Experimental Hematology 2014;42:897–908
An imbalance between Beclin-1 and p62 expression promotes the proliferation of myeloma cells through autophagy regulation Marco Tuccia, Stefania Stuccia, Annalisa Savonarolaa, Leonardo Restab, Mauro Civesa, Roberta Rossib, and Franco Silvestrisa a
Department of Biomedical Sciences and Clinical Oncology, University of Bari ‘Aldo Moro’, Bari, Italy; bDepartment of Emergence and Organ Transplantation, University of Bari ‘Aldo Moro’, Bari, Italy (Received 30 January 2014; revised 2 May 2014; accepted 13 June 2014)
Autophagy occurs in tumor cells acquiring cytotoxic drug resistance and its activation may impair their susceptibility to apoptosis in response to apoptogen agents. We investigated the pro-apoptotic effect of dexamethasone (Dex) on MM cell lines (U266, INA-6, LR5-8226, LIG, and MCC2) and primary malignant plasma cells from na€ıve and refractory/relapsed patients. We evaluated the transcriptional and ultrastructural events leading to autophagy by measuring Beclin-1 and p62 levels and transmission electronic microscopy. Autophagy was inhibited by hydroxychloroquine (HCQ), whereas the ability of Dex-resistant MM cells to recover the susceptibility to apoptosis was measured. A direct relationship between autophagy and Beclin-1 or LC3/Atg8 levels was observed, whereas their mRNAs were inversely correlated to p62 expression. Starvation strongly activated autophagy by inducing cellular, transcriptional, and ultrastructural modifications that were reversed by HCQ. Taken together, these data suggest that autophagy is a potential mechanism leading to drug resistance in MM, and suggest Beclin-1 and p62 as early markers of cell susceptibility to apoptosis. The combination of HCQ with novel agents may thus be considered to improve the therapeutic response in relapsed/resistant MM patients. Ó 2014 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc.
Introduction Although novel treatments have significantly improved both disease-free intervals and the overall survival in multiple myeloma (MM) [1], the majority of patients undergoes progression and/or relapse due to the development of acquired drug resistance (ADR). Based on the importance of early detection of ADR for planning appropriate strategies, its mechanisms have been extensively investigated in MM. Over-expression of glycoprotein-P (P-gp), the product of MDR1 has been observed in MM and correlated with clinical relapse as a consequence of ADR, and preliminary characterization of MDR1 polymorphisms may also predict the outcome in several patients [2]. Other mechanisms include both cytogenetic and epigenetic alterations
Offprint requests to: Marco Tucci, MD, Department of Biomedical Sciences and Clinical Oncology, University of Bari ‘Aldo Moro’, P.za Giulio Cesare, 11 – 70124, Bari, Italy; E-mail: [email protected] Supplementary data related to this article can be found online at http:// dx.doi.org/10.1016/j.exphem.2014.06.005.
since hyperdiploid karyotype is associated with clinical worsening whereas both t(4;14) and p(16;q32) translocations correlate with defective Cyclin-D expression and Maf-B activation that concur to MM cell proliferation. In addition, DNA methylation as well as soluble factormediated DR and cell-adhesion mediated DR, have been described in refractory/relapsed MM patients showing concurrent alterations of NF-kB and p53 signaling [3–5]. Apoptosis of tumor cells in hematological malignancies such as MM is balanced by autophagy [6,7], a genecontrolled catabolic mechanism that degrades unnecessary or dysfunctional cytoplasmic components in autophagic vesicles resulting in autophagosome formation [8]. The role of autophagy in cancer is under intensive investigation, although data on its pro-survival or pro-apoptotic effect are still controversial. It has been proven that activation of autophagy in colon cancer and hepatocellular carcinoma (HCC) enables the cell proliferation in response to either cellular stress or increased metabolic demands, whereas MM cells show a low level of autophagy whose activation correlates with both viability and resistance to apoptosis.
0301-472X/$ - see front matter. Copyright Ó 2014 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.exphem.2014.06.005
898
M. Tucci et al./ Experimental Hematology 2014;42:897–908
By contrast, the loss of the pro-survival role in breast cancer progression has been related to the effect of autophagy on both genomic damage and instability [9]. Autophagy inhibition reinforces the anti-MM activity of DNA-damaging drugs [10], whereas the activation of autophagic genes, such as Beclin-1 and Atg5, results in resistance to tyrosine-kinase inhibitors in chronic myeloid leukemia as well as cisplatin in HCC. By contrast, it has been reported that autophagy may represent a survival mechanism in BCR/ABL-transformed cells, since inhibitors of autophagy enhance their susceptibility to tyrosinekinase inhibitor-mediated apoptosis. Lastly, the activation of Beclin-1 sensitizes Her-2/neuþ breast cancer cells to targeting agents [11–14] while its silencing drives a cytotoxic effect in MM cells [10]. Autophagy is induced by an initial membrane nucleation step that requires class-III phosphoinositide 3 kinase (PI3K) complex including Beclin-1, whose levels in MM cells are inversely related to the magnitude of both programmed cell-death and sensitivity to cytotoxic drugs [10]. On the contrary, the ubiquitin-binding transcriptional factor p62/sequestosome-1, controls the drug-induced cytotoxicity, and once bound to the Atg8/LC3 motif of Beclin-1, promotes apoptosis through the cleavage of caspase-8, as recently proved in experimental liver injury [15,16]. Furthermore, Beclin-1 expression was found as inversely correlated to p62 and positively with LC3 in patients with colon cancer in complete remission after adjuvant chemotherapy [17]. Efficient transcription of autophagic signals requires either the phosphorylation of the Beclin-1/PI3K complex or the inhibition of the mTORC-1 activity necessary for the up-regulation of Atg8/LC3 via Atg3 and Atg7 ubiquitinlike proteins. This also occurs in proliferating MM cells [18,19] showing high phosphorylation of the Beclin-1/ PI3K complex once exposed to alkylating agents [20]. By contrast, Beclin-1/PI3K transcription is inhibited by hydroxychloroquine (HCQ), which recovers the susceptibility of MM cells to apoptosis by p62 in a fashion almost similar to 3-methyladenine and everolimus (RAD001) in colorectal cancer cells [21,22]. Here, we investigated the interplay of autophagy and apoptosis in myeloma cells exposed to dexamethasone (Dex) and explored the Beclin-1/p62 levels as potential predictors of ADR in MM.
Methods Patients and MM cell lines After obtaining the written informed consent from patients, seven of them with relapsed MM (group A) and four newly-diagnosed patients (group B) were enrolled in this study at the Department of Biomedical Sciences and Clinical Oncology of the University of Bari ‘Aldo Moro’. Among patients from group A, four had previously been treated with Bortezomib-Dex (pts. #1-4), one with
high-dose Dex (pt. #5), and two with melphalan (PAM) and prednisone (pts. #6 and 7). Bone marrow cells were isolated by fineneedle aspiration from the iliac crest and primary plasma cells were purified by the EasySep Human CD138 selection kit (Stemcell Technologies, Vancouver, Canada). In addition, U266, RPMI8226, and INA-6 (American Tissue Cell Collection; Manassas, VA) MM cell lines, in vitro established MM cell lines from both na€ıve (LIG) and relapsed (MCC2) patients were also included in the study, whereas PAM-resistant LR5-8226 cells served as positive control (kindly provided by Dalton W.S., Moffit Cancer Center, University of South Florida). Cell viability and apoptosis Aliquots of the MM cell lines were treated with variable amounts (from 1 nM to 101 M) of Dex to define the IC50, and their cell viability was evaluated by the colorimetric MTT assay (3-dimethylthiazol-2,5-diphenyl tetrazolium bromide; Promega, Madison, Wisconsin). Thus, Dex at 103 M was added up to 12 hours, and levels of apoptosis was quantified by Annexin-V (AV)/propidium iodide (PI) cell staining (Molecular Probes, Eugene, Oregon), as percentage of dead cells by flow-cytometry. Similarly, the effect of Dex at 103 M was evaluated on primary cells from both A and B groups, while the cleavage of caspase-8 (CaspGLOW red kit, Molecular Probes) was investigated by flow-cytometry in cell lines as well as in primary cells. The specificity of caspase-8 activation was assessed by the Red-IETD-FMK as selective caspase-8 inhibitor and confirmed by adding the Z-VAD-FMK as negative control. Real time PCR and western blot Beclin-1 and p62 mRNAs were measured in MM cell lines and primary cells by real-time PCR after purification with the NucleoSpin RNA II kit (Quiagen, Chatsworth, CA). Parallel experiments measured Atg3, Atg7, and LC3/Atg8 expression, whose mRNA levels were normalized to the b-actin housekeeping gene and relative values calculated by Dct. The list of primers is in Supplementary Table 1. Western blot (WB) analysis explored the functional activation of p62 and LC3 by myeloma cell lines and primary cells by the relative antihuman monoclonal antibody (Merck Millipore, Milan, Italy). The quantification of both p62 and LC3 expression was assessed by the Image-J Software (NIH, Washington, DC), whereas b-actin was the housekeeping control. The relative optical density (O.D.) was calculated as ratio between treated and untreated cells in triplicate. Autophagy characterization Autophagy was explored in myeloma cell lines by different methods. First, it was induced by 48-hour starvation in fetal calf serum (FCS)-free medium and both Beclin-1 and Atg8/ LC3 mRNA levels were compared to untreated cells. In addition, LC3 cytoplasmic localization was explored by immunofluorescence (IF) after overnight incubation of cells with anti-LC3 MoAb (Abgent, San Diego, CA) followed by FITC-conjugated anti-rabbit IgG MoAb (Abgent). To this, INA-6 and U266 were investigated, whereas LR5-8226 served as positive control. Nuclei were counterstained by 4,6-diamidino-2-phenylindole (DAPI; Abgent). LC3 positive cells were counted by UV microscopy (Olympus, Milan, Italy), randomly exploring 10 fields of 10 cm2 at 20 magnification with dedicated software (Imaging Software NIS Elements-D).
M. Tucci et al./ Experimental Hematology 2014;42:897–908
899
Figure 1. Dexamethasone induces apoptosis in myeloma cells. Myeloma cell lines and primary cells were treated with Dex and the magnitude of apoptosis was measured in terms of AVþ/PIþ cells. (A) LR5-8226, U266, INA-6, and MCC-2 exposed to increasing concentrations of Dex (1 nM to 101 M) were resistant to apoptosis (8.0 6 1.7% of AVþ/PIþ cells as compared to untreated cells (3.3 6 0.8%). On the contrary, RPMI-8226 and LIG showed high values of AVþ/PIþ apoptotic cells at 103 and 101 M (27 6 2 and 28 6 3%, respectively). (B) Both RPMI-8226 and LIG showed a time-dependent susceptibility to apoptosis, with a peak at 12 hours of incubation with Dex at 103 M. (C) Primary myeloma cells from group A patients showed a poor sensitivity to Dex at 103 M for 12 hours with a low percentage of AVþ/PIþ cells (20 6 5%) as compared to group B cells (42 6 7%; p ! 0.05). (D) Representative dot-plots by flow cytometry showing the variable AV/PI expression by INA-6 and RPMI-8226, primary cells from group A (pt. A7) and B (pt. B4). Bars in A and C are median6SD.
