An Elk transcription factor is required for Runx-dependent survival signaling in the sea urchin embryo.

HHS Public Access Author manuscript Author Manuscript

Dev Biol. Author manuscript; available in PMC 2017 August 01. Published in final edited form as: Dev Biol. 2016 August 1; 416(1): 173–186. doi:10.1016/j.ydbio.2016.05.026.

An Elk transcription factor is required for Runx-dependent survival signaling in the sea urchin embryo Francesca Rizzo1,#, James A. Coffman2, and Maria Ina Arnone1 Maria Ina Arnone: [email protected] 1Biology

and Evolution of Marine Organisms, Stazione Zoologica Anton Dohrn, Napoli 80121,

Italy

Author Manuscript

2MDI

Biological Laboratory, Salisbury Cove, Maine, 04672 USA

Abstract

Author Manuscript

Elk proteins are Ets family transcription factors that regulate cell proliferation, survival, and differentiation in response to ERK (extracellular-signal regulated kinase)-mediated phosphorylation. Here we report the embryonic expression and function of Sp-Elk, the single Elk gene of the sea urchin Strongylocentrotus purpuratus. Sp-Elk is zygotically expressed throughout the embryo beginning at late cleavage stage, with peak expression occurring at blastula stage. Morpholino antisense-mediated knockdown of Sp-Elk causes blastula-stage developmental arrest and embryo disintegration due to apoptosis, a phenotype that is rescued by wild-type Elk mRNA. Development is also rescued by Elk mRNA encoding a serine to aspartic acid substitution (S402D) that mimics ERK-mediated phosphorylation of a conserved site that enhances DNA binding, but not by Elk mRNA encoding an alanine substitution at the same site (S402A). This demonstrates both that the apoptotic phenotype of the morphants is specifically caused by Elk depletion, and that phosphorylation of serine 402 of Sp-Elk is critical for its anti-apoptotic function. Knockdown of Sp-Elk results in under-expression of several regulatory genes involved in cell fate specification, cell cycle control, and survival signaling, including the transcriptional regulator Sp-Runt-1 and its target Sp-PKC1, both of which were shown previously to be required for cell survival during embryogenesis. Both Sp-Runt-1 and Sp-PKC1 have sequences upstream of their transcription start sites that specifically bind Sp-Elk. These results indicate that Sp-Elk is the signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which actively suppresses apoptosis in the early embryo.

Author Manuscript

Correspondence to: Maria Ina Arnone, [email protected]. #Present address: Laboratory of Molecular Medicine and Genomics, Department of Medicine and Surgery, University of Salerno, Baronissi, Italy Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Appendix A. Supplementary Material Figure S1. Control of MASO injection experiments: comparison between SpElk MASO injected, control fluorescent MASO injected and uninjected embryos at 14, 16 and 18h of development. Figure S2. Temporal profile of expression of the genes analyzed by Q-PCR experiments reported in Fig. 6. Table S1. Number of embryo tested and phenotype obtained at blastula stage (20h) in the experiments of knock-down, rescue of SpElk morphants and overexpression of exogenous wild-type and base-substituted Sp-Elk mRNA. Table S2. Primers used for Q-PCR experiments on SpElk MASO injected embryos.

Rizzo et al.

Page 2

Author Manuscript

Keywords Sea urchin; embryo; Elk; ERK; apoptosis; Runx; PKC

1. Introduction

Author Manuscript

Apoptosis plays two major roles during development, sculpting tissues during morphogenesis and metamorphosis, and removing damaged or rogue cells (Lockshin and Zakeri, 2002). Apoptosis and proliferation are intimately linked (Alenzi, 2004), and the survival and proliferation of cells both become dependent on genomically-controlled intercellular signaling following the initial cleavage stage of animal development (Coffman, 2003, 2009; Kagoshima et al., 2007; Nimmo and Woollard, 2008; Robertson et al., 2013). Aberrant activities of key players in the complex signal pathways that control cell proliferation and survival can have catastrophic consequences (Pucci et al., 2000; Vermeulen et al., 2003).

Author Manuscript

The Ets-like (ELK) protein group, also named TCF (ternary complex factor, including Elk-1, SAP-1 and SAP-2/ERP/Net), represents a subfamily of Ets transcription factors (reviewed in Sharrocks, 2002; Shaw and Saxton, 2003; Treisman, 1994) implicated in regulation of cell proliferation (Sharrocks, 2001; Zhong et al., 2007), apoptosis (Townsend et al., 1999; Vickers et al., 2004), cell migration (Buchwalter et al., 2005), and cell fate determination (Beitel et al., 1995; Vanhoutte et al., 2001). The mammalian and fish ELK proteins contain four domains of high sequence and functional similarity: the ETS DNA-binding domain, the B-box, the D-domain and the C-domain, containing multiple S/TP motifs that act as sites for phosphorylation by MAP kinases and their subsequent regulation (Gille et al., 1995b; Janknecht et al., 1993; Marais et al., 1993). Phosphorylation of ELK proteins results in enhancement of both DNA-binding and transcriptional activation (reviewed in Sharrocks, 2002; Shaw and Saxton, 2003; Wasylyk et al., 1998). Except for the extensively studied Elk-1 homolog Lin-1 gene in C. elegans (Beitel et al., 1995; Guerry et al., 2007; Jacobs et al., 1998; Leight et al., 2005; Leight et al., 2015; Miley et al., 2004), little is known about the role of Elk transcription factors outside chordates.

Author Manuscript

In the sea urchin Strongylocentrotus purpuratus, a single Elk gene (Sp-Elk) is present and its pattern of expression during embryogenesis has been described (Rizzo et al., 2006). A genome wide analysis revealed that orthologues of the major genes implicated in the cell cycle and apoptosis are present in the sea urchin genome (Fernandez-Guerra et al., 2006; Robertson et al., 2006). Under normal circumstances apoptosis never occurs during cleavage and is rare from blastula to gastrula stages of normal sea urchin development (Vega Thurber and Epel, 2007). However, knockdown either of Sp-Runt-1, the single Runx transcription factor expressed during embryogenesis, or of Sp-PKC1, a serine-threonine kinase that is transcriptionally dependent on Sp-Runt-1 activity, leads to widespread apoptosis in the gastrula stage embryo (Dickey-Sims et al., 2005). Sp-Runt-1 is also required for expression of the mitogenic kinase Akt (Robertson et al., 2013), which in many contexts is also known to be anti-apoptotic, as well as for expression of several wnt genes (including the key endomesodermal genes wnt8 and wnt6) and cyclin D (Robertson et al., 2008), and is hence a

Dev Biol. Author manuscript; available in PMC 2017 August 01.

Rizzo et al.

Page 3

Author Manuscript

key transcriptional regulator of both pro-survival and mitogenic signaling during embryogenesis. In this study, we show that knockdown of Sp-Elk leads to widespread apoptosis in the early embryo, and that this correlates temporally with loss of Sp-Runt-1 and Sp-PKC1 expression. Furthermore, the Sp-Runt-1 and Sp-PKC1 genes both contain binding sites for Sp-Elk, suggesting that the latter promotes cell survival in part by both transcriptionally activating and cooperating with Runx in activating its pro-survival target genes.

2. Results 2.1 Sp-Elk expression during early embryonic development

Author Manuscript

The temporal and spatial expression patterns of Sp-Elk RNA have been previously analyzed (Rizzo et al., 2006). Sp-Elk transcripts are distributed throughout the embryo, but particularly enriched at mesenchyme blastula stage in the vegetal plate and at late gastrula stage in the endomesoderm and oral ectoderm. In order to define the exact time window when Sp-Elk becomes expressed in the sea urchin embryo, a detailed spatial and temporal expression analysis was performed by means of Q-PCR, western blot and immunohistochemistry (Fig. 1). Sp-Elk zygotic transcription starts around 10 hpf and peaks at 14 hpf (Fig. 1A), the zygotic protein starts to accumulate around 14 hpf (top inset in Fig. 1A) and is uniformly distributed in all embryo cells (Fig. 1B). 2.2 Morpholino antisense perturbation of Sp-Elk function

Author Manuscript

To define the role of Sp-Elk during sea urchin embryogenesis, a morpholino antisense oligonucleotide (MASO) complementary to the translational start site of Sp-Elk was injected into fertilized eggs. The efficacy of this synthetic inhibitor was tested using two strategies. Control and Sp-Elk MASO injected embryos (morphants) were analyzed by immunohistochemistry using polyclonal antibodies generated against the Sp-Elk protein (Fig 2, C1–2, D1–2). In the injected embryos, which show an aberrant phenotype, Sp-Elk protein is absent (Fig 2, D1–2). The second strategy uses a green fluorescent protein (GFP) construct, in which the Sp-Elk N-terminal region, containing the MASO target site, is fused in frame with GFP (Sp-Elk:GFP; Fig 2, F). As illustrated in Fig.2 (E1,E2), the Sp-Elk MASO very effectively blocks the translation of Sp-Elk:GFP mRNA, when injected together. The loss of Sp-Elk and GFP (Fig. 2, D2 and E2 respectively) expression from the injected embryos demonstrates that the Sp-Elk MASO effectively binds to its target sequence and blocks translation in vivo.

Author Manuscript

Embryos injected with Sp-Elk MASO appear normal during cleavage stages and early blastula stage (12–14 hpf; Fig. 2, compare A1 and B1; Fig. S1, A–C’), but thereafter develop numerous obvious defects and they never reach the gastrula stage. Embryos injected with a generic control morpholino develop normally (Fig. S1 C, C’, F, F’ and J, J’). At 16 hpf, the control embryos show the characteristic hollow ball shape, where the cells are arranged in a single layer around the blastocoel; instead about 20% (19/95) of the Sp-Elk morphants have an irregular shape, lack the organized epithelium and the blastocoel cavity is completely filled with cells (Fig. 2, B2; Fig S1, D–F’). The appearance of this aberrant phenotype


Rizzo et al.

Page 4

Author Manuscript

corresponds to the time of Sp-Elk protein maximum expression (Fig. 1). The Sp-Elk morphants continue their abnormal development until 18 hpf, when 60% (293/490 embryos, average value of 3 biological replicates) display an arrested development (Fig. 2, B3 and Fig. S1 H1) with abnormal nuclei (Fig. S1 H1’). The remaining 40% (197/490 embryos; Fig. S1 H2, H2’) shows a stronger phenotype; at around 21 hpf embryos undergo complete degeneration and disintegrate into a myriad of vesicles (Fig. 2, B4). This dramatic phenotype is a morphological indication of apoptosis.

