Plant Molecular Biology 20: 821-831, 1992. © 1992 Kluwer Academic Publishers. Printed in Belgium.

821

An mRNA that specifically accumulates in maize roots delineates a novel subset of developing cortical cells Isaac John 1, Huiqing Wang, Bruce M. Held, Eve Syrkin Wurtele and James T. Colbert * Department of Botany, Iowa State University, Ames, Iowa 50011-1020, USA (* author for correspondence); 1present address: Department of Physiology and Environmental Science, University of Nottingham School of Agriculture, Sutton Bonington, Loughborough, Leicestershire LE12 5RD, UK Received 15 November 1991; accepted in revised form 8 July 1992

Key words: cortex, developmental regulation, in situ hybridization, organ-specific gene expression, roots, Zea mays

Abstract

A near full-length cDNA clone (pZRP3) corresponding to an mRNA that accumulates specifically in roots of maize was isolated. The ZRP3 mRNA is ca. 600 nucleotides in length. The amino acid sequence of the predicted polypeptide is rich in leucine (16 ~o), proline (11 70), and cysteine (8.5 ~o). The zrp3 gene appears to be expressed exclusively in roots, whereas other ZRP3-related genes are expressed in additional organs of the maize plant. In situ hybridization shows that ZRP3 mRNA accumulation is largely confined to the cells of the cortical ground meristem. Furthermore, accumulation of this mRNA occurs within a distinct subset of cortical cells, the inner three to four cell layers.

Introduction

Roots are the plant organ specialized for anchorage, absorption, storage, and conduction. They interact with the plant shoot, providing developmental signals which alter shoot growth. Unlike shoots, the root apical meristem grows without the patterned addition of lateral organs. To enable the plant to survive and grow, roots must have the ability to continually alter their patterns of growth in response to the varied soil environ-

merit that they inhabit. During primary growth of roots, the root apical meristem gives rise to the three primary meristems: protoderm, ground meristem, and procambium. These primary meristems are regions of frequent cell division and differentiate into epidermis, cortex, and vascular cylinder, respectively [14, 35]. Root tips consist of a developmental gradation of dividing, elongating, differentiating, and fully differentiated cells. Plant organs express unique and overlapping

Journal paper number J-14572 of the Iowa Agriculture and Home Economics Experiment Station, Ames, Iowa Project Number 2997. The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number Z12103.

822 sets of mRNAs [21, 22]; such differential gene expression provides the basis for plant development and specialization of function. Most molecular investigations of tissue- and cell-type specific gene expression have focused upon aerial organ systems [10, 12, 16, 17, 24, 38, 40]. Despite the important function of roots in plant growth and their distinctive pattern of development, the isolation and characterization of genes expressed specifically in roots has received relatively little attention [5, 15, 23, 28, 32, 33]. To begin an investigation of the molecular control of maize root development and function, we screened for genes expressed preferentially in maize roots. Here, we report the isolation and the characterization of pZRP3, a cDNA clone corresponding to an mRNA that accumulates specifically during maize root development in cells of the cortical ground meristem.

described by Murray et al. [34] and modified by Lissemore et al. [29].

Materials and methods

For random screening, the cDNA library was plated at low density (100-200 plaques/plate). Single plaques were cored and plasmids isolated using the in vivo excision procedure [37] with the helper phage R408. Plasmids containing the cDNA inserts were isolated using Qiagen columns (Qiagen). Isolated plasmids were screened for root preferential expression, as will be described for differential screening. Differential screening was performed using single-stranded cDNA probes synthesized from poly(A) ÷ RNA isolated from nine-day-old roots or nine-day-old shoots. Single stranded cDNA probes were synthesized using cDNA Synthesis System Plus (Amersham) with slight modification to label the cDNA to higher specific activity with 32p. About 10000 plaques were plated onto 100mm x 15 mm Petri plates. Duplicate nitrocellulose replicas were lifted from each plate and treated according to standard methods [7]. Hybridization conditions were as described by Gasser et al. [ 16]. Plaques hybridizing preferentially with cDNA derived from roots were plated and screened again at densities 100 to 200 plaques per plate. Single plaques chosen after secondary screening were in vivo excised, and the plasmids were isolated. Root preferential accumulation of

Growth of plants

Maize (Zea mays cv. NKH31) plants were grown either under standard greenhouse conditions for three weeks or on germination paper at 30 ° C for nine days under a 16 h light/8 h dark cycle in a growth chamber. Approximately 50 seeds were planted on germination papers which were rolled and placed inside a polyethylene basket containing 1 1 of distilled water. Roots and shoots were harvested, frozen in liquid nitrogen immediately, and stored at -80 °C. Plants in the field were grown under normal agronomic conditions at the Iowa State University Agronomy Research Station during the summer of 1990. Only mature portions of the root system were harvested from the field-grown plants. R N A isolation