As additional assay to measure autophagy, transmission electron microscopy (TEM) investigated the ultrastructural cell modifications induced by starvation in both INA-6 and U266 cells. Thus, cells were washed with phosphate buffer (pH 7.4) and fixed at 4 C with 2.5% glutaraldehyde for 30 min. The cells were treated with 1% osmium tetroxide for 20 min and progressively dehydrated by increasing ethanol concentrations followed by incubation with propylene oxide and inclusion in epoxy resin. Semithin (1.5 mm) and ultrathin sections of 70–90 nm were prepared with an ultra-microtome (PTXl-RMC) and examined under the Morgagni-268 transmission electron microscope (FEI Electron Optics, Eindhoven, Netherlands) supplemented with the image analyzer iTem (Soft Imaging System, Munster, Germany). Ultrastructural morphology of both untreated and starved LR5-8226, as well as RPMI-8226 cells, was also investigated. Inhibition of autophagy Both HCQ and RAD001 were used to inhibit autophagy with the purpose of restoring susceptibility to apoptosis in MM cell lines. The potential anti-apoptotic effect of RAD001 was also investigated. The cells were preliminarily starved by FCS deprivation, incubated up to 24 hours with HCQ or RAD001 at 40 mM/L or
100 nM/L, respectively, and then incubated with Dex at 103 M for 12 hours. The percentage of apoptotic cells was calculated by AV/PI staining, in parallel with the measurement of both Beclin-1 and p62, ultrastructural modifications, and LC3 localization within the cytoplasm. Statistical analyses Mann-Whitney nonparametric test was used for calculations of differences in mRNA levels, numbers of AVþ/PIþ cells as well as LC3 expression between MM cell lines and primary malignant plasma cells.
Results Myeloma cells show a variable sensitivity to Dexinduced apoptosis As shown in Figure 1 (panel A), since the relative values were almost similar to untreated cells (3.3 6 0.8%), LR58226, U266, INA-6, and MCC-2 were apparently resistant to apoptosis in terms of percentages of AVþ/PIþ cells
900
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Figure 2. Cleavage of caspase-8 in myeloma cells induced by Dex. (A) High cleavage of caspase-8 was found in RPMI-8226 and LIG treated with Dex at 103 M as compared to LR5-8226, U266, INA6, and MCC2, as well as in primary cells from group B with respect to A (p ! 0.05 in both instances). RedIEDT-FMK was used to reveal the caspase-8 activation, whereas Z-VAD-FMK served as negative control. (B) Representative flow cytometry histograms showing the high expression of cleaved caspase-8 in RPMI-8226 and primary cells from pt. B4 as compared to INA-6 and cells from pt. A7.
(8.0 6 1.7%) induced by increasing concentrations of Dex. In addition, neither the highest Dex concentration (101 M), nor an extension of the culture time (panel B) increased apoptosis. By contrast, RPMI-8226 and LIG showed a dose- (panel A) and time-dependent (panel B) susceptibility to cell death. Six hr incubation with Dex at 103M produced a percentage of AVþ/PIþ cells (30 6 3 and 34 6 4%) that was at least tenfold higher than the control untreated cells (3 6 0.5; p ! 0.05), and this effect was increased by extending the drug exposure to 12 hours
(65 6 7% of AVþ/PIþ cells; p ! 0.05). In addition, treatment of primary myeloma cells from group B with 103 M Dex for 12 hours (panel C) resulted in a high percentage of AVþ/PIþ cells (42 6 7%) as compared to both untreated (12 6 3%; p ! 0.05) and Dex-treated cells from group A, thus, showing similar levels of apoptosis with respect to relative controls (19 6 6 and 11 6 5%). Representative dot-plot panels of AVþ/PIþ cell populations revealed by INA-6 and RPMI-8226, as well as by primary cells from patients A7 and B4, are illustrated in panel D. Based on
M. Tucci et al./ Experimental Hematology 2014;42:897–908
901
Figure 3. Transcriptional levels of autophagic genes. (A) The mRNA levels of Beclin-1 and p62 were measured by RT-PCR in both cell lines and primary cells. As shown, Beclin-1 was up-regulated by U266, INA-6 and MCC-2 (3.5 6 0.3 Dct) as compared to RPMI-8226 (7.9 6 0.9) and LIG (8.4 6 1.1), showing similar levels to LR5-8226 (2.1 6 0.2). Primary cells from group A showed high Beclin-1 mRNAs as compared to group B (3.1 6 0.4 and 7.4 6 0.7 Dct; p ! 0.05). On the contrary, cells from group B overexpressed p62 (4.1 6 0.5) in parallel to both RPMI-8226 (3.1 6 0.4) and LIG (2.6 6 0.5). By contrast, primary plasma cells from group A showed low mRNA levels of p62 (7.6 6 1.2) similarly to U266, INA-6, and MCC2 (6.9 6 0.7) as well as to LR5-8226 (8.9 6 1.1). (B) Beclin-1high/p62low cell lines and group A cells up-regulated Atg8/LC3 mRNAs (4.4 6 0.7 and 5.2 6 0.8 Dct) as compared to both Beclin-1low/p62high populations and cells from group B (7.4 6 0.9 and 8.4 6 0.9; p ! 0.05) whereas both Atg3 and Atg7 levels were apparently equivalent in cell lines and primary cells independently from Beclin-1 and p62 levels. Representative WB (C) of both p62 and LC3 levels from MM cell lines (U266 and LIG) and primary cells (group A: pt. #3; group B: pt. #2) showing reduced p62 expression in U266 (O.D.: 0.2 6 0.02) and in cells from group A (0.3 6 0.08) with respect to LIG (0.55 6 0.3) and group B cells (0.78 6 0.5). By contrast, increased LC3 cleavage occurred in U266 and in group A cells (O.D.: 0.72 6 0.2 and 0.48 þ 0.1) with respect to LIG (0.36 6 0.2) and group B (0.1 6 0.02).
these results, the variable susceptibility of MM cells to Dex-induced apoptosis was apparently dependent on the acquired development of drug resistance. Myeloma cell apoptosis is activated through caspase-8 Caspase-8 is cleaved along the extrinsic apoptotic pathway, which is also activated by Dex. Thus, caspase-8 cleavage was explored in myeloma cells in relation to their different susceptibility to apoptosis. As shown in Figure 2 (panel A), incubation with Dex at 103 M for 12 hr produced a variable caspase-8 cleavage in RPMI-8226 and LIG (61 6 2%) as well as in group B cells (44 6 6%) that was reverted by the Z-VADFMK inhibitor used as negative control. By contrast, LR5-8226, U266, INA-6, MCC2 (10 6 3%),
and group A cells (17 6 5%; p ! 0.05) showed a minor activation of caspase-8. Representative flow-cytometric histograms of caspase-8 cleavage from INA-6 and RPMI8226 cells, as well as from patients A7 and B4, are shown in Figure 2, panel B. Therefore, caspase-8 cleavage was confirmed to be dependent on Dex stimulation and its enrichment reflects the extent of apoptosis in myeloma cells. Beclin-1 and p62 are differently expressed by myeloma cells mRNA levels of both Beclin-1 and p62 were investigated in both cell lines and primary myeloma cells. As shown in Figure 3 (panel A), the expression of Beclin-1 was
902
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Figure 4. Activation of autophagy by starvation. (A) Starvation of LR5-8226, U266, INA-6, and MCC2 induced an increment of Beclin-1 (4.3 6 1.08 2DDct) and Atg8/LC3 (3.9 6 0.9) mRNA levels as compared to untreated cells (p ! 0.05), whereas RPMI-8226 and LIG mRNAs were moderately modified (2.2 6 0.1 and 1.9 6 0.2). An increment of Atg3 (2.5 6 0.4) and Atg7 (2.1 6 0.5) and defective p62 (3.2 6 0.4) levels occurred in LR5-8226, U266, INA-6, and MCC2, whereas they mRNAs were poorly altered in RPMI-8226 and LIG (1.5 6 0.2 and 1.3 6 0.07 and 1.7 6 0.2, respectively). Experiments were in triplicate and bars indicate the meanþSD. Basal levels are untreated cells. Representative panels of LC3 speckled cytoplasmic accumulation by IF were demonstrated in INA-6 after starvation.
increased in INA-6, MCC2, and U266 (3.5 þ 0.3 Dct) as compared to RPMI-8226 (7.9 6 0.9) and LIG (8.4 6 1.1; p ! 0.05), with mRNA values similar to LR5-8226 cells (2.1 6 0.2). Beclin-1 levels were inversely correlated to p62, that appeared up-regulated in RPMI-8226 (3.1 6 0.4) and LIG (2.6 6 0.5), moderately inhibited in INA-6, MCC2, and U266 (6.9 6 0.7; p ! 0.05), and dramatically reduced in LR5-8226 (8.9 6 1.1). The mRNA content of both genes was also investigated in primary cells from both A and B groups. As shown, group A myeloma cells showed high mRNA levels of Beclin-1 (3.1 6 0.4) as compared to p62 (7.6 6 1.2; p ! 0.05), whereas p62 levels were up-regulated in group B (4.1 6 0.5), suggesting an inverse relationship between Beclin-1and p62 levels in primary cells. Therefore, myeloma cells were arbitrarily differentiated as Beclin-1high/p62low (LR5-8226, U266, INA-6, MCC-2, and group A) and, vice versa as Beclin-1low/ p62high (RPMI-8226, LIG, and group B) for the next experiments. These results suggested that Beclin-1/p62 levels in MM cells may predict their potential to undergo apoptosis and, contrarily, the activation of autophagy. Based on these results, we next investigated whether the defective p62 expression in apoptosis-resistant cells was, at least in part, related to different levels of the Atg8/LC3 binding motif of Beclin-1. As shown in Figure 3 (panel B), Atg8/LC3 mRNAs were found up-regulated in both Beclin-1high/p62low cells (4.4 6 0.7 Dct) and group A (5.2 6 0.8) as compared to Beclin-1low/p62high cells
(7.4 6 0.9) and group B (8.4 6 0.9). In addition, WB analysis confirmed that p62 expression was inversely correlated to LC3 in both cell lines and primary MM cells (panel C). Moreover, the lipidation of the Atg8/LC3 complex results from a complex multistep mechanism that following its binding to the autophagosome involves a number of ubiquitin-like proteins. Thus, both Atg3 and Atg7 mRNAs were arbitrarily investigated and their basal levels were found increased in MM cell lines and primary cells independently from Beclin-1and Atg8/LC3 content. Starvation induces autophagy in myeloma cells We further investigated both transcriptional and ultrastructural modifications induced by starvation in myeloma cell lines. As shown in Figure 4 (panel A), starvation of LR58226, U266, INA-6, and MCC2 induced a significant increase of Beclin-1 (4.3 6 1.08 2DDct) and Atg8/LC3 (3.9 6 0.9) as compared to untreated not-starved cells (p ! 0.05), whereas their mRNA levels were slightly modified in both RPMI and LIG. The highest Beclin-1 and Atg8/ LC3 mRNA increase occurred in LR5-8226 (5.8 6 0.9 and 5.1 6 0.6). A parallel increment of Atg3 and Atg7 and defective p62 mRNA levels was observed in LR5-8226, U266, INA-6, and MCC2, while a moderate variation occurred in RPMI-8226 and LIG. LC3 expression was also investigated by IF (Fig. 4, panels B and C) and its speckled localization within the cytoplasm was apparently increased in Beclin-1high/p62low cells (INA-6: 25 6 4 cells/cm2) as
M. Tucci et al./ Experimental Hematology 2014;42:897–908
903
Figure 4. (continued) (B), whereas the untreated cells (C) showed a diffuse LC3 localization. (D) Representative TEM pattern showing the morphological modifications induced by starvation in INA-6 and the formation of a high number of autophagosomes (asterisk), vacuoles of different sizes (300–700 nm) and nuclear defects (5,600 magnification). (E) Magnification at 14,000 of autophagosomes formation. (F) Similar ultrastructural features were also revealed in LR5-8226 (5,600 ). (G) High magnification (36,000 ) of panel F showing the mitochondria alterations in LR5-8226 with prominent cristae and altered membranes mostly due to the hypoxic stimuli induced by chronic stimulation with PAM.