Author Manuscript Author Manuscript

Apoptosis is characterized by an extensive fragmentation of the genomic DNA. The many breakpoints formed can be visualized by labeling free 3'-OH termini with modified nucleotides using TUNEL (terminal dUTP nick end labeling) reaction. The control embryos show only few apoptotic cells (1–5 cells/embryo at early blastula stage), consistent with earlier reports (1–5 cells/embryo at early blastula stage, Vega Thurber and Epel, 2007), whereas Sp-Elk morphants display a vast number of TUNEL positive cells (Fig 3, A1–2), confirming the presence of apoptosis. Since growth arrest and apoptosis are often associated with variations of cell proliferation (Blagosklonny, 2003; Vermeulen et al., 2003), embryos were pulse-labeled with bromodeoxyuridine (BrdU) to identify the dividing cells. BrdU incorporation was visualized by immunohistochemical staining. Positive nuclear staining is clearly detected in normal embryos, which are in a growing phase, whereas Sp-Elk morphants present a reduction of cells that are undergoing cell division, but not a complete block of cell cycle (Fig 3, B1–2). Changes in cell nuclei morphology characteristic for apoptosis are also evident: the apoptotic cell nuclei stain very brightly and the chromatin appears condensed into compact patches against the nuclear envelope (indicated by arrows and shown in the insets by magnification of the nuclei; Fig. 3, B2). Apoptosis was further confirmed by the observation that Sp-Elk morphants contain elevated levels of activated caspase-6 (Fig. 3; compare images C2 and C4 with controls C1 and C3). The caspasecascade system plays vital roles in the induction, transduction and amplification of intracellular apoptotic signals (Fan et al., 2005). Caspase-6 is a major apoptotic executioner; it is responsible for the cleavage of the nuclear lamin scaffold proteins, resulting in collapse of the nucleus (Fernandes-Alnemri et al., 1995; Srinivasula et al., 1996; Takahashi et al., 1996). Sp-Elk morphants at 16 hpf show an extensive activation of caspase-6 (in green), but the nuclear structure (in red) is still visible (Fig 3, C2). Four hours later caspase-6 staining is still very strong, however it is impossible to distinguish the nuclei, which are now fragmented (Fig 3, C4). 2.3 Phosphorylation is required for Sp-Elk function

Author Manuscript

ELK subfamily proteins are phosphorylated by MAP kinase pathways at a cluster of S/TP motifs at their carboxy terminus. In particular, Serine 383 phosphorylation of human Elk-1 is critical for its DNA-binding activity and transcriptional activation properties (review in Sharrocks, 2002; Treisman, 1994). Sequence analysis showed that in Sp-Elk Serine 402 (S402) corresponds to this important phosphoacceptor site (Fig. 4 A). In vitro studies carried out on a recombinant form of Sp-Elk revealed that S402 is efficiently phosphorylated by ERK1 kinase (Fig. 4B) and its phosphorylation strengthens DNA target site binding (Fig. 4C). A commercial antibody targeted to phosphorylated Serine 383 of human Elk-1 recognizes bacterial Sp-Elk phosphorylated in vitro by ERK1 (Fig. 4B). Moreover, the same


Rizzo et al.

Page 5

Author Manuscript

antibody, used in immunohistochemistry assays, identifies the phosphorylated protein in all nuclei of the early blastula (Fig. 4E), while it appears confined at the tip of archenteron of the early gastrula (Andrikou et al., 2015), a region in which the activated form of ERK kinase is strongly expressed (Fernandez-Serra et al., 2004; Rottinger et al., 2004).


To test the importance of phosphorylation in vivo, the serine phosphoacceptor residue of SpElk was substituted, by site directed mutagenesis, with an aspartic acid (Sp-ElkS402D) or alanine residue (Sp-ElkS402A) (Fig. 4D). The introduction of a constitutive negative charge was designed to bypass the requirement for phosphorylation. Conversely, the conversion of the phosphoacceptor residue into alanine should produce an inactive or weak dominantnegative form (Brunner et al., 1994). The wild-type (wt) and the mutant forms of Sp-Elk were cloned starting from the second methionine (M2), to avoid annealing of the Sp-Elk MASO, and a V5 tag was inserted before the stop codon (Fig 4D, 4F). The mRNAs of SpElk-wt and two phosphorylation mutants were injected alone or in combination with the SpElk MASO in sea urchin fertilized eggs. The injected embryos can be divided into four phenotypic classes (Fig 5 D and Table S1): normal blastula (phen. 1, e.g., Fig. 5 A1, A5, A6, A8), mildly abnormal (phen. 2, e.g., Fig. 5 A3), strongly abnormal (phen. 3, e.g., Fig. 5 A2, A4), and disaggregated (phen. 4, e.g., Fig. 2 B4) embryos. As in previous experiments, SpElk morphant embryos show two phenotypes: 60% are strongly abnormal and 40% are completely disaggregated. When Sp-Elk-wt mRNAs are injected with Sp-Elk MASO a partial rescue of the normal phenotype (38%) is observed; the number of embryos into phenotypic classes 3 and 4 is reduced (24% and 16%, respectively) and a new class of mildly abnormal embryos appears (22%). This new phenotypic class is characterized by embryos with minimally abnormal shape, coelomic cavity partially filled of cells and a negligible activation of caspase-6 (Fig 5 A3, B3). If the Sp-Elk-wt mRNAs are injected alone the embryos are completely normal (Fig 5 A6, B6). It is possible that the overexpression of Sp-Elk does not generate abnormal phenotypes because a negative feedback loop regulates its expression (see below): the introduction of exogenous mRNAs blocks the endogenous transcription and equilibrium is reached.

Author Manuscript

When Sp-ElkS402A mRNAs are co-injected with Sp-Elk MASO, Sp-Elk function is minimally rescued: the number of embryos strongly abnormal and disaggregated is only slightly reduced as compared to Sp-Elk MASO injected embryos (50% and 35%, as compared to 60% and 40%; Fig. 5 D). However 10% mildly abnormal and 5% completely normal embryos (Fig. 5 A4, B4, E), two phenotypic classes absent in the Sp-Elk morphants, are present. The results suggest that the Sp-ElkS402A mutant is able to carry out the Sp-Elkwt function but in a much less efficient way; indeed only 30% of embryos injected with SpElkS402A mRNA alone are normal (Fig. 5 D). It is thus possible to suppose that mutant A may be working as a weak dominant negative, which is also confirmed by phenotype of SpElkS402A mRNA injected embryos (Fig. 5 A7, B7): overexpression of Sp-ElkS402A produces a phenotype that is similar to that of the Sp-Elk morphants, albeit milder, with 30% embryos having a strongly abnormal phenotype (phen. 3) with a substantial activation of caspase-6 (Fig. 5 B7). Co-injection of Sp-ElkS402D mRNA with Sp-Elk MASO is able to rescue the normal phenotype in 44% of the embryos (Fig. 5 A5, B5). Of the remaining 56%, 25% are mildly


Rizzo et al.

Page 6

Author Manuscript

abnormal, 20% strongly abnormal and 11% disaggregated (Fig 5 D). Thus Sp-ElkS402D is more efficient than wild-type Sp-Elk in rescuing the morphants from apoptotic arrest. Overexpression of Sp-ElkS402D also permits normal development (Fig 5 A8, B8). All together these results strongly suggest that the apoptotic phenotype displayed by Sp-Elk morphants is specifically caused by knockdown of Sp-Elk, and that phosphorylation of serine 402 is important for the anti-apoptotic function of Sp-Elk. 2.4 Quantitative analysis of gene expression after Sp-Elk perturbation


Q-PCR was used to examine the effects of Sp-Elk knockdown on gene expression (Fig. 6). Several independent injection experiments were performed and blastula stage embryos were collected at different time points (16 and 20 hpf). For each gene tested, results are indicated as fold-differences in the transcript levels between experimental and control embryos (Fig. 6 A). The temporal expression patterns of all genes tested have been verified by Q-PCR (Fig. S2). Six transcription factor markers for the major territories of the embryo were tested: dri (deadringer, skeletogenic mesoderm and oral ectoderm, Amore et al., 2003); ets-1/2 (skeletogenic mesoderm); hnf6 (oral ectoderm, Otim et al., 2004); gatac (mesoderm, Davidson et al., 2002; Pancer et al., 1999); gcm (non-skeletogenic mesoderm, Ransick et al., 2002); and gatae (endomesoderm, Lee and Davidson, 2004). One of the genes whose activity is most dramatically affected is hnf6 (average −4.9 fold-difference at 16 hpf and −2.5 at 20 hpf), a transcription factor that is required early for the activation of PMC differentiation genes, and after gastrulation for the maintenance of the state of oral ectoderm specification (Otim et al., 2004). Expression levels of dri, another gene important for gastrula stage differentiation of oral ectoderm (Amore et al., 2003), are also diminished. The effects on these two genes are consistent with Sp-Elk expression in the oral ectoderm. Expression of gatac is also affected, but may be a secondary effect, as it is a target of hnf6 (Otim et al., 2004). Sp-Elk is also required for normal expression of ets1/2 and gatae. Q-PCR data also show that Sp-Elk expression is altered by its knockdown. The abundance of Sp-Elk transcripts increases when Sp-Elk translation is inhibited, and the effect increase with time (average 3.6 fold-difference at 16 hpf and 4.9 at 20 hpf; Fig. 6). Thus, a negative regulatory feedback loop is present, in which the Sp-Elk gene is subjected to repression by the Sp-Elk protein.

Author Manuscript

Elk subfamily proteins are known to play a primary role in regulating early response gene expression, such as c-fos (Gille et al., 1992; Hill et al., 1993; Hipskind et al., 1991) and egr-1 (Alexandropoulos et al., 1992; Ayadi et al., 2001; Mora-Garcia and Sakamoto, 2000; Qureshi et al., 1991; Rim et al., 1992). The egr-1 sea urchin homologue is expressed throughout early development in the ectoderm beginning with blastula stage (Materna et al., 2006). In absence of Sp-Elk function the expression of egr-1 was down-regulated in both the developmental stages tested (Fig. 6 A, B). The c-fos homologue has been identified in the sea urchin genome (Howard-Ashby et al., 2006a), but its expression is almost undetectable (below 200 transcripts per embryo) during the first 24 hpf (Fig. S2 g). However, the c-fos partner in the AP1 (activator protein-1) complex formation (review in Shaulian and Karin, 2002), the c-jun transcription factor, is expressed during early sea urchin embryogenesis (Howard-Ashby et al., 2006a). Probably during this phase c-jun exists in a homodimeric


Rizzo et al.

Page 7

Author Manuscript

form (Grondin et al., 2007). Data reported in Fig. 6 show that its expression is up-regulated in the Sp-Elk morphant embryos.