Total RNA was isolated from roots and different maize organs according to the procedures described by Dean et al. [8], with modifications as described [11]. Poly(U) sephadex columns were used to purify poly(A) + RNA from total RNA as

Construction of maize root cDNA library

The cDNA synthesis reaction was primed with oligo-dT, using poly(A) + RNA isolated from nine-day-old roots. Double-stranded cDNA was synthesized with cDNA Synthesis System Plus (Amersham), according to the manufacturer's instructions. Blunt-ended double-stranded cDNA was ligated to Eco RI adapters, cloned into the 2ZAPII vector from Stratagene, and packaged in vitro using Gigapack Gold packaging extract (Stratagene).

cDNA library screening

823 the mRNAs corresponding to the positive plasmids was confirmed using slot blots containing immobilized poly(A) + RNA from roots and shoots probed with nick-translated plasmids isolated from putative root preferential clones.

DNA sequence analysis

The cDNA clone pZRP3 was sequenced at the Iowa State University Nucleic Acids Facility, according to the dideoxy-nucleotide chain termination method [36] with double-stranded DNA templates [4]. The 440 bp Hind III fragment including a short polylinker region 5' to the upstream Eco RI site of pZRP3 (Fig. 1D) was subcloned into pBluescript (SK) and designated pZRP3.2. This subclone contained the 5'untranslated and coding region of pZRP3. The remaining plasmid DNA containing the 3' untranslated region was religated and designated pZRP3.1. The 200 bp Eco NI/Eco RV (i.e., using the E c o R V site present in the pBluescript polylinker) fragment of pZRP3.2 was subcloned into Eco RV-digested pBluescript (KS) and designated pZRP3.22, pZRP3.2 was religated without the Eco NI/Eco RV fragment, and the resulting clone, designated pZRP3.21, contained the pZRP3 coding region. The three subclones pZRP3.1, pZRP3.21, and pZRP3.22 were sequenced at least twice in both directions with M13 forward and reverse primers. Restriction sites used for subcloning were sequenced across, using the pZRP3 and pZRP3.2 clones. Nucleotide sequencing was carried out with an Applied Biosystems Model 373A DNA sequencer, version 1.0.2. DNA sequence data were analyzed with the University of Wisconsin Genetics Computer Group (UWGCG) package [9]. Hydropathy analysis was performed using the DNA Strider program [30].

RNA gel blot analysis

RNA gel blot analysis and hybridization conditions were performed as described in Cotton et al.

[6]. Briefly, nylon membranes (GeneScreen, New England Nuclear) with immobilized RNA were prehybridized (50~o (v/v) deionized formamide, 10~o (w/v) dextran sulfate, 1 M NaC1, 2~o (w/v) SDS) at 65 °C for 4-6 h. For hybridization denatured salmon sperm DNA (100 #g/ml) and 32P-labeled RNA probe (0.5 to 1.0 x 10 6 cpm/ml) were added to the prehybridization buffer. Hybridization was carried out at 65 °C for 16to 18h with constant agitation. The final posthybridization wash was at 65 °C in 0.1 x SSC (1 x SSC is 0.15 M NaC1, 0.015 M trisodium citrate, pH 7.0), 0.1~o (w/v) SDS. RNA size standards were from Bethesda Research Laboratories. In vivo excised plasmids from the 2ZAPII vector contain cDNA inserts in the pBluescript (SK) vector. To produce full-length and 3'untranslated antisense RNA probes, pZRP3 and pZRP3.1 were linearized with Xho I and transcribed with T3 RNA polymerase. Sense and antisense probes for the coding region were produced by linearizing pZRP3.21 with Eco RI or Hind III and transcribing with T3 or T7 polymerase. The subclone pZRP3.21 was used to generate probes for in situ hybridization experiments.

In situ hybridization In situ hybridization studies with paraffin-embedded sections were carried out as described by Ausubel et al. [2], with modifications as follows. 35S-RNA probes of approximately 0.2 kb were synthesized from pZRP3.21. Root sections were fixed with 4~o paraformaldehyde and 0.25~o glutaraldehyde in 0.05 M Pipes buffer [2]. Pretreatment with 2/~g/ml Proteinase K was for 30 min. Hybridization solution was as described [2], except that 10~o dextran sulfate was used instead of 10~o polyethylene glycol and the hybridization temperature was 65 ° C. After hybridization, the root sections were incubated with 20#g/ml RNAse A and washed at 65 °C in a solution containing 1 x SSC and 0.1~o SDS. Slides with hybridized tissue sections were coated with nuclear track emulsion (Kodak, NTB2), exposed for

824 12 h to 48 h and developed. Photographs were taken with a Leitz microscope with either brightfield or dark-field illumination.