compared to untreated cells showing a diffuse cytoplasmic LC3 accumulation. Starved (32 6 6 cells/cm2) and control LR5-8226 cell line showed a similar LC3 expression (data not shown). TEM also explored the ultrastructural cell modifications induced by starvation. Figure 4 (panel D) shows that starved Beclin-1high/p62low cells (INA-6) accumulate vacuoles of about 300 nm, including partially damaged membranes and digested organelles. Nuclei, endoplasmic reticulum and mitochondria appeared structurally altered, reflecting the effects of oxidative stress induced by starvation. Moreover, a high cytoplasmic accumulation of autophagosomes (asterisk in panel D and at high magnification in E) was demonstrated, formed by body-like vesicles of different sizes up to 700 nm, engulfed by high-density material including lysosomes and digested structures of the endoplasmic reticulum. These ultrastructural modifications were also found in LR5-8226 cells,
regardless of starvation (panel F), in the presence of high number of mitochondria, reflecting the chronic exposure to PAM (panel G). These results provided evidence that the activation of autophagy induced by resistance to apoptosis in myeloma cells is associated with a number of events that produce transcriptional and morphological modifications. Inhibition of autophagy restores apoptosis by upregulating p62 Based on the critical role of autophagy in the development of resistance to apoptosis, Beclin-1high/p62low myeloma cell lines were separately treated with HCQ or RAD001 to verify their autophagy inhibition potential. As shown in Figure 5 (panel A), the viability of myeloma cells was not affected by Dex, HCQ or RAD001 since the AVþ/PIþ cell populations were similar to control cells. By contrast, preliminary stimulation with HCQ followed by Dex increased the size of the
904
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Figure 5. Effect of HCQ on autophagy. (A) Apoptosis measurement by AV/PI staining in Beclin-1high/p62low cells treated with inhibitors of autophagy. As shown, the cell viability was not affected by Dex, HCQ or RAD001, whereas the preliminary treatment with HCQ followed by stimulation with Dex at 103M for 12 hr partially restored the susceptibility of myeloma cells to apoptosis (27 6 3% of AVþ/PIþ cells). On the contrary, RAD001 had no effect. (B) Treatment of Beclin-1high/p62low cells with HCQ followed by Dex inhibited Beclin-1 (7.87 6 1.6 Dct) and up-regulated p62 (3.6 6 0.9) as compared to controls. (C) Further experiments explored the capability of starvation to inhibit apoptosis. The apoptotic susceptibility of Beclin-1low/p62high cells induced by Dex was limited by starvation, whereas RAD001 showed a minor effect that was not boosted by the combination with starvation. (D) The expression of p62 by myeloma cells was down-regulated in both RPMI-8226 and LIG, whereas Beclin-1 levels were up-regulated as compared to untreated cells.
AVþ/PIþ cell population (27 6 3%; p ! 0.05), whereas mTOR inhibitor showed no pro-apoptotic effect. Treatment with HCQ reverted the mRNA levels of both Beclin-1 and p62 (Fig. 5 panel B), that resulted down- (7.87 6 1.6 Dct) and up-regulated (3.6 6 0.9), respectively, as compared to their basal values (p ! 0.05 in both instances). On the contrary, the mRNA levels were not modified by RAD001 (data not shown). The functional interplay between Beclin1 and p62 signaling was further investigated by activating autophagy. As shown in Figure 5 (panel C), starvation limited the sensitivity of Beclin-1low/p62high cell lines to Dex, causing a reduction of AVþ/PIþ cells (27 6 3% vs. 52 6 5%; p ! 0.05). In addition, starvation down-regulated p62 while up-regulating Beclin-1 in both RPMI-8226 (4.3 6 0.8 and 6.4 6 0.8 Dct) and LIG (4.9 6 0.3 and 4.8 6 0.8) with respect to untreated cells (Fig. 5 panel D). Once again, RAD001 showed a minimal pro-apoptotic effect on both the numbers of AVþ/PIþ cell populations and Beclin-1 and p62 expression.
Hydroxychloroquine modifies both LC3 expression and cell morphology As shown in Figure 6 (panel A), LC3 expression by IF of starved INA-6 was impaired by HCQ in terms of numbers of positive cells (10 6 2 cell/cm2) as compared to control cells (Fig. 4 panel B) and the diffuse fluorescence resembling RPMI-8226 (panel B). On the contrary, the number of autophagosomes was lower and the cytoplasmic vesicles showed external membrane damage, while the cytoplasm was full of high-density mitochondria with prominent cristae (panel C). The mitochondrial defect (highest magnification in panel D) was mostly attributable to the permeabilization of their external membrane induced by HCQ. The morphology of HCQ-treated INA-6 resembled that of the control not-starved population used as control (panels E and F). Moreover, stimulation of INA-6 with HCQ followed by Dex induced typical morphological features, such as blebs and nuclear fragmentation, that suggested a partial reactivation of apoptosis (panels G and H).
M. Tucci et al./ Experimental Hematology 2014;42:897–908
905
Figure 6. LC3 expression and ultrastructural modifications induced by HCQ. Representative panels of LC3 expression in INA-6 treated with HCQ (A) showing a reduced, diffuse cytoplasmic accumulation by IF with a similar number of LC3þ cells to RPMI-8226 (B). Ultrastructural modifications induced by HCQ were explored by TEM in INA-6 (C) and showed a low number of autophagosomes (arrow). (D) High magnification (14,000 ) of autophagosomes (arrow in panel C). (E) Basal activation of autophagy in INA-6 cells (5,600 ) producing low numbers of autophagosomes as compared to starved cells and a limited cytoplasm vacuolization (F), whereas the treatment with HCQ followed by Dex partially restored the apoptosis (G; magnification at 7,100 ) as detected by increased nuclear fragmentation and formation of blebs (H, high magnification at 11,000 ).
Discussion Acquired drug resistance depends on various mechanisms including autophagy, which renders myeloma cells resistant to apoptosis via Beclin-1 up-regulation. Here, we provide evidence that the balance between Beclin-1 and p62 expression is critical for the survival of myeloma cells and that, at least in vitro, the inhibition of autophagy overcomes ADR and restores apoptosis.
The issue to define whether autophagy is a deathinduced mechanism or supports the cell survival is controversial, since preliminary studies demonstrated that autophagy controls cellular homeostasis while its abrogation enhances tumorigenesis [23]. This occurs in both breast cancer cell lines with a defective expression of Beclin-1 as well as in Beclin-1þ/ mice showing a strong tendency to develop premalignant lesions and spontaneous
906
M. Tucci et al./ Experimental Hematology 2014;42:897–908
tumors [24,25]. By contrast, other data support the functional role of autophagy in cancer cell survival, since the allelic-loss of Beclin-1 enhances their propensity to undergo apoptosis [26]. We provide evidence that myeloma cells show a different susceptibility to apoptosis that was apparently dependent on Beclin-1 expression, whose highest mRNA levels were found in PAM-resistant cells. In support of this, Beclin-1 was up-regulated in primary MM cells from refractory/relapsed patients and, by contrast, reduced in newly-diagnosed patients. These findings suggest that Beclin-1 activity may indirectly reflect the tumor progression of MM, and emphasize its role in the development of resistance to apoptosis. The fate of cancer cells toward autophagy or apoptosis also depends on p62 expression, which regulates the proteasome degradation of poly-ubiquitinated proteins, osteoclastogenesis, and adipogenesis, whereas its interplay with Beclin-1 is pivotal for the anti-proliferative potential of cytotoxic drugs [27]. Up-regulation of p62 has been described in apoptotic lung cancer cells, whereas Beclin-1 is increased in colorectal cancer cells from patients undergoing clinical progression [28]. This is in line with the effect produced by the long-term treatment of MM cells with proteasome inhibitors resulting in the activation of autophagy that can be promptly restrained by overcoming the bortezomib-induced resistance [29]. We found an inverse correlation between p62 and Beclin-1 levels in primary cells and MM cell lines, whereas the highest p62 expression was present in na€ıve patients. Similarly, low levels of Beclin-1 expression was found inversely correlated to p62 and positively with LC3 in patients with colon cancer showing prolonged overall survival after adjuvant 5-fluorouracilbased chemotherapy [17]. In line with this observation, p62 positively influenced the cell susceptibility to apoptosis while its defect apparently enhanced the proliferation via the LC3/Atg8 binding within autophagosomes. The proapoptotic signals driven by p62 are also controlled by poly-ubiquinated caspase-8 that is cleaved to the active form by Dex [30] and, thus, represents an indicator of susceptibility to apoptosis in MM cells. However, low proteolytic caspase-10 activity is also required for tempering the viability of MM cells since a heterodimeric protease formed of caspase-10 and cFLIPL is used by these cells to balance the pro-survival and pro-death effect of autophagy [31]. High-dose Dex treatment remains an effective therapy for patients with MM [32]. Here, we describe that a number of MM cells exposed to Dex promptly underwent apoptosis at a parallel extent with increased p62 activity. Similar findings have been reported in MCF-7 breast cancer cells incubated with high-dose Dex [14]. Taken together, these data suggest that the p62 levels may reflect the susceptibility of MM cells to apoptosis in treated patients, whereas the increased expression of Beclin-1 is predictive of ADR. Inhibiting autophagy is an innovative approach for overcoming ADR in patients undergoing chemotherapy, whose
effectiveness has recently been demonstrated in glioma [33], breast and colon carcinomas, and in MM [34]. Several inhibitors, including HCQ, restrain autophagy by blocking the transcriptional signals driven by Beclin-1 as well as by damaging the DNA strands, similarly to alkylating agents [35]. Inhibition of autophagy by HCQ enhances the druginduced cell death of MM, lymphoma and HCC cells to an extent similar to that shown by siRNA knockdown of Atg5 as well as Atg3 and Atg7 [34,36,37]. Furthermore, HCQ synergizes with proteasome inhibitors, thus, reinforcing their anti-myeloma effect, whereas thapsigargin inhibits autophagy and induces apoptosis by directly interfering with the endoplasmic reticulum [10,38]. Nevertheless, mTOR inhibitors are currently used for the treatment of several cancers [39] and defective mTORC1 activity occurs in a variety of apoptosis-resistant malignant cells. This may hypothetically imply a tumorigenic potential of RAD001 through the induction of autophagy and down-regulation of p62 [40]. However, a pro-survival effect of RAD001 was not proven in the majority of studies, while targeting the PI3K/ AKT/mTOR pathway inhibits MM cell growth in vitro [41]. We found that the in vitro treatment of Beclin-1high/ p62low MM cells with HCQ overcomes apoptosis resistance and restores cell sensitivity to Dex. In addition, a parallel decline of Beclin-1 expression and up-regulation of p62 were observed, whereas neither the number of apoptotic cells, nor the Beclin-1/p62 levels were significantly affected by RAD001. The interplay between autophagy and apoptosis in MM is also supported by the effect of starvation, which reactivates autophagy while inhibiting apoptosis through Beclin-1 retrieval. Since no tumorigenic effect of RAD001 was detected, we concluded that mTOR inhibitors interfere minimally, at least in vitro, with the proliferative rate of myeloma cells and that Beclin-1/p62 levels efficiently reflect the propensity of MM cells to undergo apoptosis. Ultrastructural cell modifications, with engulfment of digested proteins within autophagosomes, reflect the activation of autophagy machinery. The induction of autophagy by starvation enhances the formation of autophagosomes in a variety of malignant cells [42], including Beclin-1high/ p62low MM cells. The increased numbers of mitochondria showing prominent cristae may reflect the lactate excess that enhances the anaerobic glycolytic flux leading to a growth advantage [43], whereas their structural defect in LR5-8226 may depend on chronic exposure to PAM. HCQ restrains autophagosome fusion and degradation in breast, prostate and lung cancer cells [44]. Here, we demonstrate that it also influences MM cell lines and can restore the cell susceptibility to apoptosis. Ultrastructural modifications induced by autophagy include LC3/Atg8 integration within autophagosomes as a consequence of the activation of Atg7 and Atg3 ubiquitin-like proteins and cleavage of Atg4 that, moreover, are critical for the recruitment of p62 molecules [45].