Author Manuscript

Since the Sp-Elk morphant phenotype shows growth arrest as well as apoptosis (Figs. 2 and 3), genes involved in cell cycle control were investigated. Four cyclins are down-regulated in the morphant embryos: three cyclins (A, B and D) have a reduced expression in both stages analyzed; cyclin E shows minor variation, and only at the later stage (Fig 6 A, B). Interestingly, cyclin D has an expression pattern similar to that of Sp-Elk; it is expressed globally starting from blastula stage and its mRNAs later become concentrated in the vegetal plate and in the ectoderm on the oral side of the embryo (Moore et al., 2002). The Cdk (cyclin-dependent kinase) inhibitor p21 is an important modulator of cell cycle and apoptosis (reviewed in Child and Mann, 2006; Dotto, 2000; Gartel and Tyner, 2002). Sp-Elk MASO injections led to reduction of p21 expression, −3.2 fold-difference at 16 hpf and −3.9 at 20 hpf. Loss of Sp-Elk had no significant effect on cdk4, wee1 and p53. It was recently shown that two genes, runt1 and PKC1, are required for cell proliferation and survival in the sea urchin embryo (Coffman et al., 2004; Dickey-Sims et al., 2005; Robertson et al., 2013; Robertson et al., 2008). Knockdown of either of these two genes leads to extensive apoptosis (Dickey-Sims et al., 2005), similar to what is observed with knockdown of Sp-Elk. In addition, runt1 expression pattern resembles that of Sp-Elk during the first 48 h of sea urchin embryogenesis (Robertson et al., 2002), albeit with a slightly later accumulation, peaking at late blastula stage (Fig. S2). As shown in Fig. 6 (A, B), depletion of Sp-Elk reduces the transcription levels of both runt1 and PKC1, and the effect increases at later stages (−4.1 fold-difference at 16 h and −5.2 at 20 h for runt1, and −3.0 fold-difference at 16 h and −4.0 at 20 h for PKC1).

Author Manuscript

2.5 Sequences from the promoter regions of Sp-Runt1 and Sp-PKC1 bind Sp-Elk

Author Manuscript

The promoters and upstream sequences (3000 bp) of Sp-Runt1 and Sp-PKC1 were analyzed for potential Sp-Elk binding sites. ETS proteins bind to similar sequences, about 10 nucleotides long, centered over a GGAA/T core sequence (Sharrocks et al., 1997). We identified 4 potential Sp-Elk binding sites in each of the two promoters (Fig. 7A), with similarity to the known Ets binding site Cy313 (Martin et al., 2001). These sites were tested for their ability to sequence-specifically bind Sp-Elk in an electrophoretic mobility shift assay (EMSA). As shown in Fig. 7B, Sp-Elk specifically binds the candidate target sequences PKC2 and Runt1 in vitro. Furthermore, DNA sequences from both the Sp-PKC1 and Sp-Runt-1 promoter regions were recovered 20 hr (late blastula stage) embryos by chromatin immunoprecipitation (ChIP) using the anti-Sp-Elk antibody (Fig. 7C), showing that these genes engage Sp-Elk in vivo.

3. Discussion 3.1 Role of Sp-Elk in sea urchin embryogenesis This study elucidated the expression and role of Sp-Elk gene during the early sea urchin development. Sp-Elk transcripts are distributed throughout the embryo, but particularly enriched at mesenchyme blastula stage in the vegetal plate and at late gastrula stage in the


Rizzo et al.

Page 8


endomesoderm and oral ectoderm, tissues associated with continued growth and cell proliferation (Kingsley et al., 1993). The targeted blockade of Sp-Elk function leads to growth arrest and extensive apoptosis throughout the blastula stage embryo. Starting from 16 hpf the embryos show an abnormal development associated with chromatin condensation, DNA damage, reduced cell proliferation and caspase-6 activation. Thus, following the initial cleavage stage of development, cells are programmed to die in the absence of Elk. Since Elk is a signal-responsive transcription factor, these results are consistent with the proposition that neither cell proliferation nor cell survival occur by default in post-cleavage stage development; rather, the proliferation and survival of cells becomes dependent on intercellular signaling (Raff, 1992). It can be speculated that the acquisition of such dependency was a key step in the early evolution of animals (Aktipis et al., 2015), providing a failsafe mechanism whereby the cellular drive to survive and reproduce became subjugated to genomic control in a multicellular context, thus allowing for development of complex form (Arenas-Mena and Coffman, 2015).

Author Manuscript

Our experiments show that Sp-Elk is required for normal expression of several cell cycle regulators: cyclins A, B, D, E and cyclin-dependent kinase inhibitor (cki) p21 are downregulated by loss of Sp-Elk translation (see Fig. 6). In addition, two genes previously shown to be critical for cell survival, Sp-Runt-1 and Sp-PKC1, are significantly under-expressed in the Sp-Elk morphant embryos. These two genes are essential for embryonic development, and are required globally to coordinate cell proliferation and differentiation. Knockdown of either Sp-Runt-1 or Sp-PKC1 leads to arrested development and extensive apoptosis (Coffman et al., 2004; Dickey-Sims et al., 2005), a phenotype very similar to that observed for Sp-Elk knockdown. An important difference in the aberrant phenotypes is the timing of appearance. In Sp-Runt-1 and Sp-PKC1 morphants, apoptosis appears at gastrula stage, whereas Sp-Elk morphants arrest earlier and many are completely disintegrated by late blastula stage. This is consistent with the temporal expression profiles of these genes, as SpElk accumulation precedes that of Sp-Runt-1.

Author Manuscript

Sp-Runt-1 was previously shown to be a direct activator of Sp-PKC1 (Dickey-Sims et al., 2005), and the knockdown and Q-PCR experiments reported here (Fig. 6) suggest that SpElk is an activator of both Sp-Runt-1 and Sp-PKC1 expression. The three genes thus constitute a feed-forward regulatory circuit (Fig. 8). This circuit actively promotes cell survival, as normal levels of Sp-PKC1 protein are essential to avoid caspase pathway activation and then apoptosis (Dickey-Sims et al., 2005). The presence of Elk binding sites in the promoters of both Sp-Runt-1 and Sp-PKC1 (Fig. 7) supports the proposed network. Sp-Elk also regulates itself, as inferred from the increase of Sp-Elk transcription when the Sp-Elk protein is not translated (Fig. 6). This negative regulatory feedback loop could be mediated directly by the Sp-Elk protein (indicated by thin blue lines in Fig. 8), but also indirectly by Sp-Elk downstream genes. Finally, the fact that knockdown of Sp-Elk causes apoptosis earlier than that caused by knockdown of either Sp-PKC1 or Sp-Runt-1 suggests that it regulates additional anti-apoptotic targets (indicated by a dashed blue line in Fig. 8). Protein kinase C and Runx are two important families of regulatory proteins broadly implicated in the control of cell proliferation, differentiation, transformation, and apoptosis (reviewed in Coffman, 2003; Martelli et al., 2006; Nakajima, 2006). Runx-mediated control


Rizzo et al.

Page 9

Author Manuscript

of PKC, besides in sea urchins, has been also described in humans (Hug et al., 2004). Mammalian Elk-1 has been frequently considered a downstream target of PKC (Cheng et al., 1999; Fernandez et al., 2000; Schinelli et al., 2001; Soh et al., 1999; Steinmetz et al., 2001; Uht et al., 2007), but recent studies revealed also a role of Elk-1 as a regulator of PKC expression. In human K562 chronic myelogenous leukemia (CML) cells, Elk-1 regulates PKCι transcriptional activation, which is required for Bcr-Abl-mediated resistance to apoptosis (Gustafson et al., 2004). In human hepatocellular carcinoma cells (HCC), the treatment with Elk-1 antisense oligonucleotides showed a significant reduction in the PKCα mRNA level, associated with reduced cell proliferation, cell migratory and invasive capabilities (Hsieh et al., 2006). All together, these observations suggest that Elk, Runx and PKC might be part of an evolutionarily conserved network that regulates cell proliferation and survival during animal development.

Author Manuscript

3.2 Activation of Sp-Elk by MAP kinase cascades

Author Manuscript

The mammalian ELK proteins are known to represent nuclear targets of signal transduction pathways (review in Buchwalter et al., 2004; Sharrocks, 2002). Their phosphorylation, mediated by both mitogen-activated (ERK) and stress inducible (JNK and p38) MAP kinase cascades, causes a conformational change that enhances their transcriptional activity (Gille et al., 1995a; Li et al., 2000; Sharrocks, 1995; Yang et al., 1999). Phosphorylation inhibits intramolecular interactions between the C- and the ETS domains and consequently increases DNA-binding affinity (Yang et al., 1999). Sp-Elk contains four conserved phosphorylation sites in the C-domain (Fig 4.2), and one of these, the Serine 402, is efficiently phosphorylated in vitro by ERK1 kinase. Similar to the mammalian proteins, phosphorylation of Sp-Elk stimulates the binding activity to the DNA target site (Fig. 4). Embryos overexpressing a partially inactive form of Sp-Elk (Sp-ElkS402A) show a phenotype similar but less severe to that of the embryos deprived of Sp-Elk function (Fig. 5 A6, B6 and D). In contrast, the Sp-Elk active form (Sp-ElkS402D) is able to rescue the cell survival in about half of the Sp-Elk morphant embryos (Fig. 5 A5, B5 and D), whereas the wild type mRNA is less efficient in the rescue of the normal phenotype (Fig. 5 A3, B3 and D). Taken together these results suggest that phosphorylation of Sp-Elk on Serine 402 is an important event for its activation and function. 3.3 Conservation and differences of sea urchin and mammalian Elk proteins

Author Manuscript

Significant sequence similarity is observed between Sp-Elk and mammalian subfamily members: three of the four functional domains exhibit high similarity (ETS-domain, 90%; D-domain 58%; C-domain 51%). The fourth domain, the B-box, which is required for ElkSRF-SRE ternary complex formation, shows very low levels of conservation. The Elk-1 Bbox forms an inducible α-helix, which presents a hydrophobic face for interaction with SRF. Alanine scanning mutagenesis revealed that four hydrophobic residues (Y153, Y159, F162 and I164) play critical roles in this interaction in vitro, and are necessary for transcriptional activation in vivo (Ling et al., 1997). Three of these four amino acids in SAP-1 contribute substantially to the SAP-1–SRF interaction interface (Hassler and Richmond, 2001). Not one of these residues is conserved in Sp-Elk. Furthermore, the amino acid stretch that should correspond to the B-box contains two Proline residues that probably interfere in the α-helix formation. These data suggest functions of Sp-Elk that are independent from the ternary Dev Biol. Author manuscript; available in PMC 2017 August 01.

Rizzo et al.

Page 10

Author Manuscript

complex formation. This hypothesis is also confirmed by in vitro binding assay, in which the full-length Sp-Elk protein has been tested together with the human SRF and no interactions have been observed (A.D. Sharrocks, personal communication). Probably, the molecular mechanism of interaction between these two proteins evolved only after emergence of vertebrates. The SRF gene has been identified in the sea urchin genome (SPU_027774) however, and shows constant expression (< 900 transcripts per embryo) during the first 48 h of development (Howard-Ashby et al., 2006a). At present, there is no additional information about the domain of expression and the function of this gene during sea urchin development.