Results

preferentially in roots. We designated these clones p Z R P (Zea Root Preferential) 2 to 4. The c D N A clones pZRP2, 3, and 4 correspond to m R N A s of 2.5, 0.6, and 1.4 kb, respectively [ 18]. We chose to further characterize pZRP3 because of its small size and the relatively high abundance of the corresponding mRNA.

Construction of the maize root cDNA library

Poly(A) + R N A was isolated from maize roots of 9-day-old seedlings grown on germination paper. The growth of the seedlings on germination paper enabled the harvest of complete root systems, including root hairs. The R N A was used as the template to construct a maize root c D N A library in the bacteriophage vector 2ZAPII [37]. The average size of c D N A inserts was approximately 1 kb, and the library contained about 5 x 102 recombinants.

Isolation of cDNA clones corresponding to mRNAs that accumulate preferentially in roots

Initially, we attempted to isolate c D N A clones of m R N A s that accumulate preferentially in roots by randomly selecting 25 independent recombinant clones as described [15]. c D N A clones randomly selected in this manner were not expressed preferentially in roots of maize. Subsequently, we used a differential screening strategy to identify c D N A clones of m R N A s accumulating preferentially in roots. Single-stranded c D N A probes from poly(A) + R N A isolated from roots and poly(A) + R N A isolated from shoots of 9-day-old maize seedlings were used to probe duplicate plaque lifts. After secondary screening, single plaques showing stronger hybridization to the root c D N A probe were chosen for further characterization. Plasmids containing the c D N A inserts were obtained from potential positive plaques by in vivo excision [37]. Root preferential expression was verified by slot blot analysis with poly(A) + R N A from roots and shoots probed with nick translated plasmids. From about 102 000 plaques, three distinct c D N A clones were confirmed to represent m R N A s accumulating

Accumulation of Z R P 3 mRNA in various maize organs

Figure 1 shows the hybridization of 32p-labeled antisense R N A probes derived from distinct regions of the pZRP3 c D N A clone (Fig. 1D) to R N A gel blots of total R N A isolated from roots harvested at different developmental stages and from other maize organs. R N A gel blot analysis revealed that the R N A probe synthesized from the full-length c D N A clone (pZRP3) hybridized to an m R N A of about 600 nucleotides (Fig. 1A). This m R N A was abundant in the root systems harvested from three-week-old greenhouse-grown plants (GR) and from nine-day-old germination paper grown seedlings (RPA + ), but not detectable in the mature roots harvested from fieldgrown plants at pollination (FR). Other organs exhibited weak to nondetectable hybridization with the pZRP3 full-length antisense R N A probe (Fig. 1A). The m R N A hybridizing to the ZRP3 probe in ears at pollination (EP), ears 10 days after pollination (El0), mature leaves (L), and poly(A) + R N A from three-week-old greenhousegrown plants (LPA + ) was about 100 nucleotides longer than the ZRP3 m R N A detected in roots (Fig. 1A). R N A gel blots of the same R N A samples were then probed with an antisense R N A probe (pZRP3.21) derived exclusively from the coding region of the ZRP3 m R N A (Fig. 1B). Greenhouse-grown roots (GR), mature leaves (L), ears at pollination (EP), and ears 10 days after pollination (E 10) exhibited strong hybridization, but other organs exhibited weak (stem [St] and tassle [T]) or no detectable (field-grown mature roots [FR] and silk [Si]) hybridization. Genomic Southern blot analysis indicated that the gene encoding ZRP3 m R N A was a member

825 but not identical, to ZRP3 mRNA, a probe derived from the 3'-untranslated region (pZRP3.1) was used (Fig. 1C). This region would be expected to be less conserved, among members of a multigene family, than the coding region. The pZRP3.1 probe hybridized only to total RNA isolated from greenhouse-grown roots (GR) and to poly(A) ÷ RNA isolated from nine-day-old growth chamber-grown roots. Figure 2A is a control in which the same RNA samples probed for ZRP3 and ZRP3-related mRNAs were probed with an antisense RNA probe for chlorophyll a/b-binding protein (cab) m R N A [ 11]. Cab m R N A was present at high levels in leaves but was nondetectable in roots, as expected (Fig. 2A). Cab m R N A was also present at high levels in silks and tassels, and at lower