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Mutations in these motifs as well as mTOR inhibitors reduce p62-mediated transcriptional signals in both normal and malignant cells [35]. In this context, LC3 accumulation in bone marrow of mice bearing MM promotes the proliferation of myeloma cells that, on the contrary, is restrained in LC3/ mice [46]. LC3 expression and a speckled-like accumulation within the cytoplasm of our MM model were correlated with the extent of autophagy and impaired by HCQ, thus, supporting a potential link between LC3 and the activation of autophagy in MM progression. In conclusion, our data emphasize autophagy as a pro-survival mechanism in MM that counterbalances the drug-induced cell death, and supports the detection of Beclin-1/p62 for preliminary evaluations of cell susceptibility to apoptosis. In this context, new strategies designed to disrupt the autophagy cascade, including HCQ, could be beneficial to overcome ADR in MM.
14. 15.
16. 17.
18. 19.
20. 21.
Acknowledgments
22.
This work was funded by a grant (# IG11647) from AIRC (Italian Association for Cancer Research) and from the Italian Ministry of Health, PRIN 2009 (#2009WZHMNJ).
23. 24. 25.
References 1. Palumbo A, Anderson K. Multiple Myeloma. N Engl J Med. 2011; 364:1046–1060. 2. Tucci M, Quatraro C, Dammacco F, Silvestris F. Role of active drug transporters in refractory multiple myeloma. Curr Top Med Chem. 2009;9:218–224. 3. Shammas MA, Shmookler Reis RJ, Koley H, et al. Dysfunctional homologous recombination mediates genomic instability and progression in myeloma. Blood. 2009;113:2290–2297. 4. Popovic R, Licht JD. MEK and MAF in myeloma therapy. Blood. 2011;117:2300–2302. 5. Siegel DS. Relapsed/Refractory multiple myeloma: defining refractory disease and identifying strategies to overcome resistance. Semin Hematol. 2012;49:3–15. 6. Banerji V, Gibson SB. Targeting metabolism and autophagy in the context of haematogical malignancies. Int J Cell Biol. 2012;2012: 595976. 7. Nencioni N, Cea M, Montecucco F. Autophagy in blood cancers: biological role and therapeutic implications. Haematologica. 2013;98: 1335–1343. 8. Xie Z, Klionsky DJ. Autophagosome formation: core machinery and adaptations. Nat Cell Biol. 2007;9:1102–1109. 9. Mathew R, Karantza-Wadsworth V, White E. Role of autophagy in cancer. Nat Rev Cancer. 2007;7:961–967. 10. Hoang B, Benavides A, Shi Y, Frost P, Lichtenstein A. Effect of autophagy on multiple myeloma cell viability. Mol Cancer Ther. 2007;8: 1974–1984. 11. Helgason GV, Karvela M, Holyoake TL. Kill one bird with two stones: potential efficacy of BCR-ABL and autophagy inhibition in CML. Blood. 2011;118:2035–2043. 12. Song J, Qu Z, Guo X, et al. Hypoxia-induced autophagy contributes to the chemoresistance of hepatocellular carcinoma cells. Autophagy. 2009;5:1131–1144. 13. Bellodi C, Lidonnici MR, Hamilton A, et al. Targeting autophagy potentiate tyrosine kinase inhibitor-induced cell death in Philadelphia
26.
27. 28.
29.
30.
31. 32.
33. 34.
35. 36. 37.
38.
907
chromosome-positive cells, including primary CML stem cells. J Clin Invest. 2009;119:1109–1123. Jain K, Paranandi KS, Sridharan S, Basu A. Autophagy in breast cancer and its implications for therapy. Am J Cancer Res. 2013;3:251–265. Hou W, Han J, Lu C, Goldstein LA, Rabinowich H. Autophagic degradation of active caspase-8: a crosstalk mechanism between autophagy and apoptosis. Autophagy. 2010;6:891–900. Moscat J, Diaz-Meco MT. p62 at the crossroads of autophagy, apoptosis and cancer. Cell. 2009;137:1001–1004. Myung Park J, Huang S, Wu TT, Foster NR, Sinicrope FA. Prognostic impact of Becli-1, p62/sequestosome-1 and LC3 protein expression in colon carcinomas from patients receiving 5-fluorouracil as adjuvant chemotherapy. Cancer Biol Ther. 2013;14:100–107. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Ann Rev Genet. 2009;43:67–93. Meister S, Schubert U, Neubert K, et al. Extensive immunoglobulin production sensitizes myeloma cells for proteasome inhibition. Cancer Res. 2007;67:1783–1792. Ikeda H, Hideshima T, Fulciniti M, et al. PI3K/p110{delta} is a novel therapeutic target in multiple myeloma. Blood. 2010;116:1460–1468. Mauri~no GS, Alcaide A, Domınguez C. Pharmacological control of autophagy: therapeutic perspectives in inflammatory bowel disease and colorectal cancer. Curr Pharm Des. 2012;18:3853–3873. Cheong H, Lu C, Lindsen T, Thompson CB. Therapeutic targets in cancer cell metabolism and autophagy. Nat Biotechnol. 2012;30:671–678. Gewirtz DA. The four faces of autophagy: implications for cancer therapy. Cancer Res. 2014;74:647–651. Karantza-Wadsworth V, White E. Role of autophagy in breast cancer. Autophagy. 2007;3:610–613. Yang ZJ, Chee CE, Huang S, Sinicrope F. Autophagy modulation for cancer therapy. Cancer Biol Ther. 2011;11:169–176. Chen S, Rehman SK, Zhang W, Wen A, Yao L, Zhang J. Autophagy is a therapeutic target in anticancer drug resistance. Biochem Biophys Acta. 2010;1806:220–229. Mathew R, Karp C, Beaudoin B, et al. Autophagy suppresses tumorigenesis through elimination of p62. Cell. 2009;137:1062–1075. Koukourakis MI, Giatromanolaki A, Sivridis E, Pitiakoudis M, Gatter KC, Harris AL. Beclin-1 over- and under-expression in colorectal cancer: distinct patterns relate to prognosis and tumour hypoxia. Br J Cancer. 2010;103:1209–1214. Landoswki T, Escalante AM, Jefferson A, et al. Inhibition of autophagy promotes bortezomib-mediated cell death in myeloma cells. Blood. 2008;112. Abstract 1259. Herr I, Gassler N, Friess H, B€uchler MW. Regulation of differential pro- and anti-apoptotic signaling by glucocorticoids. Apoptosis. 2007;12:271–291. Lamy L, Ngo VN, Tolga Emre NC, et al. Control of autophagic cell death by caspase-10 in multiple myeloma. Cancer Cell. 2013;15:1–15. Richardson PG, Sonneveld P, Schuster MW, et al. Bortezomib or highdose dexamethasone for relapsed multiple myeloma. N Engl J Med. 2005;352:2487–2498. Chen N, Karantza-Wadsworth V. Role and regulation of autophagy in cancer. Biochem Biophys Acta. 2009;1793:1516–1523. Pan Y, Gao Y, Chen L, et al. Targeting autophagy augments in vitro and in vivo antimyeloma activity of DNA-damaging chemotherapy. Clin Can Res. 2011;17:3248–3258. Janku F, McConkey DJ, Hong DS. Autophagy as a target for anticancer therapy. Nature Rev Clin Oncol. 2011;8:528–539. Yang ZJ, Chee CE, Huang S, Sinicrope F. The role of autophagy in cancr: therapeutic implications. Mol Cancer Ther. 2011;10:1533–1541. Li J, Yang B, Zhou Q, et al. Autophagy promotes hepatocellular carcinoma cell invasion through activation of epithelial-mesenchymal transition. Carcinogenesis. 2013;34:1343–1351. Shen PYC, Divakaran S, Ponduru S, Vogl DT, Amaravadi RK, Bradner JE. The rationale for combined proteasome and autophagy inhibition
908
M. Tucci et al./ Experimental Hematology 2014;42:897–908
in multiple myeloma established using novel translational platforms. Blood. 2008;112. Abstract 951. 39. Dancey J. mTOR signaling and drug development in cancer. Nature Rev Clin Oncol. 2010;7:209–219. 40. Huang S, Yang ZJ, Yu C, Sinicrope FA. Inhibition of mTOR kinase by AZD8055 can antagonize chemotherapy-induced cell death through autophagy induction and down-regulation of p62/sequestosome-1. J Biol Chem. 2011;286:40002–40012. 41. Aronson LI, Davenport EL, Mirabella F, Morgan GJ, Davies FE. Understanding the interplay between the proteasome pathway and autophagy in response to dual PI3K/mTOR inhibition in myeloma cells is essential for their effective clinical application. Leukemia. 2013;27:2397–2403.
42. Klionsky DJ, Abeliovich H, Agostinis P, et al. Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy. 2008;4:151–175. 43. Maiuri MC, Zalckvar E, Kimchi A, et al. Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nat Rev Mol Cell Biol. 2007;8:741–752. 44. Amaravadi RK, Lippincott-Schwartz J, Yin XM, et al. Principles and current strategies for targeting autophagy for cancer treatment. Clin Cancer Res. 2011;17:654–666. 45. Nishida Y, Arakawa S, Fujitani K. Discovery of Atg5/Atg7independent alternative macroautophagy. Nature. 2009;461:654–658. 46. Tanida I, Ueno T, Kominami E. LC3 and autophagy. Methods Mol Biol. 2008;445:77–88.