Author Manuscript

An important element of conservation between Sp-Elk and mammalian Elk-1 is the role of these two proteins in the processes of cell proliferation and apoptosis. In human cells the induction of a dominant negative form of Elk-1, Elk-En, blocks cellular proliferation and initiates cell cycle arrest (Vickers et al., 2004). This phenotype, similar to that obtained in the Sp-Elk knockdown in sea urchin embryos, suggests conserved regulatory mechanisms between human and sea urchin, although with several differences. An important difference concerns the role of SRF: in human cells Elk-1 works in collaboration with SRF, promoting cell cycle entry and proliferation (Vickers et al., 2004), whereas Sp-Elk, lacking the B-box, probably has an autonomous function. Thus the regulatory functions of Elk defined by its DNA target sequences appear to be more conserved than the protein-protein interactions that it engages to execute those functions.

Author Manuscript

Loss of Sp-Elk function leads to underexpression of the cyclin-dependent kinase inhibitor (cki) p21, whereas, induction of Elk-En in human cells induces p21 expression. Up to now there is no information concerning p21 as a possible Elk direct target, but for this cki several functions have been proposed in cell cycle control, and opposing roles in regulation of apoptosis (Gartel, 2005). p21 facilitates active cyclin-Cdk complexes formation, thereby promoting cell cycle progression (Bagui et al., 2000; Cheng et al., 1999; LaBaer et al., 1997). In addition, p21 functions as inhibitor of apoptosis, interacting with pro-apoptotic molecules such as procaspase-3 (Suzuki et al., 1998) or the apoptosis signal-regulating kinase1 (ASK1) (Asada et al., 1999). However, in some cases p21 induces apoptosis. For example, overexpression of p21 enhances the cell death response to cisplatin in glioma (Kondo et al., 1996) and ovarian carcinoma cell lines (Lincet et al., 2000); and p21 potentiates MAPK-dependent apoptosis in hepatocytes (Qiao et al., 2002). In this study the reduction of p21 expression is associated with growth arrest and induction of apoptosis. It remains to be determined whether this loss of expression contributes to the apoptotic phenotype of Sp-Elk morphants.

Author Manuscript

ELK subfamily proteins regulate a wide range of genes, but their best characterized targets are the immediate early genes, which contain SRE sites and are regulated is SRF dependent manner (Treisman, 1990, 1992). Two of these genes have been identified in the sea urchin genome, egr-1 and c-fos, but only egr-1 is expressed during early embryogenesis (HowardAshby et al., 2006b; Materna et al., 2006; this work). In sea urchin embryos, egr-1 expression is slightly reduced in the absence of Sp-Elk protein. Therefore, egr-1 is unlikely to be a direct target of Sp-Elk.


Rizzo et al.

Page 11

Author Manuscript

In conclusion, these observations indicate that Sp-Elk is a signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which functions to actively suppress apoptosis during embryogenesis. It is possible that Elk proteins play an ancient and widely conserved role in the gene regulatory systems that evolved to render cell survival and proliferation dependent on intercellular signaling during animal development.

4. Methods 4.1 Animals and culture of embryos

Author Manuscript

Adult S. purpuratus were obtained from Pat Leahy (Kerckhoff Marine Laboratory, California Institute of Technology, USA). Spawning was induced by vigorous shaking of animals or by intracoelomic injection of 0.5 M KCl. Embryos were cultured at 15°C in Millipore filtered Mediterranean seawater (MFSW) diluted 9:1 in deionized H2O. 4.2 Molecular reagents, construct preparation and site directed mutagenesis

Author Manuscript

The cDNAs corresponding to the complete coding sequences of Sp-Elk, was obtained by screening arrayed cDNA libraries from S. purpuratus 20 h embryos (Cameron et al., 2000) following an established protocol (Rast et al., 2000). To construct the Sp-Elk:GFP plasmid, the 5’UTR and the first 94 bp downstream of the ATG codon were amplified by PCR using the primers ElkMU_BglII (GCAGATAGATCTACAGGCAACTAGTGGTCACAGA) and ElkMD_EcoRI (CGCATTGAATTCCGCGATCGAAGAAGTCTGA) on 20 h cDNA. Then the PCR product was digested with BglII and EcoRI and subcloned into the pBlueScript NR3 plasmid (Lemaire et al., 1995). The GFP coding sequence was that used by Arnone et al. (1997), and was subcloned into the NotI restriction site in frame downstream of the SpElk N-terminus fragment. Sp-Elk WT expression plasmids were constructed by subcloning into the pBlueScript NR3 plasmid (Lemaire et al., 1995) a 1.3 kb Dra to XhoI fragment containing the Sp-Elk coding sequence starting from the second methionine. A DNA fragment containing the V5 tag was digested from pcDNA3.1/V5-HisB (Invitrogen, Carlsbad, CA) with BamHI-BglII and cloned into the BglII restriction site downstream the Sp-Elk sequence. Each construct was checked by sequencing. To obtain the Sp-ElkS402D and Sp-ElkS402A mutant constructs, the AGC codon encoding serine in position 402 of SpElk was mutated to GAC or GCG by QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, Calif.) according to the manufacturer’s instructions and using the following oligonucleotides: S402Dup (CCACTTCTGGAGTACCCTAGACCCACTTACGCTTAGCCC);

Author Manuscript

S402Ddw (GGGCTAAGCGTAAGTGGGTCTAGGGTACTCCAGAAGTGG); S402Aup (CCACTTCTGGAGTACCCTAGCGCCACTTACGCTTAGCCC); S402Adw (GGGCTAAGCGTAAGTGGCGCTAGGGTACTCCAGAAGTGG). Mutations were confirmed by Sanger sequencing.


Rizzo et al.

Page 12

4.3 Morpholino antisense oligonucleotides (MASO) and mRNAs injections


The Sp-Elk MASO (CGCTTCCGACATTGTGATGATTCTG) obtained from Gene Tools (Pilomath, OR), and is targeted against the translation initiation site. A working solution of 100 µM of MASOs in 0.12 M KCl was injected into fertilized eggs (2 to 4 pl). In all experiments, as a negative control, embryos were injected with 100 µM of the standard control MASO (oligo end modified with 3′-Carboxyfluorescein, control-fluo MASO, Gene Tools) at equal or greater concentration and compared side-by-side with uninjected and MASO embryos. As for previous experiments (Andrikou et al, 2015) no delay of development or abnormal morphology was observed at any stage in the control-fluo MASO injected embryos (Figure S1). For mRNA injection, Capped synthetic mRNA was made with T3 RNA polymerase using mMESSAGE mMACHINE Kit (Ambion, Austin, USA), subsequently treating the RNA product with DNase I to remove DNA template. To remove unincorporated nucleotides the RNA was purified through a mini Quick Spin™ Column (Roche). The mRNA was checked by gel electrophoresis. mRNAs injection solutions were prepared in RNase-free H2O (Ambion) at mRNA concentrations of 200 ng/µl in the presence of 0.12 M KCl. Eggs were prepared and injected as described by Mao et al. (1996), using 0.12 M KCl injection solution as control. 4.4 Antibody production, western blot analysis and immunohistochemistry


Rabbit polyclonal anti-Sp-Elk antibodies were produced against a recombinant protein expressed in E. coli (Biopat, Milan, Italy) and affinity purified first using Protein GSepharose (Amersham Pharmacia Biotech, Upsala, Sweden) and then CNBr-activated Sepharose 4B (Amersham Pharmacia Biotech) coupled to the fusion proteins. For western blot, protein samples were boiled in the presence of NuPage LDS Sample Buffer. Samples were run on NuPage 4–12% Bis-Tris Gels (Invitrogen) at constant 200 V and transferred to nitrocellulose membrane Immobilon-P (Millipore, Bedford, MA). Proteins were blocked on nitrocellulose membrane by incubation in Blocking buffer (5% powder milk in PBS, 0.1% Tween20) for 1 h. The membranes were incubated overnight at 4°C with ones of the following primary antibodies: α-Sp-Elk (dilution 1: 1000), or α-P-Elk-1 (Santa Cruz Biotechnology, dilution 1: 1000), or α-V5 (Invitrogen, diluted 1:3000). The membranes were then washed three times with PBS, 0.1% Tween20 and incubated for 1 hour at room temperature with a 1:1000 dilution in Blocking buffer of horseradish peroxidase-conjugated goat anti-mouse or antirabbit IgG (Santa Cruz). Protein bands were visualized on HyperfilmECL films using either the ECLWestern blotting Detection Reagents (Amersham). For immunohistochemistry, developmental staged embryos were collected by gentle centrifugation, washed once with ASW, and fixed in paraformaldehyde 4% diluted in ASW, for 10 minute at RT then washed 3 times with ASW. To permeabilize the membrane 10 × pellet volumes of cold Methanol were added and incubated for 1 minute at 4°C and then washes 3 times with PBST. Fixed embryos were blocked in blocking solution (5% Goat Serum, 1× PBST and 1% DMSO) at RT for 1h. For α-Sp-Elk antibody (dilution 1:50), α-PElk-1 antibody (Serine-383, Santa Cruz Biotechnology, dilution 1:100), α-activated caspase 6 (Calbiochem, dilution 1:200) and α-V5 (Invitrogen, dilution 1:300), embryos were incubated with 5% goat serum in PBST overnight at 4°C. Then embryos were washed 3 times with PBST, and incubated for 1h at RT with the secondary antibody diluted in 5% goat serum in PBST, AlexaFluor 488 goat anti-rabbit or goat anti-mouse IgG (Molecular Probes, Dev Biol. Author manuscript; available in PMC 2017 August 01.

Rizzo et al.