(D) EcoRI

IIAUG

EcoNI I

HInDIII I

I

I I

EcoRI I full-length

oodl.g I

3' untranslated

100 bases Fig. i. Abundance ofZRP3 mRNA in various maize organs. Total RNAs were isolated from roots of three-week-old greenhouse-grown plants (GR) and from other organs harvested from field-grown plants at pollination: root (FR), stem (St), leaf(L), ear at pollination (EP), ear 10 days after pollination (El0), silk (Si), and tassel (T). Poly(A) + R N A was isolated from 9-day-old growth chamber grown-roots (RPA + ), and from 3-week-old greenhouse-grown leaves (LPA + ). Total RNA (10 #g) and poly(A) + R N A (0.5/~g, root; 1.0/~g, leaf) was fractionated by electrophoresis in a 3 % formaldehyde/1% agarose gel. After electrophoresis the RNA samples were transferred to a nylon membrane and hybridized with 32p_ labeled antisense RNA probes. The full-length probe was derived from pZRP3, the coding region probe from pZRP3.21, and the 3' -untranslated region probe from pZRP3.1. The sizes of the RNAs used as molecular weight markers are indicated.

of a small multigene family [18, and data not shown]. To test whether the mRNAs observed in organs other than roots might be mRNAs related,

Fig. 2. Accumulation of chlorophyll a/b-binding protein (cab) mRNA in various maize organs and visualization of total RNA samples stained with ethidium bromide, A. RNA sampies are as described in the legend to Fig. 1. The samples were hybridized with an antisense RNA probe for cab. B. Ethidium bromide staining of total RNA samples from various maize organs. Prior to blotting the RNA samples probed for ZRP3 (Fig. 1) and cab, the samples were stained with ethidium bromide and photographed on a UV light-emitting transilluminator to verify that approximately equal masses of RNAs were loaded into each lane.

826 levels in stems and developing ears. Ethidium bromide staining of the total R N A samples was used to verify that approximately equal masses of total R N A were analyzed for ZRP3 m R N A abundance (Fig. 2B).

Z R P 3 m R N A accumulates in a distinct subset of the root cortical cells

The optimal probe length for in situ hybridization is 30 to 300 nucleotides [2]. Therefore, in situ hybridization to investigate the spatial distribution of ZRP3 m R N A in developing roots was performed with 35S-labeled antisense R N A probes derived from pZRP3.21 (containing the ca. 200 nucleotide coding region). The maximal rate of cell division in the Z e a mays root is about 1.25 mm from the root apex [13]. The region of cellular elongation overlaps with the region of cell division. The region of maximum cell elongation is about 4 mm from the root apex; minimal cell division occurs in this region [13]. Figure3A shows a longitudinal section of a maize root tip. ZRP3 m R N A accumulated at low levels in the cells of the apical meristem that appear to give rise to the cortical ground meristem. ZRP3 m R N A was most abundant in the inner region of the cortical ground meristem from about 0.5 mm to 2 mm behind the root tip (Fig. 3A) in the region of maximal cell division. Low levels of ZRP3 m R N A accumulated in the inner cortical cells near the region of maximal cellular elongation. Fig. 3B is a control in which a longitudinal section of maize root similar to that in Fig. 3A was hybridized to the sense ZRP3.21 R N A probe. Figures 4A to 4F show in situ hybridizations to transverse sections of maize roots, and confirm and expand the results from the longitudinal sections. ZRP3 m R N A accumulated at low levels in the region of the apical meristem from which the cortex would be derived (Fig. 4C and 4F). The greatest accumulation of ZRP3 m R N A was observed in the cortical ground meristem ca. 2 mm behind the root tip (Fig. 4B and 4E). In this region, the ZRP3 m R N A accumulated in the inner three to four cell layers of the cortical ground

Fig. 3. Localization of ZRP3 mRNA by in situ hybridization to longitudinal sections of maize root. A. Bright-field photograph of a longitudinal section hybridized with the antisense ZRP3.21 RNA probe. The black spots are silver grains and represent ZRP3 mRNA accumulation. B. Control for A, using sense ZRP3.21 RNA as probe. The positions of the root cap (rc), apical meristem (am), protoderm (p), cortical ground meristem (c), and procambium (pc) are indicated. The bar equals 0.1 mm.

meristem. A much lower level of ZRP3 m R N A accumulated in the inner cortical cells present at about 4 mm behind the root tip (Fig. 4A and 4D). The immature pith cells in this region had ZRP3 m R N A levels similar to those of the cortical cells present at about 4 mm behind the root tip (Fig. 4A and 4D). ZRP3 m R N A was not detectable in the procambium, vascular cylinder, protoderm, epidermis, endodermis, root cap, or the outer cell layers of the cortex. Control sections, hybridized to the sense ZRP3 probe, are shown in Fig 4G to 4I.