M. Tucci et al./ Experimental Hematology 2014;42:897–908 Supplementary Table 1. Autophagic factors and relative primers for Real Time PCR amplification Genes Beclin-1 p62 Atg3 Atg7 Atg8/LC3
Primers Fw- CACGAGTTTCAAGATCCTGGACCG Rev- AATCTGCGAGAGACACCATCCTG Fw- CGGCACTCTCTATGGAAAACA Rev- CGCAAGCTTAACACAACTATG Fw- ATCACAACACAGGTATTACAG Rev- TCCTCATCTTCATCTTCTTCC Fw- AACCAAAGCAGCAAGGAGC Rev- ATTCATCCGATCGTCACTGCTGC Fw- GAGAAGCAGCTTCCTCTTCTGG Rev- GTGTCCGTTCACCAACAGGAG
908.e1
An imbalance between Beclin-1 and p62 expression promotes the proliferation of myeloma cells through autophagy regulation Marco Tuccia, Stefania Stuccia, Annalisa Savonarolaa, Leonardo Restab, Mauro Civesa, Roberta Rossib, and Franco Silvestrisa a
Department of Biomedical Sciences and Clinical Oncology, University of Bari ‘Aldo Moro’, Bari, Italy; bDepartment of Emergence and Organ Transplantation, University of Bari ‘Aldo Moro’, Bari, Italy (Received 30 January 2014; revised 2 May 2014; accepted 13 June 2014)
Autophagy occurs in tumor cells acquiring cytotoxic drug resistance and its activation may impair their susceptibility to apoptosis in response to apoptogen agents. We investigated the pro-apoptotic effect of dexamethasone (Dex) on MM cell lines (U266, INA-6, LR5-8226, LIG, and MCC2) and primary malignant plasma cells from na€ıve and refractory/relapsed patients. We evaluated the transcriptional and ultrastructural events leading to autophagy by measuring Beclin-1 and p62 levels and transmission electronic microscopy. Autophagy was inhibited by hydroxychloroquine (HCQ), whereas the ability of Dex-resistant MM cells to recover the susceptibility to apoptosis was measured. A direct relationship between autophagy and Beclin-1 or LC3/Atg8 levels was observed, whereas their mRNAs were inversely correlated to p62 expression. Starvation strongly activated autophagy by inducing cellular, transcriptional, and ultrastructural modifications that were reversed by HCQ. Taken together, these data suggest that autophagy is a potential mechanism leading to drug resistance in MM, and suggest Beclin-1 and p62 as early markers of cell susceptibility to apoptosis. The combination of HCQ with novel agents may thus be considered to improve the therapeutic response in relapsed/resistant MM patients. Ó 2014 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc.
Introduction Although novel treatments have significantly improved both disease-free intervals and the overall survival in multiple myeloma (MM) [1], the majority of patients undergoes progression and/or relapse due to the development of acquired drug resistance (ADR). Based on the importance of early detection of ADR for planning appropriate strategies, its mechanisms have been extensively investigated in MM. Over-expression of glycoprotein-P (P-gp), the product of MDR1 has been observed in MM and correlated with clinical relapse as a consequence of ADR, and preliminary characterization of MDR1 polymorphisms may also predict the outcome in several patients [2]. Other mechanisms include both cytogenetic and epigenetic alterations
Offprint requests to: Marco Tucci, MD, Department of Biomedical Sciences and Clinical Oncology, University of Bari ‘Aldo Moro’, P.za Giulio Cesare, 11 – 70124, Bari, Italy; E-mail: [email protected] Supplementary data related to this article can be found online at http:// dx.doi.org/10.1016/j.exphem.2014.06.005.
since hyperdiploid karyotype is associated with clinical worsening whereas both t(4;14) and p(16;q32) translocations correlate with defective Cyclin-D expression and Maf-B activation that concur to MM cell proliferation. In addition, DNA methylation as well as soluble factormediated DR and cell-adhesion mediated DR, have been described in refractory/relapsed MM patients showing concurrent alterations of NF-kB and p53 signaling [3–5]. Apoptosis of tumor cells in hematological malignancies such as MM is balanced by autophagy [6,7], a genecontrolled catabolic mechanism that degrades unnecessary or dysfunctional cytoplasmic components in autophagic vesicles resulting in autophagosome formation [8]. The role of autophagy in cancer is under intensive investigation, although data on its pro-survival or pro-apoptotic effect are still controversial. It has been proven that activation of autophagy in colon cancer and hepatocellular carcinoma (HCC) enables the cell proliferation in response to either cellular stress or increased metabolic demands, whereas MM cells show a low level of autophagy whose activation correlates with both viability and resistance to apoptosis.
0301-472X/$ - see front matter. Copyright Ó 2014 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.exphem.2014.06.005
898
M. Tucci et al./ Experimental Hematology 2014;42:897–908
By contrast, the loss of the pro-survival role in breast cancer progression has been related to the effect of autophagy on both genomic damage and instability [9]. Autophagy inhibition reinforces the anti-MM activity of DNA-damaging drugs [10], whereas the activation of autophagic genes, such as Beclin-1 and Atg5, results in resistance to tyrosine-kinase inhibitors in chronic myeloid leukemia as well as cisplatin in HCC. By contrast, it has been reported that autophagy may represent a survival mechanism in BCR/ABL-transformed cells, since inhibitors of autophagy enhance their susceptibility to tyrosinekinase inhibitor-mediated apoptosis. Lastly, the activation of Beclin-1 sensitizes Her-2/neuþ breast cancer cells to targeting agents [11–14] while its silencing drives a cytotoxic effect in MM cells [10]. Autophagy is induced by an initial membrane nucleation step that requires class-III phosphoinositide 3 kinase (PI3K) complex including Beclin-1, whose levels in MM cells are inversely related to the magnitude of both programmed cell-death and sensitivity to cytotoxic drugs [10]. On the contrary, the ubiquitin-binding transcriptional factor p62/sequestosome-1, controls the drug-induced cytotoxicity, and once bound to the Atg8/LC3 motif of Beclin-1, promotes apoptosis through the cleavage of caspase-8, as recently proved in experimental liver injury [15,16]. Furthermore, Beclin-1 expression was found as inversely correlated to p62 and positively with LC3 in patients with colon cancer in complete remission after adjuvant chemotherapy [17]. Efficient transcription of autophagic signals requires either the phosphorylation of the Beclin-1/PI3K complex or the inhibition of the mTORC-1 activity necessary for the up-regulation of Atg8/LC3 via Atg3 and Atg7 ubiquitinlike proteins. This also occurs in proliferating MM cells [18,19] showing high phosphorylation of the Beclin-1/ PI3K complex once exposed to alkylating agents [20]. By contrast, Beclin-1/PI3K transcription is inhibited by hydroxychloroquine (HCQ), which recovers the susceptibility of MM cells to apoptosis by p62 in a fashion almost similar to 3-methyladenine and everolimus (RAD001) in colorectal cancer cells [21,22]. Here, we investigated the interplay of autophagy and apoptosis in myeloma cells exposed to dexamethasone (Dex) and explored the Beclin-1/p62 levels as potential predictors of ADR in MM.
Methods Patients and MM cell lines After obtaining the written informed consent from patients, seven of them with relapsed MM (group A) and four newly-diagnosed patients (group B) were enrolled in this study at the Department of Biomedical Sciences and Clinical Oncology of the University of Bari ‘Aldo Moro’. Among patients from group A, four had previously been treated with Bortezomib-Dex (pts. #1-4), one with
high-dose Dex (pt. #5), and two with melphalan (PAM) and prednisone (pts. #6 and 7). Bone marrow cells were isolated by fineneedle aspiration from the iliac crest and primary plasma cells were purified by the EasySep Human CD138 selection kit (Stemcell Technologies, Vancouver, Canada). In addition, U266, RPMI8226, and INA-6 (American Tissue Cell Collection; Manassas, VA) MM cell lines, in vitro established MM cell lines from both na€ıve (LIG) and relapsed (MCC2) patients were also included in the study, whereas PAM-resistant LR5-8226 cells served as positive control (kindly provided by Dalton W.S., Moffit Cancer Center, University of South Florida). Cell viability and apoptosis Aliquots of the MM cell lines were treated with variable amounts (from 1 nM to 101 M) of Dex to define the IC50, and their cell viability was evaluated by the colorimetric MTT assay (3-dimethylthiazol-2,5-diphenyl tetrazolium bromide; Promega, Madison, Wisconsin). Thus, Dex at 103 M was added up to 12 hours, and levels of apoptosis was quantified by Annexin-V (AV)/propidium iodide (PI) cell staining (Molecular Probes, Eugene, Oregon), as percentage of dead cells by flow-cytometry. Similarly, the effect of Dex at 103 M was evaluated on primary cells from both A and B groups, while the cleavage of caspase-8 (CaspGLOW red kit, Molecular Probes) was investigated by flow-cytometry in cell lines as well as in primary cells. The specificity of caspase-8 activation was assessed by the Red-IETD-FMK as selective caspase-8 inhibitor and confirmed by adding the Z-VAD-FMK as negative control. Real time PCR and western blot Beclin-1 and p62 mRNAs were measured in MM cell lines and primary cells by real-time PCR after purification with the NucleoSpin RNA II kit (Quiagen, Chatsworth, CA). Parallel experiments measured Atg3, Atg7, and LC3/Atg8 expression, whose mRNA levels were normalized to the b-actin housekeeping gene and relative values calculated by Dct. The list of primers is in Supplementary Table 1. Western blot (WB) analysis explored the functional activation of p62 and LC3 by myeloma cell lines and primary cells by the relative antihuman monoclonal antibody (Merck Millipore, Milan, Italy). The quantification of both p62 and LC3 expression was assessed by the Image-J Software (NIH, Washington, DC), whereas b-actin was the housekeeping control. The relative optical density (O.D.) was calculated as ratio between treated and untreated cells in triplicate. Autophagy characterization Autophagy was explored in myeloma cell lines by different methods. First, it was induced by 48-hour starvation in fetal calf serum (FCS)-free medium and both Beclin-1 and Atg8/ LC3 mRNA levels were compared to untreated cells. In addition, LC3 cytoplasmic localization was explored by immunofluorescence (IF) after overnight incubation of cells with anti-LC3 MoAb (Abgent, San Diego, CA) followed by FITC-conjugated anti-rabbit IgG MoAb (Abgent). To this, INA-6 and U266 were investigated, whereas LR5-8226 served as positive control. Nuclei were counterstained by 4,6-diamidino-2-phenylindole (DAPI; Abgent). LC3 positive cells were counted by UV microscopy (Olympus, Milan, Italy), randomly exploring 10 fields of 10 cm2 at 20 magnification with dedicated software (Imaging Software NIS Elements-D).
M. Tucci et al./ Experimental Hematology 2014;42:897–908
899
Figure 1. Dexamethasone induces apoptosis in myeloma cells. Myeloma cell lines and primary cells were treated with Dex and the magnitude of apoptosis was measured in terms of AVþ/PIþ cells. (A) LR5-8226, U266, INA-6, and MCC-2 exposed to increasing concentrations of Dex (1 nM to 101 M) were resistant to apoptosis (8.0 6 1.7% of AVþ/PIþ cells as compared to untreated cells (3.3 6 0.8%). On the contrary, RPMI-8226 and LIG showed high values of AVþ/PIþ apoptotic cells at 103 and 101 M (27 6 2 and 28 6 3%, respectively). (B) Both RPMI-8226 and LIG showed a time-dependent susceptibility to apoptosis, with a peak at 12 hours of incubation with Dex at 103 M. (C) Primary myeloma cells from group A patients showed a poor sensitivity to Dex at 103 M for 12 hours with a low percentage of AVþ/PIþ cells (20 6 5%) as compared to group B cells (42 6 7%; p ! 0.05). (D) Representative dot-plots by flow cytometry showing the variable AV/PI expression by INA-6 and RPMI-8226, primary cells from group A (pt. A7) and B (pt. B4). Bars in A and C are median6SD.