Page 13

Author Manuscript

Eugene, Oregon). Embryos were washed with PBST and stored in glycerol 50% in PBS with Na Azide, and then examined by epifluorescence microscopy. 4.5 Chromatin immunoprecipitation (ChIP) ChIP using the anti-Sp-Elk antibody was performed on 20 hr blastula stage embryos as described in Dickey-Sims et al. (2005), using the SpPKC1 primers described in that study, and the following primers to amplify sequences upstream of the Sp-Runt-1 promoter region: CCTTGATGCAATAGCGGAATATGTCCAGTA (forward) and CACACAGCCAATGCTACACTGATGCAA (reverse). 4.6 BrdU labeling and terminal transferase-mediated dUTP nick end labeling (TUNEL) assay


Blastula stage embryos (16 h) were incubated in 300 µg/ml BrdU (Sigma-Aldrich; St. Louis, Missouri, USA) for 4 hours in artificial seawater (ASW) at 15°C then fixed in 4% formaldehyde in ASW for 90 min on ice, washed three times in ASW, they were treated with 2 M HCl on ice for 30 min, neutralized in 100 mM Tris, pH 9.5, 100 mM NaCl for 2 min on ice, and washed three times in PBST. BrdU was detected by staining with an AlexaFluor 647-conjugated anti-BrdU antibody (Molecular Probes, Eugene, Oregon, USA) diluted 1:20 in PBST and incubated overnight at 4°C. Digital images were collected using a Leica TCS SP2 confocal microscope. For TUNEL assay, late gastrula stage embryos (48 h) were fixed for 1 h in 4% paraformaldehyde at 4°C and washed for 1 h in PBST. Staining was performed using the In Situ Fluorescein Detection of Cell Death Kit from Roche (Indianapolis, Indiana, USA), following manufacturer’s instructions. The embryo nucleic acids were stained in a 1:1000 dilution of SYTO-83 (Molecular Probes) for 30 minutes, followed by rinsing with PBS to remove unbound dye. Experiments were performed on three biological replicates and 200 embryos were stained for each experimental point. Stained embryos were washed three times in PBST and examined with fluorescence microscope. 4.7 Quantitative polymerase chain reaction (Q-PCR)

Author Manuscript

Total RNA was extracted from embryos at various stages using Eurozol reagent (Euroclone, Celbio, Milan, Italy). Residual DNA was digested with DNase I using a DNA-free kit (Ambion, Austin, TX). First-strand cDNA was synthesized in a 50 µl reaction from 1 µg of total RNA using random hexamers and the TaqMan Reverse transcription Kit (Applied Biosystems). Specific primer sets (Table S2) for each gene were designed using the Primer3 program (Rozen and Skaletsky, 2000) (http://www.broad.mit.edu/cgi-bin/primer/ primer3_www.cgi). Primer sets were chosen to amplify products 100–200 bp in length. cDNA was diluted to a concentration of 1 embryo/µl. Reactions were performed in triplicate using the Chromo 4 real-time detector (BioRad, Hercules, CA) with SYBR Green chemistry (Applied Biosystems). Data for each gene were normalized against ubiquitin mRNA, which is known to be expressed at constant levels during the first 72 h of development (Nemer et al., 1991). Experiments in which ribosomal 18S RNA, or the combination of the two (geometrical mean) were used as normalization genes gave comparable results (data not shown). Primer efficiencies (i.e., the amplification factor for each cycle) were found to exceed 1.9. Calculations from QPCR raw data used the formula 1.9ΔCt, where 1.9 is the multiplier for amplification per PCR cycle, and ΔCt is the cycle threshold difference with Dev Biol. Author manuscript; available in PMC 2017 August 01.

Rizzo et al.

Page 14

Author Manuscript

ubiquitin found for that sample. Absolute quantification of the number of transcripts was obtained by using SpZ12-1 as an internal standard. The number of SpZ12-1 transcripts in embryos of the relevant stages had been measured earlier by RNA titration (Wang et al., 1995). 4.8 In vitro transcription and translation and phosphorylation of recombinant Sp-Elk

Author Manuscript

In vitro translated proteins were synthesized and 35S-labeled using the TNT coupled in vitro transcription/translation system (Promega) from Sp-Elk WT linearized construct under the control of a T3 promoter. 35S-labeled proteins were separated by NuPAGE 4–12% Bis-Tris Gel (Invitrogen) and identified by autoradiography. Recombinant Sp-Elk His-tagged protein was expressed in E. coli and purified Ni+2 affinity chromatography. 1µg recombinant protein was phosphorylated in a reaction that contained kinase buffer (4 mM MOPS; 1 mM EGTA; 0.2 mM DTT; 0.2 mM NaF; 15 mM MgCl2; 2mM DTT, 5 mM β-glycerol phosphate), 100 uM ATP, and 2ng/µl activated recombinant ERK1 kinase (Upstate Biotechnology, Lake Plaid, NY) in a 50ul reaction. 4.9 Gel retardation assay

Author Manuscript

Single-stranded purified oligonucleotides were annealed in a solution containing 0.125 M TRIS-HCl pH 7,4, NaCl 0.5 M. Annealing mixtures were heated to 95° C for 5 min and slowly chilled overnight to room temperature. About 100 ng of double-stranded oligonucleotide was 32P labeled with 5 U of Klenow fragment (3’–5’ exo-) (New England Biolabs, Beverly, MA) at 37°C for 1 h in 50 µl of a reaction mixture containing: 1× Klenow buffer (New England Biolabs), dTTP 1 mM, dGTP 1mM, 30 µCi [α32P]dATP (Amersham) and 30 µCi [α32P]dCTP (Amersham). Labeling mixtures were subsequently centrifuged through a G-25 Sephadex column to remove excess of unincorporated nucleotide. Gel retardation assays were performed by mixing 0.4 ng (about 5 × 105 cpm) of probe with 1 µl of in vitro synthesized Sp-Elk protein and 5 µg of poly(dI-dC)/poly(dI-dC) duplex in a buffer containing 20 mM HEPES (pH 7.9), 0.75 mM DTT, 57.5 mM KCl, 2.5 mM MgCl2, 0.05 mM EDTA and 10% glycerol. The binding reaction was performed on ice for 15 min and then the DNA-binding complexes were resolved by gel electrophoresis on an 8% polyacrylamide gel, 1× TBE with 300 V at 4° C. After 2–3 h run, gels were dried and exposed overnight to Biomax MS film. The sequences of oligonucleotides used are: Cy313F, 5’-GAGTATCAACAGGAAGTAGGT-3’ and Cy313R, 5’ACCTACTTCCTGTTGATACTC-3’.

Supplementary Material Author Manuscript

Refer to Web version on PubMed Central for supplementary material.

Acknowledgments The authors wish to thank Pat Leahy (KML, Caltech, Pasadena, CA) for providing adult S. purpuratus, Davide Caramiello for animal maintenance and Marco Borra for quantitative Real Time PCR. F.R. has been supported by a SZN PhD fellowship. Additional financial support was provided by from the NIGMS of the NIH (R01-GM070840 to J.A.C. and Institutional Development Awards to the MDI Biological Laboratory, under grant numbers P20GM104318 and P20-GM103423).


Rizzo et al.

Page 15

Author Manuscript

REFERENCES

Author Manuscript Author Manuscript Author Manuscript

Aktipis CA, Boddy AM, Jansen G, Hibner U, Hochberg ME, Maley CC, Wilkinson GS. Cancer across the tree of life: cooperation and cheating in multicellularity. Philophical Transactions of the Royal Society B Biological Sciences. 2015; 370 pii: 20140219. Alenzi FQ. Links between apoptosis, proliferation and the cell cycle. British journal of biomedical science. 2004; 61:99–102. [PubMed: 15250676] Alexandropoulos K, Qureshi SA, Rim M, Sukhatme VP, Foster DA. v-Fps-responsiveness in the Egr-1 promoter is mediated by serum response elements. Nucleic acids research. 1992; 20:2355–2359. [PubMed: 1594452] Amore G, Yavrouian RG, Peterson KJ, Ransick A, McClay DR, Davidson EH. Spdeadringer, a sea urchin embryo gene required separately in skeletogenic and oral ectoderm gene regulatory networks. Developmental biology. 2003; 261:55–81. [PubMed: 12941621] Andrikou C, Pai CY, Su YH, Arnone MI. Logics and properties of a genetic regulatory program that drives embryonic muscle development in an echinoderm. eLife. 2015; 4 Arenas-Mena C, Coffman JA. Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals. Developmental Dynamics. 2015; 244:11093–11201. Arnone MI, Bogarad LD, Collazo A, Kirchhamer CV, Cameron RA, Rast JP, Gregorians A, Davidson EH. Green Fluorescent Protein in the sea urchin: new experimental approaches to transcriptional regulatory analysis in embryos and larvae. Development (Cambridge, England). 1997; 124:4649– 4659. Asada M, Yamada T, Ichijo H, Delia D, Miyazono K, Fukumuro K, Mizutani S. Apoptosis inhibitory activity of cytoplasmic p21(Cip1/WAF1) in monocytic differentiation. The EMBO journal. 1999; 18:1223–1234. [PubMed: 10064589] Ayadi A, Zheng H, Sobieszczuk P, Buchwalter G, Moerman P, Alitalo K, Wasylyk B. Net-targeted mutant mice develop a vascular phenotype and up-regulate egr-1. The EMBO journal. 2001; 20:5139–5152. [PubMed: 11566878] Bagui TK, Jackson RJ, Agrawal D, Pledger WJ. Analysis of cyclin D3-cdk4 complexes in fibroblasts expressing and lacking p27(kip1) and p21(cip1). Molecular and cellular biology. 2000; 20:8748– 8757. [PubMed: 11073976] Beitel GJ, Tuck S, Greenwald I, Horvitz HR. The Caenorhabditis elegans gene lin-1 encodes an ETSdomain protein and defines a branch of the vulval induction pathway. Genes & development. 1995; 9:3149–3162. [PubMed: 8543158] Blagosklonny MV. Apoptosis, proliferation, differentiation: in search of the order. Seminars in cancer biology. 2003; 13:97–105. [PubMed: 12654253] Brunner D, Oellers N, Szabad J, Biggs WH 3rd, Zipursky SL, Hafen E. A gain-of-function mutation in Drosophila MAP kinase activates multiple receptor tyrosine kinase signaling pathways. Cell. 1994; 76:875–888. [PubMed: 8124723] Buchwalter G, Gross C, Wasylyk B. Ets ternary complex transcription factors. Gene. 2004; 324:1–14. [PubMed: 14693367] Buchwalter G, Gross C, Wasylyk B. The ternary complex factor Net regulates cell migration through inhibition of PAI-1 expression. Molecular and cellular biology. 2005; 25:10853–10862. [PubMed: 16314510] Cameron RA, Mahairas G, Rast JP, Martinez P, Biondi TR, Swartzell S, Wallace JC, Poustka AJ, Livingston BT, Wray GA, Ettensohn CA, Lehrach H, Britten RJ, Davidson EH, Hood L. A sea urchin genome project: sequence scan, virtual map, and additional resources. Proceedings of the National Academy of Sciences of the United States of America. 2000; 97:9514–9518. [PubMed: 10920195] Cheng M, Olivier P, Diehl JA, Fero M, Roussel MF, Roberts JM, Sherr CJ. The p21(Cip1) and p27(Kip1) CDK 'inhibitors' are essential activators of cyclin D-dependent kinases in murine fibroblasts. The EMBO journal. 1999; 18:1571–1583. [PubMed: 10075928] Child ES, Mann DJ. The intricacies of p21 phosphorylation: protein/protein interactions, subcellular localization and stability. Cell cycle (Georgetown, Tex. 2006; 5:1313–1319.


Rizzo et al.