827

Fig. 4. Localization of ZRP3 mRNA by in situ hybridization to transverse sections of maize root tip. Panels A, B, and C.

Bright-field photographs of transverse sections through the root tip hybridized with the antisense pZRP3.21 R N A probe. Sections were made at the level of the apical meristem (C), about 2 mm behind the root tip (B), and about 4 mm behind the root tip (A). The positions of the epidermis (e), cortex (c), and vascular cylinder (v) are indicated in panel A. The bar equals 0.1 mm. Panels D, E, and F. Dark-field photographs of the transverse sections shown in A, B, and C, respectively. The white spots are silver grains and represent ZRP3 mRNA accumulation. Panels G, H, and I. Controls for D, E, and F, using sense R N A probe.

The nucleotide and predicted amino acid sequence of pZRP3 Figure 5 shows the complete nucleotide sequence of pZRP3. The c D N A clone is 594 bp long, excluding the poly(A) tail. An open reading frame begins with an ATG initiation codon at nucleotide 21 and ends with a stop codon TAA at nucleotide 410. The ATG is preceded by a consensus Kozak sequence (CCACC) [19,26]. A putative polyadenylation signal sequence (AATAAG) occurs 25 nucleotides 5' of the poly(A) tail [20, 42]. Comparison of m R N A and

c D N A insert sizes indicates that pZRP3 is close to full-length. The predicted protein consists of 129 amino acids with a calculated molecular mass of 13.5 kDa. The predicted ZRP3 amino acid sequence is rich in both leucine residues (16~o), which are distributed throughout the predicted polypeptide, and proline residues (11 ~o), which are most frequent between amino acid positions 24 and 49. Eleven cysteines (8.5~o) are distributed throughout the polypeptide between amino acid 22 and the carboxy terminal end. A potential glycosylation site [251 is present at amino acid position 25. A proline motif P-V-V-P-T-P is

828 i0 30 50 GT~CAGTCCATCACCACC~T~CTCCCAAGGTTGCGCTCTTCCTTGCCCTGAGCCTCC M A P K V A L F L A L S L L 70 90 Ii0 TGTT~CTGCCACCGCGCA~GCTGCG~CCC~CTGTTCTGGCCCAGTCGTCCC~CGC 1 5 F A A T A * H G * C E P N C S G P V V P T P 130 150 170 CGCCAGTCGTGCCGACTCCGTCGTCGCACAGCCACGGGCGCTGCCCGATCGACGCGCTCA 3 5 P V V P T P S S H S H G R C P I D A L K 190 210 230 AGCTC~GG~TGCGCCAAAG~CTAGGCCTCGTC~GGTCGGCCTACCCCAGTACGAGC 5 5 L K V C A K V L G L V K V G L P Q Y E Q 250 270 290 ~TGCTGCCCGTTGCTGGAGGGTCTGGTGGACCTCGACGCCGCATTGTGCCTCTGCACCG 7 5 C C P L L E G L V D L D A A L C L C T A 310 330 350 CCATC~GGCC~CGTCCTCGGCATCCACCTC~CGTGCCCCTTAGCCTC~CTTCATCC 9 5 I K A N V L G I H L N V P L S L N F I L 370 390 410 TC~C~C~CGGCA~ATTTGCCCAGAGGACTTCACTTGCCCC~CT~GCTTGGGATC I I 5 N N C G R I C P E D F T C P N S t o p 430 450 470 CCTTGTGTGCTCCATCTCGCGATTCTATTTACGAGCATGTCGGCCTCTTGC~TATTAGC 490 510 530 G~T~GTTTGTCGTTTCAAATTCTTTCGCTGTACCATCGACGAT~TATTTGTGTGGAG 550 570 590 TTATATTTGAAATTTT~TGATC~GAAATATTCGTGTTTTTTATTTTGAGA~AAA AAAAAAAAA

Fig. 5. The nucleotide and predicted amino acid sequence of the p Z R P 3 c D N A clone. The predicted Z R P 3 amino acid sequence corresponding to the open reading flame extending ~om position 21 to 410 is shown beneath the ZRP3 nucleotide sequence. Bold letters in the nucleotide sequence indicate the putative K o z ~ sequence, start codon, stop codon, and putative polyadenylation sisal. The putative s i g n sequence cleavage sites are indicated by an asterisk. The a ~ n o acid residues of the dkect PVVPTP repeat, and the potential glycosylation signal sequence are underlined.

present two times in the polypeptide. As shown in Fig. 6, hydropathy analysis indicates a predominance of hydrophobic amino acids and a stretch of hydrophylic amino acids between positions 30 and 50. A putative signal sequence is also present at the amino terminus (residues 1-21) of the polypeptide.