As additional assay to measure autophagy, transmission electron microscopy (TEM) investigated the ultrastructural cell modifications induced by starvation in both INA-6 and U266 cells. Thus, cells were washed with phosphate buffer (pH 7.4) and fixed at 4 C with 2.5% glutaraldehyde for 30 min. The cells were treated with 1% osmium tetroxide for 20 min and progressively dehydrated by increasing ethanol concentrations followed by incubation with propylene oxide and inclusion in epoxy resin. Semithin (1.5 mm) and ultrathin sections of 70–90 nm were prepared with an ultra-microtome (PTXl-RMC) and examined under the Morgagni-268 transmission electron microscope (FEI Electron Optics, Eindhoven, Netherlands) supplemented with the image analyzer iTem (Soft Imaging System, Munster, Germany). Ultrastructural morphology of both untreated and starved LR5-8226, as well as RPMI-8226 cells, was also investigated. Inhibition of autophagy Both HCQ and RAD001 were used to inhibit autophagy with the purpose of restoring susceptibility to apoptosis in MM cell lines. The potential anti-apoptotic effect of RAD001 was also investigated. The cells were preliminarily starved by FCS deprivation, incubated up to 24 hours with HCQ or RAD001 at 40 mM/L or
100 nM/L, respectively, and then incubated with Dex at 103 M for 12 hours. The percentage of apoptotic cells was calculated by AV/PI staining, in parallel with the measurement of both Beclin-1 and p62, ultrastructural modifications, and LC3 localization within the cytoplasm. Statistical analyses Mann-Whitney nonparametric test was used for calculations of differences in mRNA levels, numbers of AVþ/PIþ cells as well as LC3 expression between MM cell lines and primary malignant plasma cells.
Results Myeloma cells show a variable sensitivity to Dexinduced apoptosis As shown in Figure 1 (panel A), since the relative values were almost similar to untreated cells (3.3 6 0.8%), LR58226, U266, INA-6, and MCC-2 were apparently resistant to apoptosis in terms of percentages of AVþ/PIþ cells
900
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Figure 2. Cleavage of caspase-8 in myeloma cells induced by Dex. (A) High cleavage of caspase-8 was found in RPMI-8226 and LIG treated with Dex at 103 M as compared to LR5-8226, U266, INA6, and MCC2, as well as in primary cells from group B with respect to A (p ! 0.05 in both instances). RedIEDT-FMK was used to reveal the caspase-8 activation, whereas Z-VAD-FMK served as negative control. (B) Representative flow cytometry histograms showing the high expression of cleaved caspase-8 in RPMI-8226 and primary cells from pt. B4 as compared to INA-6 and cells from pt. A7.
(8.0 6 1.7%) induced by increasing concentrations of Dex. In addition, neither the highest Dex concentration (101 M), nor an extension of the culture time (panel B) increased apoptosis. By contrast, RPMI-8226 and LIG showed a dose- (panel A) and time-dependent (panel B) susceptibility to cell death. Six hr incubation with Dex at 103M produced a percentage of AVþ/PIþ cells (30 6 3 and 34 6 4%) that was at least tenfold higher than the control untreated cells (3 6 0.5; p ! 0.05), and this effect was increased by extending the drug exposure to 12 hours
(65 6 7% of AVþ/PIþ cells; p ! 0.05). In addition, treatment of primary myeloma cells from group B with 103 M Dex for 12 hours (panel C) resulted in a high percentage of AVþ/PIþ cells (42 6 7%) as compared to both untreated (12 6 3%; p ! 0.05) and Dex-treated cells from group A, thus, showing similar levels of apoptosis with respect to relative controls (19 6 6 and 11 6 5%). Representative dot-plot panels of AVþ/PIþ cell populations revealed by INA-6 and RPMI-8226, as well as by primary cells from patients A7 and B4, are illustrated in panel D. Based on
M. Tucci et al./ Experimental Hematology 2014;42:897–908
901
Figure 3. Transcriptional levels of autophagic genes. (A) The mRNA levels of Beclin-1 and p62 were measured by RT-PCR in both cell lines and primary cells. As shown, Beclin-1 was up-regulated by U266, INA-6 and MCC-2 (3.5 6 0.3 Dct) as compared to RPMI-8226 (7.9 6 0.9) and LIG (8.4 6 1.1), showing similar levels to LR5-8226 (2.1 6 0.2). Primary cells from group A showed high Beclin-1 mRNAs as compared to group B (3.1 6 0.4 and 7.4 6 0.7 Dct; p ! 0.05). On the contrary, cells from group B overexpressed p62 (4.1 6 0.5) in parallel to both RPMI-8226 (3.1 6 0.4) and LIG (2.6 6 0.5). By contrast, primary plasma cells from group A showed low mRNA levels of p62 (7.6 6 1.2) similarly to U266, INA-6, and MCC2 (6.9 6 0.7) as well as to LR5-8226 (8.9 6 1.1). (B) Beclin-1high/p62low cell lines and group A cells up-regulated Atg8/LC3 mRNAs (4.4 6 0.7 and 5.2 6 0.8 Dct) as compared to both Beclin-1low/p62high populations and cells from group B (7.4 6 0.9 and 8.4 6 0.9; p ! 0.05) whereas both Atg3 and Atg7 levels were apparently equivalent in cell lines and primary cells independently from Beclin-1 and p62 levels. Representative WB (C) of both p62 and LC3 levels from MM cell lines (U266 and LIG) and primary cells (group A: pt. #3; group B: pt. #2) showing reduced p62 expression in U266 (O.D.: 0.2 6 0.02) and in cells from group A (0.3 6 0.08) with respect to LIG (0.55 6 0.3) and group B cells (0.78 6 0.5). By contrast, increased LC3 cleavage occurred in U266 and in group A cells (O.D.: 0.72 6 0.2 and 0.48 þ 0.1) with respect to LIG (0.36 6 0.2) and group B (0.1 6 0.02).
these results, the variable susceptibility of MM cells to Dex-induced apoptosis was apparently dependent on the acquired development of drug resistance. Myeloma cell apoptosis is activated through caspase-8 Caspase-8 is cleaved along the extrinsic apoptotic pathway, which is also activated by Dex. Thus, caspase-8 cleavage was explored in myeloma cells in relation to their different susceptibility to apoptosis. As shown in Figure 2 (panel A), incubation with Dex at 103 M for 12 hr produced a variable caspase-8 cleavage in RPMI-8226 and LIG (61 6 2%) as well as in group B cells (44 6 6%) that was reverted by the Z-VADFMK inhibitor used as negative control. By contrast, LR5-8226, U266, INA-6, MCC2 (10 6 3%),
and group A cells (17 6 5%; p ! 0.05) showed a minor activation of caspase-8. Representative flow-cytometric histograms of caspase-8 cleavage from INA-6 and RPMI8226 cells, as well as from patients A7 and B4, are shown in Figure 2, panel B. Therefore, caspase-8 cleavage was confirmed to be dependent on Dex stimulation and its enrichment reflects the extent of apoptosis in myeloma cells. Beclin-1 and p62 are differently expressed by myeloma cells mRNA levels of both Beclin-1 and p62 were investigated in both cell lines and primary myeloma cells. As shown in Figure 3 (panel A), the expression of Beclin-1 was
902
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Figure 4. Activation of autophagy by starvation. (A) Starvation of LR5-8226, U266, INA-6, and MCC2 induced an increment of Beclin-1 (4.3 6 1.08 2DDct) and Atg8/LC3 (3.9 6 0.9) mRNA levels as compared to untreated cells (p ! 0.05), whereas RPMI-8226 and LIG mRNAs were moderately modified (2.2 6 0.1 and 1.9 6 0.2). An increment of Atg3 (2.5 6 0.4) and Atg7 (2.1 6 0.5) and defective p62 (3.2 6 0.4) levels occurred in LR5-8226, U266, INA-6, and MCC2, whereas they mRNAs were poorly altered in RPMI-8226 and LIG (1.5 6 0.2 and 1.3 6 0.07 and 1.7 6 0.2, respectively). Experiments were in triplicate and bars indicate the meanþSD. Basal levels are untreated cells. Representative panels of LC3 speckled cytoplasmic accumulation by IF were demonstrated in INA-6 after starvation.
increased in INA-6, MCC2, and U266 (3.5 þ 0.3 Dct) as compared to RPMI-8226 (7.9 6 0.9) and LIG (8.4 6 1.1; p ! 0.05), with mRNA values similar to LR5-8226 cells (2.1 6 0.2). Beclin-1 levels were inversely correlated to p62, that appeared up-regulated in RPMI-8226 (3.1 6 0.4) and LIG (2.6 6 0.5), moderately inhibited in INA-6, MCC2, and U266 (6.9 6 0.7; p ! 0.05), and dramatically reduced in LR5-8226 (8.9 6 1.1). The mRNA content of both genes was also investigated in primary cells from both A and B groups. As shown, group A myeloma cells showed high mRNA levels of Beclin-1 (3.1 6 0.4) as compared to p62 (7.6 6 1.2; p ! 0.05), whereas p62 levels were up-regulated in group B (4.1 6 0.5), suggesting an inverse relationship between Beclin-1and p62 levels in primary cells. Therefore, myeloma cells were arbitrarily differentiated as Beclin-1high/p62low (LR5-8226, U266, INA-6, MCC-2, and group A) and, vice versa as Beclin-1low/ p62high (RPMI-8226, LIG, and group B) for the next experiments. These results suggested that Beclin-1/p62 levels in MM cells may predict their potential to undergo apoptosis and, contrarily, the activation of autophagy. Based on these results, we next investigated whether the defective p62 expression in apoptosis-resistant cells was, at least in part, related to different levels of the Atg8/LC3 binding motif of Beclin-1. As shown in Figure 3 (panel B), Atg8/LC3 mRNAs were found up-regulated in both Beclin-1high/p62low cells (4.4 6 0.7 Dct) and group A (5.2 6 0.8) as compared to Beclin-1low/p62high cells
(7.4 6 0.9) and group B (8.4 6 0.9). In addition, WB analysis confirmed that p62 expression was inversely correlated to LC3 in both cell lines and primary MM cells (panel C). Moreover, the lipidation of the Atg8/LC3 complex results from a complex multistep mechanism that following its binding to the autophagosome involves a number of ubiquitin-like proteins. Thus, both Atg3 and Atg7 mRNAs were arbitrarily investigated and their basal levels were found increased in MM cell lines and primary cells independently from Beclin-1and Atg8/LC3 content. Starvation induces autophagy in myeloma cells We further investigated both transcriptional and ultrastructural modifications induced by starvation in myeloma cell lines. As shown in Figure 4 (panel A), starvation of LR58226, U266, INA-6, and MCC2 induced a significant increase of Beclin-1 (4.3 6 1.08 2DDct) and Atg8/LC3 (3.9 6 0.9) as compared to untreated not-starved cells (p ! 0.05), whereas their mRNA levels were slightly modified in both RPMI and LIG. The highest Beclin-1 and Atg8/ LC3 mRNA increase occurred in LR5-8226 (5.8 6 0.9 and 5.1 6 0.6). A parallel increment of Atg3 and Atg7 and defective p62 mRNA levels was observed in LR5-8226, U266, INA-6, and MCC2, while a moderate variation occurred in RPMI-8226 and LIG. LC3 expression was also investigated by IF (Fig. 4, panels B and C) and its speckled localization within the cytoplasm was apparently increased in Beclin-1high/p62low cells (INA-6: 25 6 4 cells/cm2) as
M. Tucci et al./ Experimental Hematology 2014;42:897–908
903
Figure 4. (continued) (B), whereas the untreated cells (C) showed a diffuse LC3 localization. (D) Representative TEM pattern showing the morphological modifications induced by starvation in INA-6 and the formation of a high number of autophagosomes (asterisk), vacuoles of different sizes (300–700 nm) and nuclear defects (5,600 magnification). (E) Magnification at 14,000 of autophagosomes formation. (F) Similar ultrastructural features were also revealed in LR5-8226 (5,600 ). (G) High magnification (36,000 ) of panel F showing the mitochondria alterations in LR5-8226 with prominent cristae and altered membranes mostly due to the hypoxic stimuli induced by chronic stimulation with PAM.