Page 16

Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Coffman JA. Runx transcription factors and the developmental balance between cell proliferation and differentiation. Cell biology international. 2003; 27:315–324. [PubMed: 12788047] Coffman JA. Is Runx a linchpin for developmental signaling in metazoans? Journal of cellular biochemistry. 2009; 107:194–202. [PubMed: 19330799] Coffman JA, Dickey-Sims C, Haug JS, McCarthy JJ, Robertson AJ. Evaluation of developmental phenotypes produced by morpholino antisense targeting of a sea urchin Runx gene. BMC biology. 2004; 2:6. [PubMed: 15132741] Consales C, Arnone MI. Functional characterization of Ets-binding sites in the sea urchin embryo: three base pair conversions redirect expression from mesoderm to ectoderm and endoderm. Gene. 2002; 287:75–81. [PubMed: 11992725] Davidson EH, Rast JP, Oliveri P, Ransick A, Calestani C, Yuh CH, Minokawa T, Amore G, Hinman V, Arenas-Mena C, Otim O, Brown CT, Livi CB, Lee PY, Revilla R, Schilstra MJ, Clarke PJ, Rust AG, Pan Z, Arnone MI, Rowen L, Cameron RA, McClay DR, Hood L, Bolouri H. A provisional regulatory gene network for specification of endomesoderm in the sea urchin embryo. Developmental biology. 2002; 246:162–190. [PubMed: 12027441] Dickey-Sims C, Robertson AJ, Rupp DE, McCarthy JJ, Coffman JA. Runx-dependent expression of PKC is critical for cell survival in the sea urchin embryo. BMC biology. 2005; 3:18. [PubMed: 16076398] Dotto GP. p21(WAF1/Cip1): more than a break to the cell cycle? Biochimica et biophysica acta. 2000; 1471:M43–M56. [PubMed: 10967424] Fan TJ, Han LH, Cong RS, Liang J. Caspase family proteases and apoptosis. Acta biochimica et biophysica Sinica. 2005; 37:719–727. [PubMed: 16270150] Fernandes-Alnemri T, Litwack G, Alnemri ES. Mch2, a new member of the apoptotic Ced-3/Ice cysteine protease gene family. Cancer research. 1995; 55:2737–2742. [PubMed: 7796396] Fernandez-Guerra A, Aze A, Morales J, Mulner-Lorillon O, Cosson B, Cormier P, Bradham C, Adams N, Robertson AJ, Marzluff WF, Coffman JA, Geneviere AM. The genomic repertoire for cell cycle control and DNA metabolism in S. purpuratus. Developmental biology. 2006; 300:238–251. [PubMed: 17078944] Fernandez-Serra M, Consales C, Livigni A, Arnone MI. Role of the ERK-mediated signaling pathway in mesenchyme formation and differentiation in the sea urchin embryo. Developmental biology. 2004; 268:384–402. [PubMed: 15063175] Fernandez N, Caloca MJ, Prendergast GV, Meinkoth JL, Kazanietz MG. Atypical protein kinase Czeta stimulates thyrotropin-independent proliferation in rat thyroid cells. Endocrinology. 2000; 141:146–152. [PubMed: 10614633] Gartel AL. The conflicting roles of the cdk inhibitor p21(CIP1/WAF1) in apoptosis. Leukemia research. 2005; 29:1237–1238. [PubMed: 15946739] Gartel AL, Tyner AL. The role of the cyclin-dependent kinase inhibitor p21 in apoptosis. Molecular cancer therapeutics. 2002; 1:639–649. [PubMed: 12479224] Gille H, Kortenjann M, Thomae O, Moomaw C, Slaughter C, Cobb MH, Shaw PE. ERK phosphorylation potentiates Elk-1-mediated ternary complex formation and transactivation. The EMBO journal. 1995a; 14:951–962. [PubMed: 7889942] Gille H, Sharrocks AD, Shaw PE. Phosphorylation of transcription factor p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature. 1992; 358:414–417. [PubMed: 1322499] Gille H, Strahl T, Shaw PE. Activation of ternary complex factor Elk-1 by stress-activated protein kinases. Curr Biol. 1995b; 5:1191–1200. [PubMed: 8548291] Grondin B, Lefrancois M, Tremblay M, Saint-Denis M, Haman A, Waga K, Bedard A, Tenen DG, Hoang T. c-Jun homodimers can function as a context-specific coactivator. Molecular and cellular biology. 2007; 27:2919–2933. [PubMed: 17283046] Guerry F, Marti CO, Zhang Y, Moroni PS, Jaquiery E, Muller F. The Mi-2 nucleosome-remodeling protein LET-418 is targeted via LIN-1/ETS to the promoter of lin-39/Hox during vulval development in C. elegans. Developmental biology. 2007; 306:469–479. [PubMed: 17466968]


Rizzo et al.

Page 17


Gustafson WC, Ray S, Jamieson L, Thompson EA, Brasier AR, Fields AP. Bcr-Abl regulates protein kinase Ciota (PKCiota) transcription via an Elk1 site in the PKCiota promoter. The Journal of biological chemistry. 2004; 279:9400–9408. [PubMed: 14670960] Hassler M, Richmond TJ. The B-box dominates SAP-1-SRF interactions in the structure of the ternary complex. The EMBO journal. 2001; 20:3018–3028. [PubMed: 11406578] Hill CS, Marais R, John S, Wynne J, Dalton S, Treisman R. Functional analysis of a growth factorresponsive transcription factor complex. Cell. 1993; 73:395–406. [PubMed: 8477450] Hipskind RA, Rao VN, Mueller CG, Reddy ES, Nordheim A. Ets-related protein Elk-1 is homologous to the c-fos regulatory factor p62TCF. Nature. 1991; 354:531–534. [PubMed: 1722028] Howard-Ashby M, Materna SC, Brown CT, Chen L, Cameron RA, Davidson EH. Gene families encoding transcription factors expressed in early development of Strongylocentrotus purpuratus. Developmental biology. 2006a; 300:90–107. [PubMed: 17054934] Howard-Ashby M, Materna SC, Brown CT, Chen L, Cameron RA, Davidson EH. Identification and characterization of homeobox transcription factor genes in Strongylocentrotus purpuratus, and their expression in embryonic development. Developmental biology. 2006b; 300:74–89. [PubMed: 17055477] Hsieh YH, Wu TT, Tsai JH, Huang CY, Hsieh YS, Liu JY. PKCalpha expression regulated by Elk-1 and MZF-1 in human HCC cells. Biochemical and biophysical research communications. 2006; 339:217–225. [PubMed: 16297876] Hug BA, Ahmed N, Robbins JA, Lazar MA. A chromatin immunoprecipitation screen reveals protein kinase Cbeta as a direct RUNX1 target gene. The Journal of biological chemistry. 2004; 279:825– 830. [PubMed: 14561740] Jacobs D, Beitel GJ, Clark SG, Horvitz HR, Kornfeld K. Gain-of-function mutations in the Caenorhabditis elegans lin-1 ETS gene identify a C-terminal regulatory domain phosphorylated by ERK MAP kinase. Genetics. 1998; 149:1809–1822. [PubMed: 9691039] Janknecht R, Ernst WH, Pingoud V, Nordheim A. Activation of ternary complex factor Elk-1 by MAP kinases. The EMBO journal. 1993; 12:5097–5104. [PubMed: 8262053] Kagoshima H, Shigesada K, Kohara Y. RUNX regulates stem cell proliferation and differentiation: insights from studies of C. elegans. Journal of cellular biochemistry. 2007; 100:1119–1130. [PubMed: 17265434] Kingsley PD, Angerer LM, Angerer RC. Major temporal and spatial patterns of gene expression during differentiation of the sea urchin embryo. Developmental biology. 1993; 155:216–234. [PubMed: 8416835] Kondo S, Barna BP, Kondo Y, Tanaka Y, Casey G, Liu J, Morimura T, Kaakaji R, Peterson JW, Werbel B, Barnett GH. WAF1/CIP1 increases the susceptibility of p53 non-functional malignant glioma cells to cisplatin-induced apoptosis. Oncogene. 1996; 13:1279–1285. [PubMed: 8808702] LaBaer J, Garrett MD, Stevenson LF, Slingerland JM, Sandhu C, Chou HS, Fattaey A, Harlow E. New functional activities for the p21 family of CDK inhibitors. Genes & development. 1997; 11:847– 862. [PubMed: 9106657] Lee PY, Davidson EH. Expression of Spgatae, the Strongylocentrotus purpuratus ortholog of vertebrate GATA4/5/6 factors. Gene Expr Patterns. 2004; 5:161–165. [PubMed: 15567710] Leight ER, Glossip D, Kornfeld K. Sumoylation of LIN-1 promotes transcriptional repression and inhibition of vulval cell fates. Development. 2005; 132:1047–1056. [PubMed: 15689373] Leight ER, Murphy JT, Fantz DA, Pepin D, Schneider DL, Ratliff TM, Mohammad DH, Herman MA, Kornfeld K. Conversion of the LIN-1 ETS protein of Caenorhabditis elegans from a SUMOylated transcriptional repressor to a phosphorylated transcriptional activator. Genetics. 2015; 199:761– 775. [PubMed: 25567989] Lemaire P, Garrett N, Gurdon JB. Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell. 1995; 81:85–94. [PubMed: 7720076] Li QJ, Vaingankar S, Sladek FM, Martins-Green M. Novel nuclear target for thrombin: activation of the Elk1 transcription factor leads to chemokine gene expression. Blood. 2000; 96:3696–3706. [PubMed: 11090049]


Rizzo et al.