J

X "O ._=

I

I I

I

I

I

I

i I

i00 I I

I

3

--3

2

2

Search of the EMBL database revealed significant homology (58~o identity at the nucleotide level and 51 ~o at the amino acid level) of pZRP3 to a single published sequence; the carrot cDNA clone DC 2.15. This cDNA represents an mRNA that accumulates during somatic embryogenesis in carrot suspension cultures [1]. The pZRP3 nucleotide sequence is also 64~o identical to a 195 base region of pEMB3, a partial cDNA sequence representing an mRNA distinct from the DC 2.15 mRNA but also accumulating in carrot somatic embryos (E.S. Wurtele, unpublished data).

r-

O "O "

-1

-1

-2

-2

°1

i

J I

il

amino

i

I

acid

II

I II 100

°

number

Fig. 6. Hydropathy profile of the amino acid sequence predicted from the c D N A clone pZRP3. A computer-generated hydropathy profile (window of 11 consecutive amino acids) of the predicted ZRP3 protein was calculated according to Kyte and Doolittle [27] and plotted against the amino acid number using the D N A Strider program [30].

Discussion We are interested in the molecular mechanisms controlling root development and function in higher plants. Thus, we have isolated cDNA clones corresponding to mRNAs that accumulate preferentially in roots. The ZRP3 mRNA appears to specifically accumulate in the cortical ground meristem of young roots. We conclude that the

829 ZRP3 m R N A does not accumulate to substantial levels throughout the root system because the m R N A was not detectable in total RNA isolated from mature roots of field-grown plants. However, we have not yet investigated the possibility that environmental factors, such as field growth conditions, may affect ZRP3 m R N A accumulation. Our results indicate that ZRP3 is a member of a multigene family. ZRP3 m R N A accumulates in young regions of roots whereas related members of this gene family accumulate in other organs of the maize plant. The evidence for this is threefold. First, Southern analysis using the entire ZRP3 c D N A as a probe is consistent with the presence of several zrp3-related genes in the maize genome [18, and data not shown]. Second, the ZRP3 m R N A in young roots is smaller than the ZRP3related mRNAs detected in other organs. Although this could result from alternative splicing of the primary transcript from a single gene, it is clearly possible that related versions of the zrp3 gene could transcribe a larger mRNA. Third, RNA blot analysis indicates that the 3'-untranslated sequence of the ZRP3 m R N A hybridizes to an RNA isolated from young roots but does not hybridize at a detectable level to total RNA isolated from mature stems, mature leaves, developing ears, silks, or tassels. Even poly(A) + RNA isolated from maize leaves shows no detectable hybridization to RNA probe from the 3'untranslated sequence. In contrast, the coding sequence of ZRP3 m R N A strongly hybridizes to total RNA isolated from young roots, mature leaves, and developing ears of maize. The 3'untranslated region is likely to be less conserved than the amino acid coding sequence among members of the zrp3 gene family, and thus would be expected to hybridize specifically to the ZRP3 mRNA. Our current data do not preclude the possibility that additional members of the zrp3 gene family are also expressed in roots. The deduced ZRP3 amino acid sequence is rich in prolines but shows no significant homology to either of the two classes of proline-rich cell wall proteins described so far [ 3]. The structural cell wall proteins are characterized by basic re-