compared to untreated cells showing a diffuse cytoplasmic LC3 accumulation. Starved (32 6 6 cells/cm2) and control LR5-8226 cell line showed a similar LC3 expression (data not shown). TEM also explored the ultrastructural cell modifications induced by starvation. Figure 4 (panel D) shows that starved Beclin-1high/p62low cells (INA-6) accumulate vacuoles of about 300 nm, including partially damaged membranes and digested organelles. Nuclei, endoplasmic reticulum and mitochondria appeared structurally altered, reflecting the effects of oxidative stress induced by starvation. Moreover, a high cytoplasmic accumulation of autophagosomes (asterisk in panel D and at high magnification in E) was demonstrated, formed by body-like vesicles of different sizes up to 700 nm, engulfed by high-density material including lysosomes and digested structures of the endoplasmic reticulum. These ultrastructural modifications were also found in LR5-8226 cells,
regardless of starvation (panel F), in the presence of high number of mitochondria, reflecting the chronic exposure to PAM (panel G). These results provided evidence that the activation of autophagy induced by resistance to apoptosis in myeloma cells is associated with a number of events that produce transcriptional and morphological modifications. Inhibition of autophagy restores apoptosis by upregulating p62 Based on the critical role of autophagy in the development of resistance to apoptosis, Beclin-1high/p62low myeloma cell lines were separately treated with HCQ or RAD001 to verify their autophagy inhibition potential. As shown in Figure 5 (panel A), the viability of myeloma cells was not affected by Dex, HCQ or RAD001 since the AVþ/PIþ cell populations were similar to control cells. By contrast, preliminary stimulation with HCQ followed by Dex increased the size of the
904
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Figure 5. Effect of HCQ on autophagy. (A) Apoptosis measurement by AV/PI staining in Beclin-1high/p62low cells treated with inhibitors of autophagy. As shown, the cell viability was not affected by Dex, HCQ or RAD001, whereas the preliminary treatment with HCQ followed by stimulation with Dex at 103M for 12 hr partially restored the susceptibility of myeloma cells to apoptosis (27 6 3% of AVþ/PIþ cells). On the contrary, RAD001 had no effect. (B) Treatment of Beclin-1high/p62low cells with HCQ followed by Dex inhibited Beclin-1 (7.87 6 1.6 Dct) and up-regulated p62 (3.6 6 0.9) as compared to controls. (C) Further experiments explored the capability of starvation to inhibit apoptosis. The apoptotic susceptibility of Beclin-1low/p62high cells induced by Dex was limited by starvation, whereas RAD001 showed a minor effect that was not boosted by the combination with starvation. (D) The expression of p62 by myeloma cells was down-regulated in both RPMI-8226 and LIG, whereas Beclin-1 levels were up-regulated as compared to untreated cells.
AVþ/PIþ cell population (27 6 3%; p ! 0.05), whereas mTOR inhibitor showed no pro-apoptotic effect. Treatment with HCQ reverted the mRNA levels of both Beclin-1 and p62 (Fig. 5 panel B), that resulted down- (7.87 6 1.6 Dct) and up-regulated (3.6 6 0.9), respectively, as compared to their basal values (p ! 0.05 in both instances). On the contrary, the mRNA levels were not modified by RAD001 (data not shown). The functional interplay between Beclin1 and p62 signaling was further investigated by activating autophagy. As shown in Figure 5 (panel C), starvation limited the sensitivity of Beclin-1low/p62high cell lines to Dex, causing a reduction of AVþ/PIþ cells (27 6 3% vs. 52 6 5%; p ! 0.05). In addition, starvation down-regulated p62 while up-regulating Beclin-1 in both RPMI-8226 (4.3 6 0.8 and 6.4 6 0.8 Dct) and LIG (4.9 6 0.3 and 4.8 6 0.8) with respect to untreated cells (Fig. 5 panel D). Once again, RAD001 showed a minimal pro-apoptotic effect on both the numbers of AVþ/PIþ cell populations and Beclin-1 and p62 expression.
Hydroxychloroquine modifies both LC3 expression and cell morphology As shown in Figure 6 (panel A), LC3 expression by IF of starved INA-6 was impaired by HCQ in terms of numbers of positive cells (10 6 2 cell/cm2) as compared to control cells (Fig. 4 panel B) and the diffuse fluorescence resembling RPMI-8226 (panel B). On the contrary, the number of autophagosomes was lower and the cytoplasmic vesicles showed external membrane damage, while the cytoplasm was full of high-density mitochondria with prominent cristae (panel C). The mitochondrial defect (highest magnification in panel D) was mostly attributable to the permeabilization of their external membrane induced by HCQ. The morphology of HCQ-treated INA-6 resembled that of the control not-starved population used as control (panels E and F). Moreover, stimulation of INA-6 with HCQ followed by Dex induced typical morphological features, such as blebs and nuclear fragmentation, that suggested a partial reactivation of apoptosis (panels G and H).
M. Tucci et al./ Experimental Hematology 2014;42:897–908
905
Figure 6. LC3 expression and ultrastructural modifications induced by HCQ. Representative panels of LC3 expression in INA-6 treated with HCQ (A) showing a reduced, diffuse cytoplasmic accumulation by IF with a similar number of LC3þ cells to RPMI-8226 (B). Ultrastructural modifications induced by HCQ were explored by TEM in INA-6 (C) and showed a low number of autophagosomes (arrow). (D) High magnification (14,000 ) of autophagosomes (arrow in panel C). (E) Basal activation of autophagy in INA-6 cells (5,600 ) producing low numbers of autophagosomes as compared to starved cells and a limited cytoplasm vacuolization (F), whereas the treatment with HCQ followed by Dex partially restored the apoptosis (G; magnification at 7,100 ) as detected by increased nuclear fragmentation and formation of blebs (H, high magnification at 11,000 ).
Discussion Acquired drug resistance depends on various mechanisms including autophagy, which renders myeloma cells resistant to apoptosis via Beclin-1 up-regulation. Here, we provide evidence that the balance between Beclin-1 and p62 expression is critical for the survival of myeloma cells and that, at least in vitro, the inhibition of autophagy overcomes ADR and restores apoptosis.
The issue to define whether autophagy is a deathinduced mechanism or supports the cell survival is controversial, since preliminary studies demonstrated that autophagy controls cellular homeostasis while its abrogation enhances tumorigenesis [23]. This occurs in both breast cancer cell lines with a defective expression of Beclin-1 as well as in Beclin-1þ/ mice showing a strong tendency to develop premalignant lesions and spontaneous
906
M. Tucci et al./ Experimental Hematology 2014;42:897–908
tumors [24,25]. By contrast, other data support the functional role of autophagy in cancer cell survival, since the allelic-loss of Beclin-1 enhances their propensity to undergo apoptosis [26]. We provide evidence that myeloma cells show a different susceptibility to apoptosis that was apparently dependent on Beclin-1 expression, whose highest mRNA levels were found in PAM-resistant cells. In support of this, Beclin-1 was up-regulated in primary MM cells from refractory/relapsed patients and, by contrast, reduced in newly-diagnosed patients. These findings suggest that Beclin-1 activity may indirectly reflect the tumor progression of MM, and emphasize its role in the development of resistance to apoptosis. The fate of cancer cells toward autophagy or apoptosis also depends on p62 expression, which regulates the proteasome degradation of poly-ubiquitinated proteins, osteoclastogenesis, and adipogenesis, whereas its interplay with Beclin-1 is pivotal for the anti-proliferative potential of cytotoxic drugs [27]. Up-regulation of p62 has been described in apoptotic lung cancer cells, whereas Beclin-1 is increased in colorectal cancer cells from patients undergoing clinical progression [28]. This is in line with the effect produced by the long-term treatment of MM cells with proteasome inhibitors resulting in the activation of autophagy that can be promptly restrained by overcoming the bortezomib-induced resistance [29]. We found an inverse correlation between p62 and Beclin-1 levels in primary cells and MM cell lines, whereas the highest p62 expression was present in na€ıve patients. Similarly, low levels of Beclin-1 expression was found inversely correlated to p62 and positively with LC3 in patients with colon cancer showing prolonged overall survival after adjuvant 5-fluorouracilbased chemotherapy [17]. In line with this observation, p62 positively influenced the cell susceptibility to apoptosis while its defect apparently enhanced the proliferation via the LC3/Atg8 binding within autophagosomes. The proapoptotic signals driven by p62 are also controlled by poly-ubiquinated caspase-8 that is cleaved to the active form by Dex [30] and, thus, represents an indicator of susceptibility to apoptosis in MM cells. However, low proteolytic caspase-10 activity is also required for tempering the viability of MM cells since a heterodimeric protease formed of caspase-10 and cFLIPL is used by these cells to balance the pro-survival and pro-death effect of autophagy [31]. High-dose Dex treatment remains an effective therapy for patients with MM [32]. Here, we describe that a number of MM cells exposed to Dex promptly underwent apoptosis at a parallel extent with increased p62 activity. Similar findings have been reported in MCF-7 breast cancer cells incubated with high-dose Dex [14]. Taken together, these data suggest that the p62 levels may reflect the susceptibility of MM cells to apoptosis in treated patients, whereas the increased expression of Beclin-1 is predictive of ADR. Inhibiting autophagy is an innovative approach for overcoming ADR in patients undergoing chemotherapy, whose
effectiveness has recently been demonstrated in glioma [33], breast and colon carcinomas, and in MM [34]. Several inhibitors, including HCQ, restrain autophagy by blocking the transcriptional signals driven by Beclin-1 as well as by damaging the DNA strands, similarly to alkylating agents [35]. Inhibition of autophagy by HCQ enhances the druginduced cell death of MM, lymphoma and HCC cells to an extent similar to that shown by siRNA knockdown of Atg5 as well as Atg3 and Atg7 [34,36,37]. Furthermore, HCQ synergizes with proteasome inhibitors, thus, reinforcing their anti-myeloma effect, whereas thapsigargin inhibits autophagy and induces apoptosis by directly interfering with the endoplasmic reticulum [10,38]. Nevertheless, mTOR inhibitors are currently used for the treatment of several cancers [39] and defective mTORC1 activity occurs in a variety of apoptosis-resistant malignant cells. This may hypothetically imply a tumorigenic potential of RAD001 through the induction of autophagy and down-regulation of p62 [40]. However, a pro-survival effect of RAD001 was not proven in the majority of studies, while targeting the PI3K/ AKT/mTOR pathway inhibits MM cell growth in vitro [41]. We found that the in vitro treatment of Beclin-1high/ p62low MM cells with HCQ overcomes apoptosis resistance and restores cell sensitivity to Dex. In addition, a parallel decline of Beclin-1 expression and up-regulation of p62 were observed, whereas neither the number of apoptotic cells, nor the Beclin-1/p62 levels were significantly affected by RAD001. The interplay between autophagy and apoptosis in MM is also supported by the effect of starvation, which reactivates autophagy while inhibiting apoptosis through Beclin-1 retrieval. Since no tumorigenic effect of RAD001 was detected, we concluded that mTOR inhibitors interfere minimally, at least in vitro, with the proliferative rate of myeloma cells and that Beclin-1/p62 levels efficiently reflect the propensity of MM cells to undergo apoptosis. Ultrastructural cell modifications, with engulfment of digested proteins within autophagosomes, reflect the activation of autophagy machinery. The induction of autophagy by starvation enhances the formation of autophagosomes in a variety of malignant cells [42], including Beclin-1high/ p62low MM cells. The increased numbers of mitochondria showing prominent cristae may reflect the lactate excess that enhances the anaerobic glycolytic flux leading to a growth advantage [43], whereas their structural defect in LR5-8226 may depend on chronic exposure to PAM. HCQ restrains autophagosome fusion and degradation in breast, prostate and lung cancer cells [44]. Here, we demonstrate that it also influences MM cell lines and can restore the cell susceptibility to apoptosis. Ultrastructural modifications induced by autophagy include LC3/Atg8 integration within autophagosomes as a consequence of the activation of Atg7 and Atg3 ubiquitin-like proteins and cleavage of Atg4 that, moreover, are critical for the recruitment of p62 molecules [45].
