– 18630
Lease KA, Walker JC (2006) The Arabidopsis unannotated secreted peptide database, a resource for plant peptidomics. Plant Physiol 142: 831–838 Leyser O. (2010) The power of auxin in plants. Plant Physiol 154: 501– 505 Ljung K, Hull AK, Celenza J, Yamada M, Estelle M, Normanly J, Sandberg G (2005) Sites and regulation of auxin biosynthesis in Arabidopsis roots. Plant Cell 17: 1090–1104 Matsubayashi Y, Sakagami Y (1996) Phytosulfokine, sulfated peptides that induce the proliferation of single mesophyll cells of Asparagus officinalis L. Proc Natl Acad Sci USA 93: 7623–7627 Meng L, Buchanan BB, Feldman LJ, Luan S (2012) CLE‐like (CLEL) peptides control the pattern of root growth and lateral root development in Arabidopsis. Proc Natl Acad Sci USA 109: 1760– 1765 Ni DA, Wang LJ, Ding CH, Xu ZH (2001) Auxin distribution and transport during embryogenesis and seed germination of Arabidopsis. Cell Res 11: 273–278 Nordstrom AC, Jacobs FA, Eliasson L (1991) Effect of exogenous indole‐ 3‐acetic‐acid and indole‐3‐butyric acid on internal levels of the
July 2014 | Volume 56 | Issue 7 | 635–647
Whitford R, Fernandez A, Tejos R, Perez AC, Kleine‐Vehn J, Vanneste S, Drozdzecki A, Leitner J, Abas L, Aerts M, Hoogewijs K, Baster P, De Groodt R, Lin YC, Storme V, Van de Peer Y, Beeckman T, Madder A, Devreese B, Luschnig C, Friml J, Hilson P (2012) GOLVEN secretory peptides regulate auxin carrier turnover during plant gravitropic responses. Dev Cell 22: 678–685 Xiong X, Xu D, Yang Z, Huang H, Cui X (2013) A single amino‐acid substitution at lysine 40 of an Arabidopsis thalianaalpha‐tubulin causes extensive cell proliferation and expansion defects. J Integr Plant Biol 55: 209–220 Yu S, Ligang C, Liping Z, Diqiu Y (2010) Overexpression of OsWRKY72 gene interferes in the abscisic acid signal and auxin transport pathway of Arabidopsis. J Biosci 35: 459–471 Zhao Y (2010) Auxin biosynthesis and its role in plant development. Annu Rev of Plant Biol 61: 49 Zhao FY, Han MM, Zhang SY, Wang K, Zhang CR, Liu T, Liu W (2012) Hydrogen peroxide‐mediated growth of the root system occurs via auxin signaling modification and variations in the expression of cell‐cycle genes in rice seedlings exposed to cadmium stress. J Integr Plant Biol 54: 991–1006
www.jipb.net
AREP1 regulates root development in Arabidopsis
SUPPORTING INFORMATION Additional supporting information can be found in the online version of this article: Figure S1. Primary root elongation of seedlings grown on media supplemented with 0–10 nM indoleacetic acid (IAA) Primary root elongation of seedlings grown on media supplemented with 0 nM (A), 0.1 nM (B), 1 nM (C), 10 nM (D) IAA. Photos were taken after 7 d growth Figure S2. Indoleacetic acid (IAA) content measurement Two week old seedlings of wild‐type (col), auxin‐responsive endogenous polypeptide 1 (AREP1) RNAi (An2, An7), and overexpressors (Sn1, Sn5) grown on 1/2 Murashige–Skoog medium were weighed, and the auxin assay was carried out
www.jipb.net
647
using an enzyme‐linked immunoassay kit (HengYuan Biological Technology, Shanghai, China). Figure S3. Auxin‐responsive endogenous polypeptide 1 (AREP1) expression level was suppressed by WRKY75 overexpression Transcript of AREP1 was not altered in myb77 and wrky75 while significantly decreased in two independent WRKY75 overexpression lines. One microgram of RNA extracted from 7 d old seedlings of the identified myb77, wrky75, two independent WRKY75 overexpressing lines 3, 6, and wild‐type for reverse transcription (Bio‐Rad, Vilnius, Lithuania) with 30 oligo dT primer. Table S1. Primers for plasmid construction Table S2. Summary of P‐values among the transgenic, vector control, and wild‐type plants Table S3. Primers of auxin‐responsive genes for real‐time polymerase chain reaction (PCR)
July 2014 | Volume 56 | Issue 7 | 635–647