peat motifs differing between the classes: Serine(Hydroxyproline)4 for hydroxyproline-rich glycoproteins, and Proline-Proline-X-Y for proline-rich proteins (PRPs). These cell wall proteins include a signal sequence and exhibit organ- and tissuepreferential expression. The predicted ZRP3 polypeptide also has a putative signal sequence and exhibits organ- and tissue-specific accumulation. The ZRP3 polypeptide, however, is quite distinct from both the HRGPs and the PRPs. The proline content (11 ~o) of ZRP3 is much lower than that of either the HRGPs or the PRPs (30 to 40 ~/o); furthermore, the proline repeat motifs of HRGPs and PRPs are not present in the ZRP3 polypeptide. Whether the prolines of the ZRP3 polypeptide are posttranslationally modified to hydroxyproline remains to be determined. In addition, in contrast to the HRGPs and PRPs, the ZRP3 polypeptide has a high cysteine content. Although the ZRP3 polypeptide is of unknown function, clues as to its possible biological role are available from its amino acid sequence and its pattern of expression. The predicted amino acid sequence of ZRP3 is rich in leucine (16~o). However, the leucines are not arranged in the leucine zipper motif characteristic of some D N A binding proteins [ 39, 41 ]. The cysteine residues may form disulfide bonds and confer a rigid structure on the protein; alternatively, the cysteines may function to bind heavy metals. The presence of both a putative signal peptide and the large hydrophobic region between amino acids 80 and 110 is consistent with ZRP3 polypeptide being a membrane protein. The ZRP3 m R N A accumulates in the developing cortex of maize roots. Depending on the stability of the ZRP3 polypeptide, it might be present in more mature inner cortical cells, i.e., further from the root tip than is the ZRP3 mRNA. The maximal distribution of ZRP3 m R N A is limited to the inner three to four cell layers of the cortical ground meristem. The distribution of ZRP3 therefore biochemically delineates a subset of cortical cells not previously reported. These inner cortical cells are adjacent to the procambium, and thus it is possible that ZRP3 is involved in some aspect of transport of molecules to or from the vasculature. Alternatively, the

830 ZRP3 polypeptide may be involved in regulating some aspect of the differentiation of the inner cortical cells. The sequence and characteristics ofpZRP3 are distinct from the root-specific clones isolated so far [5, 23, 28, 32]. Notwithstanding, pZRP3 does exhibit strong homology to two carrot cDNA clones: DC 2.15 [1] and pEMB3 (E.S. Wurtele, unpublished data), which encode two related polypeptides of unknown function. Both carrot clones correspond to mRNAs induced during somatic embryogenesis. The region(s) of the somatic embryo in which they accumulate has not yet been reported. We are presently investigating the regulation of zrp3 gene expression and the function of the ZRP3 polypeptide in relation to root development.

Acknowledgements We thank Dr Michael Lee, ISU, Department of Agronomy, for growing maize plants in the field, Iffat Rahim, Department of Botany, for helping us use the UWGCG package. We are also grateful to Dr Jack Homer arid Mark Chamberlin, Department of Botany, for invaluable advice on histology. This work was supported by a grant from Northrup King and Sandoz Crop Protection, the ISU office of Biotechnology, and by the MART project of the Pakistan Agricultural Research Council/United States Agency for International Development.

References 1. Aleith F, Richter G: Gene expression during induction of somatic embryogenesis in carrot cell suspensions. Planta 183:17-24 (1990). 2. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K: Current Protocols in Molecular Biology. Greene/Wiley-Interscience, New York (1989). 3. Cassab GI, Varner JE: Cell wall proteins. Annu Rev Plant Physiol 39:321-353 (1988). 4. Chen EY, Seeburg PH: Supercoiled sequencing: A fast and simple method for sequencing plasmid DNA. DNA 4:165-170 (1985).

5. Conkling MA, Cheng C-L, Yamamoto YT, Goodman HM: Isolation of transcriptionally regulated root-specific genes from tobacco. Plant Physiol 93: 1203-1211 (1990). 6. Cotton JLS, Ross CW, Byrne DH, Colbert JT: Downregulation of phytocbrome mRNA abundance by red light and benzyladenine in etiolated cucumber cotyledons. Plant Mol Biol 14:707-714 (1990). 7. Davis RW, Botstein D, Roth JR: Advanced Bacterial Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1980). 8. Dean C, van den Elzen P, Tamaki S, Dunsmuir P, Bedbrook J: Differential expression of the eight genes of the petunia ribulose bisphosphate carboxylase small subunit multi-gene family. EMBO J 4:3055-3061 (1985), 9. Devereux J, Haeberli P, Smithies O: A comprehensive set of sequence analysis programs for the VAX. Nucl Acids Res 12:387-395 (1984). 10. Dietrich RA, Maslyar DJ, Heupel RC, Harada JJ: Spatial patterns of gene expression in Brassica napus seedlings: identification of a cortex-specific gene and localization of mRNAs encoding isocitrate lyase and a polypeptide homologous to proteinases. Plant Cell 1: 73-80 (1989). 11. Edwards CL, Colbert JT: Regulation of phytochrome mRNA abundance in green oat leaves. Plant Cell Environ 13:813-819 (1990). 12. Edwards JW, Coruzzi GM: Cell-specificgene expression in plants. Annu Rev Genet 24:275-303 (1990). 13. Erickson RO, Sax KB: Elemental growth rate of the primary root of Zea mays. Proc Am Phil Soc 100:487-498 (1956). 14. Esau K: Anatomy of Seed Plants. John Wiley, New York (1977). 15. Evans IM, Swinhoe R, Gatehouse LN, Gatehouse JA, Boulter D: Distribution of root mRNA species in other vegetative organs of pea (Pisum sativum L.). Mol Gen Genet 214:153-157 (1988). 16. Gasser CS, Budelier KA, Smith AG, Shah DM, Fraley RT: Isolation of tissue-specific cDNAs from tomato pistils. Plant Cell 1:15-24 (1989). 17. Goldberg RB: Plants: Novel developmental processes. Science 240:1460-1467 (1988). 18. John I, Held BM, Wurtele ES, Colbert JT: Isolation and characterization of root-preferential cDNA clones from Zea mays. J Cell Biochem 15A: 133 (1991). 19. Joshi CP: An inspection of the domain between putative TATA box and translation start site in 79 plant genes. Nucl Acids Res 15:6643-6653 (1987). 20. Joshi CP: Putative polyadenylation signals in nuclear genes of higher plants: a compilation analysis. Nucl Acids Res 15:9627-9640 (1987). 21. Kamalay JC, Goldberg RB: Regulation of structural gene expression in tobacco. Cell 19:935-946 (1980). 22. Kamalay JC, Goldberg RB: Organ-specific nuclear RNAs in tobacco. Proc Natl Acad Sci USA 81:2801-2805 (1984).