M. Tucci et al./ Experimental Hematology 2014;42:897–908
Mutations in these motifs as well as mTOR inhibitors reduce p62-mediated transcriptional signals in both normal and malignant cells [35]. In this context, LC3 accumulation in bone marrow of mice bearing MM promotes the proliferation of myeloma cells that, on the contrary, is restrained in LC3/ mice [46]. LC3 expression and a speckled-like accumulation within the cytoplasm of our MM model were correlated with the extent of autophagy and impaired by HCQ, thus, supporting a potential link between LC3 and the activation of autophagy in MM progression. In conclusion, our data emphasize autophagy as a pro-survival mechanism in MM that counterbalances the drug-induced cell death, and supports the detection of Beclin-1/p62 for preliminary evaluations of cell susceptibility to apoptosis. In this context, new strategies designed to disrupt the autophagy cascade, including HCQ, could be beneficial to overcome ADR in MM.
14. 15.
16. 17.
18. 19.
20. 21.
Acknowledgments
22.
This work was funded by a grant (# IG11647) from AIRC (Italian Association for Cancer Research) and from the Italian Ministry of Health, PRIN 2009 (#2009WZHMNJ).
23. 24. 25.
References 1. Palumbo A, Anderson K. Multiple Myeloma. N Engl J Med. 2011; 364:1046–1060. 2. Tucci M, Quatraro C, Dammacco F, Silvestris F. Role of active drug transporters in refractory multiple myeloma. Curr Top Med Chem. 2009;9:218–224. 3. Shammas MA, Shmookler Reis RJ, Koley H, et al. Dysfunctional homologous recombination mediates genomic instability and progression in myeloma. Blood. 2009;113:2290–2297. 4. Popovic R, Licht JD. MEK and MAF in myeloma therapy. Blood. 2011;117:2300–2302. 5. Siegel DS. Relapsed/Refractory multiple myeloma: defining refractory disease and identifying strategies to overcome resistance. Semin Hematol. 2012;49:3–15. 6. Banerji V, Gibson SB. Targeting metabolism and autophagy in the context of haematogical malignancies. Int J Cell Biol. 2012;2012: 595976. 7. Nencioni N, Cea M, Montecucco F. Autophagy in blood cancers: biological role and therapeutic implications. Haematologica. 2013;98: 1335–1343. 8. Xie Z, Klionsky DJ. Autophagosome formation: core machinery and adaptations. Nat Cell Biol. 2007;9:1102–1109. 9. Mathew R, Karantza-Wadsworth V, White E. Role of autophagy in cancer. Nat Rev Cancer. 2007;7:961–967. 10. Hoang B, Benavides A, Shi Y, Frost P, Lichtenstein A. Effect of autophagy on multiple myeloma cell viability. Mol Cancer Ther. 2007;8: 1974–1984. 11. Helgason GV, Karvela M, Holyoake TL. Kill one bird with two stones: potential efficacy of BCR-ABL and autophagy inhibition in CML. Blood. 2011;118:2035–2043. 12. Song J, Qu Z, Guo X, et al. Hypoxia-induced autophagy contributes to the chemoresistance of hepatocellular carcinoma cells. Autophagy. 2009;5:1131–1144. 13. Bellodi C, Lidonnici MR, Hamilton A, et al. Targeting autophagy potentiate tyrosine kinase inhibitor-induced cell death in Philadelphia
26.
27. 28.
29.
30.
31. 32.
33. 34.
35. 36. 37.
38.
907
chromosome-positive cells, including primary CML stem cells. J Clin Invest. 2009;119:1109–1123. Jain K, Paranandi KS, Sridharan S, Basu A. Autophagy in breast cancer and its implications for therapy. Am J Cancer Res. 2013;3:251–265. Hou W, Han J, Lu C, Goldstein LA, Rabinowich H. Autophagic degradation of active caspase-8: a crosstalk mechanism between autophagy and apoptosis. Autophagy. 2010;6:891–900. Moscat J, Diaz-Meco MT. p62 at the crossroads of autophagy, apoptosis and cancer. Cell. 2009;137:1001–1004. Myung Park J, Huang S, Wu TT, Foster NR, Sinicrope FA. Prognostic impact of Becli-1, p62/sequestosome-1 and LC3 protein expression in colon carcinomas from patients receiving 5-fluorouracil as adjuvant chemotherapy. Cancer Biol Ther. 2013;14:100–107. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Ann Rev Genet. 2009;43:67–93. Meister S, Schubert U, Neubert K, et al. Extensive immunoglobulin production sensitizes myeloma cells for proteasome inhibition. Cancer Res. 2007;67:1783–1792. Ikeda H, Hideshima T, Fulciniti M, et al. PI3K/p110{delta} is a novel therapeutic target in multiple myeloma. Blood. 2010;116:1460–1468. Mauri~no GS, Alcaide A, Domınguez C. Pharmacological control of autophagy: therapeutic perspectives in inflammatory bowel disease and colorectal cancer. Curr Pharm Des. 2012;18:3853–3873. Cheong H, Lu C, Lindsen T, Thompson CB. Therapeutic targets in cancer cell metabolism and autophagy. Nat Biotechnol. 2012;30:671–678. Gewirtz DA. The four faces of autophagy: implications for cancer therapy. Cancer Res. 2014;74:647–651. Karantza-Wadsworth V, White E. Role of autophagy in breast cancer. Autophagy. 2007;3:610–613. Yang ZJ, Chee CE, Huang S, Sinicrope F. Autophagy modulation for cancer therapy. Cancer Biol Ther. 2011;11:169–176. Chen S, Rehman SK, Zhang W, Wen A, Yao L, Zhang J. Autophagy is a therapeutic target in anticancer drug resistance. Biochem Biophys Acta. 2010;1806:220–229. Mathew R, Karp C, Beaudoin B, et al. Autophagy suppresses tumorigenesis through elimination of p62. Cell. 2009;137:1062–1075. Koukourakis MI, Giatromanolaki A, Sivridis E, Pitiakoudis M, Gatter KC, Harris AL. Beclin-1 over- and under-expression in colorectal cancer: distinct patterns relate to prognosis and tumour hypoxia. Br J Cancer. 2010;103:1209–1214. Landoswki T, Escalante AM, Jefferson A, et al. Inhibition of autophagy promotes bortezomib-mediated cell death in myeloma cells. Blood. 2008;112. Abstract 1259. Herr I, Gassler N, Friess H, B€uchler MW. Regulation of differential pro- and anti-apoptotic signaling by glucocorticoids. Apoptosis. 2007;12:271–291. Lamy L, Ngo VN, Tolga Emre NC, et al. Control of autophagic cell death by caspase-10 in multiple myeloma. Cancer Cell. 2013;15:1–15. Richardson PG, Sonneveld P, Schuster MW, et al. Bortezomib or highdose dexamethasone for relapsed multiple myeloma. N Engl J Med. 2005;352:2487–2498. Chen N, Karantza-Wadsworth V. Role and regulation of autophagy in cancer. Biochem Biophys Acta. 2009;1793:1516–1523. Pan Y, Gao Y, Chen L, et al. Targeting autophagy augments in vitro and in vivo antimyeloma activity of DNA-damaging chemotherapy. Clin Can Res. 2011;17:3248–3258. Janku F, McConkey DJ, Hong DS. Autophagy as a target for anticancer therapy. Nature Rev Clin Oncol. 2011;8:528–539. Yang ZJ, Chee CE, Huang S, Sinicrope F. The role of autophagy in cancr: therapeutic implications. Mol Cancer Ther. 2011;10:1533–1541. Li J, Yang B, Zhou Q, et al. Autophagy promotes hepatocellular carcinoma cell invasion through activation of epithelial-mesenchymal transition. Carcinogenesis. 2013;34:1343–1351. Shen PYC, Divakaran S, Ponduru S, Vogl DT, Amaravadi RK, Bradner JE. The rationale for combined proteasome and autophagy inhibition
908
M. Tucci et al./ Experimental Hematology 2014;42:897–908
in multiple myeloma established using novel translational platforms. Blood. 2008;112. Abstract 951. 39. Dancey J. mTOR signaling and drug development in cancer. Nature Rev Clin Oncol. 2010;7:209–219. 40. Huang S, Yang ZJ, Yu C, Sinicrope FA. Inhibition of mTOR kinase by AZD8055 can antagonize chemotherapy-induced cell death through autophagy induction and down-regulation of p62/sequestosome-1. J Biol Chem. 2011;286:40002–40012. 41. Aronson LI, Davenport EL, Mirabella F, Morgan GJ, Davies FE. Understanding the interplay between the proteasome pathway and autophagy in response to dual PI3K/mTOR inhibition in myeloma cells is essential for their effective clinical application. Leukemia. 2013;27:2397–2403.
42. Klionsky DJ, Abeliovich H, Agostinis P, et al. Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy. 2008;4:151–175. 43. Maiuri MC, Zalckvar E, Kimchi A, et al. Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nat Rev Mol Cell Biol. 2007;8:741–752. 44. Amaravadi RK, Lippincott-Schwartz J, Yin XM, et al. Principles and current strategies for targeting autophagy for cancer treatment. Clin Cancer Res. 2011;17:654–666. 45. Nishida Y, Arakawa S, Fujitani K. Discovery of Atg5/Atg7independent alternative macroautophagy. Nature. 2009;461:654–658. 46. Tanida I, Ueno T, Kominami E. LC3 and autophagy. Methods Mol Biol. 2008;445:77–88.
M. Tucci et al./ Experimental Hematology 2014;42:897–908 Supplementary Table 1. Autophagic factors and relative primers for Real Time PCR amplification Genes Beclin-1 p62 Atg3 Atg7 Atg8/LC3
Primers Fw- CACGAGTTTCAAGATCCTGGACCG Rev- AATCTGCGAGAGACACCATCCTG Fw- CGGCACTCTCTATGGAAAACA Rev- CGCAAGCTTAACACAACTATG Fw- ATCACAACACAGGTATTACAG Rev- TCCTCATCTTCATCTTCTTCC Fw- AACCAAAGCAGCAAGGAGC Rev- ATTCATCCGATCGTCACTGCTGC Fw- GAGAAGCAGCTTCCTCTTCTGG Rev- GTGTCCGTTCACCAACAGGAG
908.e1