Page 18


Lincet H, Poulain L, Remy JS, Deslandes E, Duigou F, Gauduchon P, Staedel C. The p21(cip1/waf1) cyclin-dependent kinase inhibitor enhances the cytotoxic effect of cisplatin in human ovarian carcinoma cells. Cancer letters. 2000; 161:17–26. [PubMed: 11078909] Ling Y, Lakey JH, Roberts CE, Sharrocks AD. Molecular characterization of the B-box protein-protein interaction motif of the ETS-domain transcription factor Elk-1. The EMBO journal. 1997; 16:2431–2440. [PubMed: 9171356] Lockshin RA, Zakeri Z. Caspase-independent cell deaths. Current opinion in cell biology. 2002; 14:727–733. [PubMed: 12473346] Mao CA, Wikramanayake AH, Gan L, Chuang CK, Summers RG, Klein WH. Altering cell fates in sea urchin embryos by overexpressing SpOtx, an orthodenticle-related protein. Development. 1996; 122:1489–1498. [PubMed: 8625836] Marais R, Wynne J, Treisman R. The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell. 1993; 73:381–393. [PubMed: 8386592] Martelli AM, Evangelisti C, Nyakern M, Manzoli FA. Nuclear protein kinase C. Biochimica et biophysica acta. 2006; 1761:542–551. [PubMed: 16574477] Martin EL, Consales C, Davidson EH, Arnone MI. Evidence for a mesodermal embryonic regulator of the sea urchin CyIIa gene. Developmental biology. 2001; 236:46–63. [PubMed: 11456443] Materna SC, Howard-Ashby M, Gray RF, Davidson EH. The C2H2 zinc finger genes of Strongylocentrotus purpuratus and their expression in embryonic development. Developmental biology. 2006; 300:108–120. [PubMed: 16997293] Miley GR, Fantz D, Glossip D, Lu X, Saito RM, Palmer RE, Inoue T, Van Den Heuvel S, Sternberg PW, Kornfeld K. Identification of residues of the Caenorhabditis elegans LIN-1 ETS domain that are necessary for DNA binding and regulation of vulval cell fates. Genetics. 2004; 167:1697–1709. [PubMed: 15342509] Moore JC, Sumerel JL, Schnackenberg BJ, Nichols JA, Wikramanayake A, Wessel GM, Marzluff WF. Cyclin D and cdk4 are required for normal development beyond the blastula stage in sea urchin embryos. Molecular and cellular biology. 2002; 22:4863–4875. [PubMed: 12052892] Mora-Garcia P, Sakamoto KM. Granulocyte colony-stimulating factor induces Egr-1 up-regulation through interaction of serum response elementbinding proteins. The Journal of biological chemistry. 2000; 275:22418–22426. [PubMed: 10806199] Nakajima T. Signaling cascades in radiation-induced apoptosis: roles of protein kinase C in the apoptosis regulation. Med Sci Monit. 2006; 12:RA220–RA224. [PubMed: 17006414] Nemer M, Rondinelli E, Infante D, Infante AA. Polyubiquitin RNA characteristics and conditional induction in sea urchin embryos. Developmental biology. 1991; 145:255–265. [PubMed: 1645680] Nimmo R, Woollard A. Worming out the biology of Runx. Developmental biology. 2008; 313:492– 500. [PubMed: 18062959] Otim O, Amore G, Minokawa T, McClay DR, Davidson EH. SpHnf6, a transcription factor that executes multiple functions in sea urchin embryogenesis. Developmental biology. 2004; 273:226– 243. [PubMed: 15328009] Pancer Z, Rast JP, Davidson EH. Origins of immunity: transcription factors and homologues of effector genes of the vertebrate immune system expressed in sea urchin coelomocytes. Immunogenetics. 1999; 49:773–786. [PubMed: 10398804] Pucci B, Kasten M, Giordano A. Cell cycle and apoptosis. Neoplasia (New York, N.Y. 2000; 2:291– 299. Qiao L, McKinstry R, Gupta S, Gilfor D, Windle JJ, Hylemon PB, Grant S, Fisher PB, Dent P. Cyclin kinase inhibitor p21 potentiates bile acidinduced apoptosis in hepatocytes that is dependent on p53. Hepatology (Baltimore, Md. 2002; 36:39–48. Qureshi SA, Cao XM, Sukhatme VP, Foster DA. v-Src activates mitogen-responsive transcription factor Egr-1 via serum response elements. The Journal of biological chemistry. 1991; 266:10802– 10806. [PubMed: 2040600] Raff MC. Social controls on cell survival and cell death. Nature. 1992; 356:397–400. [PubMed: 1557121]


Rizzo et al.

Page 19


Ransick A, Rast JP, Minokawa T, Calestani C, Davidson EH. New early zygotic regulators expressed in endomesoderm of sea urchin embryos discovered by differential array hybridization. Developmental biology. 2002; 246:132–147. [PubMed: 12027439] Rast JP, Amore G, Calestani C, Livi CB, Ransick A, Davidson EH. Recovery of developmentally defined gene sets from high-density cDNA macroarrays. Developmental biology. 2000; 228:270– 286. [PubMed: 11112329] Rim M, Qureshi SA, Gius D, Nho J, Sukhatme VP, Foster DA. Evidence that activation of the Egr-1 promoter by v-Raf involves serum response elements. Oncogene. 1992; 7:2065–2068. [PubMed: 1408148] Rizzo F, Fernandez-Serra M, Squarzoni P, Archimandritis A, Arnone MI. Identification and developmental expression of the ets gene family in the sea urchin (Strongylocentrotus purpuratus). Developmental biology. 2006; 300:35–48. [PubMed: 16997294] Robertson AJ, Coluccio A, Jensen S, Rydlizky K, Coffman JA. Sea urchin akt activity is Runxdependent and required for post-cleavage stage cell division. Biology open. 2013; 2:472–478. [PubMed: 23789095] Robertson AJ, Coluccio A, Knowlton P, Dickey-Sims C, Coffman JA. Runx expression is mitogenic and mutually linked to Wnt activity in blastula-stage sea urchin embryos. PloS one. 2008; 3:e3770. [PubMed: 19020668] Robertson AJ, Croce J, Carbonneau S, Voronina E, Miranda E, McClay DR, Coffman JA. The genomic underpinnings of apoptosis in Strongylocentrotus purpuratus. Developmental biology. 2006; 300:321–334. [PubMed: 17010332] Robertson AJ, Dickey CE, McCarthy JJ, Coffman JA. The expression of SpRunt during sea urchin embryogenesis. Mechanisms of development. 2002; 117:327–330. [PubMed: 12204279] Rottinger E, Besnardeau L, Lepage T. A Raf/MEK/ERK signaling pathway is required for development of the sea urchin embryo micromere lineage through phosphorylation of the transcription factor Ets. Development. 2004; 131:1075–1087. [PubMed: 14973284] Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods in molecular biology (Clifton, N.J. 2000; 132:365–386. Schinelli S, Zanassi P, Paolillo M, Wang H, Feliciello A, Gallo V. Stimulation of endothelin B receptors in astrocytes induces cAMP response element-binding protein phosphorylation and c-fos expression via multiple mitogen-activated protein kinase signaling pathways. J Neurosci. 2001; 21:8842–8853. [PubMed: 11698596] Sharrocks AD. ERK2/p42 MAP kinase stimulates both autonomous and SRF-dependent DNA binding by Elk-1. FEBS letters. 1995; 368:77–80. [PubMed: 7615093] Sharrocks AD. The ETS-domain transcription factor family. Nature reviews. 2001; 2:827–837. Sharrocks AD. Complexities in ETS-domain transcription factor function and regulation: lessons from the TCF (ternary complex factor) subfamily. The Colworth Medal Lecture. Biochemical Society transactions. 2002; 30:1–9. [PubMed: 12023815] Sharrocks AD, Brown AL, Ling Y, Yates PR. The ETS-domain transcription factor family. The international journal of biochemistry & cell biology. 1997; 29:1371–1387. [PubMed: 9570133] Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nature cell biology. 2002; 4:E131– E136. [PubMed: 11988758] Shaw PE, Saxton J. Ternary complex factors: prime nuclear targets for mitogen-activated protein kinases. The international journal of biochemistry & cell biology. 2003; 35:1210–1226. [PubMed: 12757758] Soh JW, Lee EH, Prywes R, Weinstein IB. Novel roles of specific isoforms of protein kinase C in activation of the c-fos serum response element. Molecular and cellular biology. 1999; 19:1313– 1324. [PubMed: 9891065] Srinivasula SM, Fernandes-Alnemri T, Zangrilli J, Robertson N, Armstrong RC, Wang L, Trapani JA, Tomaselli KJ, Litwack G, Alnemri ES. The Ced-3/interleukin 1beta converting enzyme-like homolog Mch6 and the lamin-cleaving enzyme Mch2alpha are substrates for the apoptotic mediator CPP32. The Journal of biological chemistry. 1996; 271:27099–27106. [PubMed: 8900201]


Rizzo et al.

Page 20


Steinmetz R, Zeng P, King DW, Walvoord E, Pescovitz OH. Peptides derived from pro-growth hormone-releasing hormone activate p38 mitogen-activated protein kinase in GH3 pituitary cells. Endocrine. 2001; 15:119–127. [PubMed: 11572318] Suzuki A, Tsutomi Y, Akahane K, Araki T, Miura M. Resistance to Fas-mediated apoptosis: activation of caspase 3 is regulated by cell cycle regulator p21WAF1 and IAP gene family ILP. Oncogene. 1998; 17:931–939. [PubMed: 9747872] Takahashi A, Alnemri ES, Lazebnik YA, Fernandes-Alnemri T, Litwack G, Moir RD, Goldman RD, Poirier GG, Kaufmann SH, Earnshaw WC. Cleavage of lamin A by Mch2 alpha but not CPP32: multiple interleukin 1 beta-converting enzyme-related proteases with distinct substrate recognition properties are active in apoptosis. Proceedings of the National Academy of Sciences of the United States of America. 1996; 93:8395–8400. [PubMed: 8710882] Townsend KJ, Zhou P, Qian L, Bieszczad CK, Lowrey CH, Yen A, Craig RW. Regulation of MCL1 through a serum response factor/Elk-1-mediated mechanism links expression of a viabilitypromoting member of the BCL2 family to the induction of hematopoietic cell differentiation. The Journal of biological chemistry. 1999; 274:1801–1813. [PubMed: 9880563] Treisman R. The SRE: a growth factor responsive transcriptional regulator. Seminars in cancer biology. 1990; 1:47–58. [PubMed: 2133110] Treisman R. The serum response element. Trends in biochemical sciences. 1992; 17:423–426. [PubMed: 1455511] Treisman R. Ternary complex factors: growth factor regulated transcriptional activators. Current opinion in genetics & development. 1994; 4:96–101. [PubMed: 8193547] Uht RM, Amos S, Martin PM, Riggan AE, Hussaini IM. The protein kinase C-eta isoform induces proliferation in glioblastoma cell lines through an ERK/Elk-1 pathway. Oncogene. 2007; 26:2885–2893. [PubMed: 17146445] Vanhoutte P, Nissen JL, Brugg B, Gaspera BD, Besson MJ, Hipskind RA, Caboche J. Opposing roles of Elk-1 and its brain-specific isoform, short Elk-1, in nerve growth factor-induced PC12 differentiation. The Journal of biological chemistry. 2001; 276:5189–5196. [PubMed: 11050086] Vega Thurber R, Epel D. Apoptosis in early development of the sea urchin, Strongylocentrotus purpuratus. Developmental biology. 2007; 303:336–346. [PubMed: 17174294] Vermeulen K, Berneman ZN, Van Bockstaele DR. Cell cycle and apoptosis. Cell proliferation. 2003; 36:165–175. [PubMed: 12814432] Vickers ER, Kasza A, Kurnaz IA, Seifert A, Zeef LA, O'Donnell A, Hayes A, Sharrocks AD. Ternary complex factor-serum response factor complex-regulated gene activity is required for cellular proliferation and inhibition of apoptotic cell death. Molecular and cellular biology. 2004; 24:10340–10351. [PubMed: 15542842] Wang DG, Kirchhamer CV, Britten RJ, Davidson EH. SpZ12-1, a negative regulator required for spatial control of the territory-specific CyIIIa gene in the sea urchin embryo. Development. 1995; 121:1111–1122. [PubMed: 7743924] Wasylyk B, Hagman J, Gutierrez-Hartmann A. Ets transcription factors: nuclear effectors of the RasMAP-kinase signaling pathway. Trends in biochemical sciences. 1998; 23:213–216. [PubMed: 9644975] Yang SH, Shore P, Willingham N, Lakey JH, Sharrocks AD. The mechanism of phosphorylationinducible activation of the ETS-domain transcription factor Elk-1. The EMBO journal. 1999; 18:5666–5674. [PubMed: 10523309] Zhong S, Fromm J, Johnson DL. TBP is differentially regulated by c-Jun N-terminal kinase 1 (JNK1) and JNK2 through Elk-1, controlling c-Jun expression and cell proliferation. Molecular and cellular biology. 2007; 27:54–64. [PubMed: 17074809]


Rizzo et al.