831 23. Keller B, Lamb CJ: Specific expression of a novel cell wail hydroxyproline-rich glycoprotein gene in lateral root initiation. Genes Devel 3:1639-1646 (1989). 24. Koltunow AM, Truettner J, Cox KH, Wailroth M, Goldberg RB: Different temporal and spatial gene expression patterns occur during anther development. Plant Cell 2: 1201-1224 (1990). 25. Kornfeld R, Kornfeld S: Assembly of asparagine-linked oligosaccharides. Annu Rev Biochem 54:631-664 (1985). 26. Kozak M: Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucl Acids Res 12:857-872 (1984). 27. Kyte J, Doolittle RF: A simple method for displaying the hydropathic character of a protein. J Mol Biol 157: 105132 (1982). 28. Lerner DR, Raikhel NV: Cloning and characterization of root-specific barley lectin. Plant Physiol 91:124-129 (1990). 29. Lissemore JL, Colbert JT, Quail PH: Cloning of eDNA for phytochrome from etiolated Cucurbita and coordinate photoregulation of the abundance of two distinct phytochrome transcripts. Plant Mol Biol 8:485-496 (1987). 30. Marck C: 'DNA Strider': a 'C' program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers. Nucl Acids Res 16: 18291836 (1988). 31. McFadden GI, Bonig I, Cornish CE, Clarke AE: A simple fixation and embedding method for use in hybridization histochemistry on plant tissues. Histochem J 20: 575-586 (1988). 32. McLean BG, Enbanks S, Meagher RB: Tissue-specific expression of divergent actins in soybean root. Plant Cell 2:335-344 (1990).

33. Montoliu L, Rigau J, Puigdomenech P: A tandem of c~-tubulingenes preferentially expressed in radicular tissues from Zea mays. Plant Mol Biol 14:1-15 (1989). 34. Murray MG, Peters DL, Thompson WF: Ancient repeated sequences in the pea mung bean genomes and implications for genome evolution. J Mol Evol 17:31-42 (1981). 35. Raven PH, Evert RF, Eichhorn SE: Biology of Plants. Worth, New York (1986). 36. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitors. Proc Natl Aead Sci USA 74: 5463-5467 (1977). 37. Short JM, Fernandez JM, Sorge JA, Huse WD: Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucl Acids Res 16:7583-7600 (1988). 38. Simoens CR, Peleman J, Vaivekens D, Van Montagu M, Inze D: Isolation of genes expressed in specific tissues of Arabidopsis thaliana by differential screening of a genomic library. Gene 67:1-11 (1988). 39. Singh K, Dennis ES, Ellis JG, Llewellyn DJ, Tokuhisa JG, Wahleithner JA, Peacock WJ: OCSBF-1, a maize Ocs enhancer binding factor: isolation and expression during development. Plant Cell 2:891-903 (1990). 40. Ursin VM, Yamaguchi J, McCormick S: Gametophytic and sporophytic expression of anther-specific genes in developing tomato anthers. Plant Cell 1: 727-736 (1989). 41. Vinson CR, Sigler PB, McKnight SL: Scissors-gripmodel for DNA recognition by a family of leucine zipper proteins. Science 246:911-916 (1989). 42. Wickens M: How the messenger got its tail: addition of poly(A) in the nucleus. Trends Biochem Sci 15:277-281 (1990).