Page 21

Author Manuscript

Highlights •

The sea urchin Elk gene Sp-Elk is globally expressed in the early embryo, and blocking this expression causes blastula stage developmental arrest due to apoptosis

•

Phosphorylation of the Sp-Elk protein on a conserved serine residue enhances its DNA binding and contributes to its anti-apoptotic activity

•

Sp-Elk is required for the developmental expression of numerous regulatory genes that promote cell proliferation and survival, including Sp-Runt-1 and its target Sp-PKC1

•

Sp-Elk specifically binds sequences upstream of the transcription start sites of Sp-Runt-1 and Sp-PKC1

Author Manuscript Author Manuscript Author Manuscript Dev Biol. Author manuscript; available in PMC 2017 August 01.

Rizzo et al.

Page 22


Figure 1. Sp-Elk gene and protein expression during early development

(A) Level of Sp-Elk expression measured by Q-PCR every two hours from fertilization to blastula stage. The inset on top of the graph reports western blot analysis of selected time points from the same batch of embryos used for Q-PCR analysis. (B) Immunohistochemistry of Sp-Elk protein at blastula stage.


Rizzo et al.

Page 23


Figure 2. Morpholino antisense-mediated knockdown of Sp-Elk

(A, B) Differential interface contrast (DIC) images of 12 h (A1), 16 h (A2), 18 h (A3) and 21 h (A4) control embryos; 12 h (B1), 16 h (B2), 18 h (B3) and 21 h (B4) Sp-Elk MASO injected embryos. (C, D) Immunostaining with anti-Sp-Elk antibody on control (C1, C2) and Sp-Elk MASO injected (D1, D2) embryos. Brightfield (C1, D1) and full projections of confocal z-series (C2, D2) images are shown. (E1) Superimposition of fluorescent and DIC images of embryos injected with the Sp-Elk:GFP fusion mRNAs: all the cells express GFP as shown by the (false) green color. (E2) When Sp-Elk MASO is co-injected with Sp-


Rizzo et al.

Page 24

Author Manuscript

Elk:GFP mRNA, embryos do not show any GFP fluorescence but do display the Sp-Elk MASO phenotype. (F) Diagram of the Sp-Elk:GFP transcript used for injections, a red bar indicates the position of the Sp-Elk MASO target sequence (see Methods). For statistics of phenotype obtained and MASO injection control experiments, see Table S1 and Fig. S1.


Rizzo et al.

Page 25


Figure 3. Knockdown of Sp-Elk leads to apoptosis

(A1–2) Superimposition of brightfield and confocal images (full projections of confocal zseries) of TUNEL-labeled (green) embryos. (B1–2) Full projections of confocal z-series images of BrdU-labeled (red) embryos. Arrows indicate nuclei with apoptotic morphology. (C1–4) A magnification of normal and apoptotic nuclei is shown in panel B1 and B2, respectively. Confocal images (single optical sections) of anti-activated caspase-6 (green)and nucleic acids (SYTO 83, red)- labeled embryos. (A1), (B1), (C1) and (C3) are control embryos; (A2), (B2), (C2) and (C4) are embryos injected with Sp-Elk MASO.


Rizzo et al.

Page 26


Figure 4. Sp-Elk phosphorylation at Serine 402

Author Manuscript

(A) Sequence alignment between Sp-Elk and human ELK proteins. The asterisk indicates the position of Serine 402. (B) Western blotting analysis of bacterially expressed Sp-Elk non-phosphorylated and phosphorylated with ERK1 using the antibody α-P-Elk-1. (C) Gelretardation analysis of non-phosphorylated and ERK1 phosphorylated bacterial Sp-Elk protein with the Cy313 binding site (Consales and Arnone, 2002). The Sp-Elk/Cy313 complex and the free probe are indicated. ERK1 phosphorylation of Sp-Elk increases its binding affinity to the DNA target site. (D) Immunohistochemistry showing phosphorylated Elk in all nuclei of an early blastula. (E) Diagram of Elk constructs used for rescue experiments. (F) SDS-PAGE autoradiography and western blotting of in vitro translated SpElk-wt protein. In vitro translated, 35S-labeled Luciferase control protein (I) and Sp-Elk-wt (II) were synthesized using the TNT coupled rabbit reticulocyte lysate system. Sp-Elk-wt protein is recognized by α-V5 and α-Sp-Elk.


Rizzo et al.

Page 27


Figure 5. Rescue of Sp-Elk morphants and overexpression effects of exogenous wild-type and base-substituted Sp-Elk mRNA

Author Manuscript

(A1, B1, C1) Control embryo; (A2, B2, C2) embryo injected with Sp-Elk MASO; (A3, B3, C3) embryo injected with Sp-Elk MASO and Elk-wt mRNAs; (A4, B4, C4) embryo injected with Sp-Elk MASO and ElkS402A mRNAs; (A5, B5, C5) embryo injected with Sp-Elk MASO and ElkS402D mRNAs; (A6, B6, C6) embryo injected with Elk-wt mRNAs; (A7, B7, C7) embryo injected with ElkS402A mRNAs; (A8, B8, C8) embryo injected ElkS402D mRNAs; (A1–8) Brightfield and (B1–8 and C1–8) full projections of confocal z-series images of blastula stage (20h) embryos are shown. For each embryo is indicated the percentage of abundance considering the average of 3 biological replicates and the color of the number represents the phenotypic class membership. See also Table S1 for statistics. (D) Graph of abundance percentage of each phenotypic class in the injected embryos. The percentages are average values of 3 independent injection experiments. The color-code is reported at the bottom of the figure.


Rizzo et al.

Page 28


Figure 6. Q-PCR analysis of gene expression in Sp-Elk morphants

(A) Fold differences in transcript levels in Sp-Elk morphants compared to control embryos in the same batch (duplicate average for a single experiment), measured as described in Methods. A positive number means the number of transcripts of the target gene is increased by the Sp-Elk MASO injection; a negative number means the number of target gene transcripts is decreased. Measurements carried out on independent injection experiment, are separated by slashes. Fold differences of more than a factor of 2 (~ 1 cycle) are indicated in bold. (B) Graphical representation of Q-PCR results, columns represent average values


Rizzo et al.

Page 29

Author Manuscript

calculated between all the results reported in the upper table. Error bars indicate ± standard deviations. The grey box indicates a fold variation less than a factor 2, which is taken here to be the minimum level of variation considered significant. Color legend is indicated at the right bottom corner. The temporal expression patterns of all the genes analyzed have been characterized by Q-PCR (Fig. S2).


Rizzo et al.

Page 30


Figure 7. DNA-binding specificity of Sp-Elk toward different Ets target sequences in Sp-PKC1 and Sp-Runt-1 promoters

(A) Sequence alignment of the potential Sp-Elk binding sites, located in 5’ proximal region of Sp-PKC1 and Sp-Runt-1, with the well characterized Cy313 ETS binding sequence (on top). (B) Gel-shift experiments and EMSA/antibody supershift assays (α-Sp-Elk) performed by using oligonucleotide probes Cy313, PCK2 and Runt1 in the presence of in vitro synthesized Sp-Elk, and competitor sequences added at 100-or 50-fold molar excess. (C) Amplification of Sp-Runt-1 and Sp-PKC1 promoter region sequences recovered by ChIP from blastula stage (20 hpf) chromatin using the anti-Sp-Elk antibody or a non-immune IgG Dev Biol. Author manuscript; available in PMC 2017 August 01.

Rizzo et al.

Page 31

Author Manuscript

control. The Sp-Runt-1 primers failed to amplify a specific product from the 1:100 dilution of input (pre-ChIP) DNA, probably owing to competition from a nonspecific primer-dimer artifact produced by those primers (which precluded the use of qPCR). The Sp-PKC1 primers amplified a single specific band; qPCR measurements indicated that the Sp-PKC1 target sequence was enriched ~64-fold (ΔCt = 6) by ChIP using anti-Sp-Elk, compared to what was obtained using non-immune IgG.


Rizzo et al.

Page 32


Figure 8. Proposed Elk-dependent feed-forward gene regulatory circuit required for cell survival in sea urchin embryos

The connections deduced from the data reported in figs. 6 and 7, are indicated by blue lines. Based on their known roles in other systems, Sp-PKC1 may also promote cell proliferation, and the Runx target genes akt-1 and akt-2 (Robertson et al., 2013) may also contribute to the pro-survival functions of Sp-Runt-1, as indicated by the question marks.

Author Manuscript Author Manuscript Dev Biol. Author manuscript; available in PMC 2017 August 01.

bicaudal-C is required for the formation of anterior neurogenic ectoderm in the sea urchin embryo.

7 signaling is required for anterior skeletal patterning in sea urchin embryos.

Cilia are required for asymmetric nodal induction in the sea urchin embryo.

Microtubule motors in the early sea urchin embryo.

Primary mesenchyme cells of the sea urchin embryo require an autonomously produced, nonfibrillar collagen for spiculogenesis.

The transcription factor XBP1 is selectively required for eosinophil differentiation.

Zelda is differentially required for chromatin accessibility, transcription factor binding, and gene expression in the early Drosophila embryo.

Zygotic LvBMP5-8 is required for skeletal patterning and for left-right but not dorsal-ventral specification in the sea urchin embryo.

Characterization of the sea urchin mitochondrial transcription factor A reveals unusual features.

Embryonic stage-related properties of sea urchin embryo chromatin.

Specific functions of the Wnt signaling system in gene regulatory networks throughout the early sea urchin embryo.

Z mRNA is stored in the egg cytoplasm and basally regulated in the sea urchin embryo.

Tyrosine phosphorylation is required for activation of an alpha interferon-stimulated transcription factor.

Actinomycin D--disruption of the mitotic gradient in the cleavage stages of the sea urchin embryo.

Role of the extracellular matrix in tissue-specific gene expression in the sea urchin embryo.

UHF-1, a factor required for maximal transcription of early and late sea urchin histone H4 genes: analysis of promoter-binding sites.

Developmental shifts in the synthesis of heterogeneous nuclear RNA classes in the sea urchin embryo.

Yap1, transcription regulator in the Hippo signaling pathway, is required for Xenopus limb bud regeneration.

The newly characterized Pl-jun is specifically expressed in skeletogenic cells of the Paracentrotus lividus sea urchin embryo.

Pool sizes of the deoxynucleoside triphosphates in the sea urchin egg and developing embryo.

Tissue-specific, temporal changes in cell adhesion to echinonectin in the sea urchin embryo.

The sea urchin spermatozoon.

Cell movements during the initial phase of gastrulation in the sea urchin embryo.

Regulatory logic and pattern formation in the early sea urchin embryo.