Biosensors and Bioelectronics 59 (2014) 58–63
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
An off–on–off electrochemiluminescence approach for ultrasensitive detection of thrombin Li Deng a, Ying Du b, Jing-Juan Xu a,n, Hong-Yuan Chen a a b
State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China Academy of Fundamental and Interdisciplinary Sciences, Harbin Institute of Technology, Harbin 150080, China
art ic l e i nf o
a b s t r a c t
Article history: Received 26 November 2013 Received in revised form 18 February 2014 Accepted 6 March 2014 Available online 15 March 2014
This work demonstrates an aptasensor for ultrasensitive electrochemiluminescence (ECL) detection of thrombin based on an “off–on–off” approach. The system is composed of an Eu3 þ -doped CdS nanocrystals (CdS:Eu NCs) film on glassy carbon electrode (GCE) as ECL emitter. Then gold nanoparticles (AuNPs) labeled hairpin-DNA probe (ssDNA1) containing thrombin-binding aptamer (TBA) sequence was linked on the NCs film, which led to ECL quenching (off) as a result of Förster-resonance energy transfer (FRET) between the CdS:Eu NC film and the proximal AuNPs. Upon the occurrence of hybridization with its complementary DNA (ssDNA2), an ECL enhancement (on) occurred owing to the interactions of the excited CdS:Eu NCs with ECL-induced surface plasmon resonance (SPR) in AuNPs at large separation. Thrombin could induce ssDNA1 forming a G-quadruplex and cause the AuNPs to be close to CdS:Eu NCs film again, which resulted in an enhanced ECL quenching (off). This “off–on–off” system showed a maximum 7.4-fold change of ECL intensity due to the configuration transformation of ssDNA1 and provides great sensitivity for detection of thrombin in a wide detection range from 50 aM to 1 pM. & 2014 Elsevier B.V. All rights reserved.
Keywords: Electrochemiluminescence Resonance energy transfer Thrombin binding aptamer Eu3 þ -doped CdS nanocrystals Gold nanoparticles
1. Introduction Thrombin is a physiological serine protease involved in coagulation-related reactions responsible for blood clotting (Dihanich et al., 1991; Yang et al., 2011). Changes in thrombin concentration levels in the blood are known to be associated with various coagulation abnormalities and it is considered as a biomarker for tumor diagnosis (Hwang et al., 2001; Liu et al., 2009). Thus, highly sensitive detection of thrombin is of immense importance for early diagnosis, clinical practice and following disease recurrence (Centi et al., 2007; Forrest, 1997). Thrombin binding aptamer (TBA), owing to lots of advantages as the ease of labeling, excellent stability and high affinity and selectivity towards thrombin (Iliuk et al., 2011; Osborne and Ellington, 1997), has been widely used as recognition element to construct thrombin biosensor combined with different analysis methods, such as colorimetry, fluorescence, surface plasmon resonance (SPR), electrochemistry, electrochemiluminescence (ECL), and so on (Huang et al., 2013; Li et al., 2012b; Shan et al., 2011; Tang et al., 2007; Wu et al., 2013; Xiao et al., 2005; Xue et al., 2012). Among them, ECL techniques, the generation of an optical signal triggered by electrochemical reactions, have appeared to be an excellent alternative to
n
Corresponding author. Tel.: þ 86 25 83597294; fax: þ 86 25 83597294. E-mail address: [email protected] (J.-J. Xu).
http://dx.doi.org/10.1016/j.bios.2014.03.012 0956-5663/& 2014 Elsevier B.V. All rights reserved.
other methods due to the combination of advantages of both electrochemical and chemiluminescent biosensors, such as high sensitivity and ease of control (Richter, 2004). TBA is known to form a stable G-quadruplex (G4) structure binding to thrombin, which adopts a specific three-dimensional (3-D) “chair structure” (Liao et al., 2011; Niu et al., 2012). The conformational changes induced by thrombin–TBA recognition events make distance-related resonance energy transfer (RET) techniques an ideal means for thrombin detection (Babu et al., 2013; Boeneman et al., 2009; Krauss et al., 2012). Recently, increasing interest has been attracted to the cooperation of RET with ECL techniques (named ECL–RET) which could fabricate sensitive ECL switches to obtain amplified signals transition, due to its high sensitivity, rapid biological response, as well as good controlment (Li et al., 2012a; Shan et al., 2009; Sun et al., 2012; Wang et al., 2013; Wu et al., 2012). To obtain optimal ECL–RET efficiency, perfect energy overlapped donor/acceptor pair is of great importance, therefore energy tunable materials are especially appealing as potential donor and acceptor (Wang et al., 2011; Zhou et al., 2012). As we know noble metals could not only be used as electrode materials but also as SPR substrates. Simultaneous application of SPR, electrochemical and ECL techniques on the same Au substrate was reported (Ramanaviciene et al., 2012). Recently, considerable efforts have been made to ECL–RET phenomena between semiconductor nanocrystals (NCs) and plasmons
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
in metallic nanoparticles (NPs) (He et al., 2013; Zhang et al., 2012). As one of the most popular ECL emitters, CdS NCs become a candidate donor for their quantum effect and surface-sensitive ECL intensity, while gold nanoparticles (AuNPs) emerge as the widely applied acceptors because of their high extinction coefficients and strong size-dependent SPR properties (Wang et al., 2011; Khlebtsov, 2008). Similar to photoluminescence (PL), the RET between CdS NCs and the ECL-excited SPR in AuNPs could result in distance-dependent ECL quenching or enhancing (He et al., 2013; Shan et al., 2009). In the classic RET case, the donor must have a wide range of emission tunability for the better controlment of the spectral overlap with the absorption spectra of a particular acceptor and higher excited-state lifetime than the acceptor (Sarkar et al., 2013). Eu3 þ -doped CdS nanocrystals (CdS:Eu NCs), the donor used in this ECL–RET system, possess improved ECL intensity and efficiency with two ECL emission bands at 450–550 nm from the host CdS and 600–650 nm due to the energy transfer from host CdS to Eu3 þ ions (Deng et al., 2012; Zhou et al., 2012). The doped Eu3 þ ions also affect the electric field of CdS:Eu NCs surface, which can further influence the SPR in AuNPs (the accepter). The conformational changes of TBA alter the distance between the donor and the acceptor thus modulating the signal to detect ultra-low concentration of thrombin. In this work we applied CdS:Eu NCs as the ECL emitters and AuNPs functioning as both ECL quencher and enhancer together with TBA to control the distance to form a novel “off–on–off” ECL biosensor. Since TBA can specifically bind with thrombin much stronger than its complementary DNA chain, ultrasensitive detection of thrombin was achieved. The presence of thrombin was perceived by the decrease of ECL intensity originating from the distance variation between AuNPs and CdS:Eu NCs by complementary DNA and thrombin. The difference between ECL intensity before and after incubating with target protein (ΔI), was correlated to the concentrations of thrombin. This ECL aptasensor showed a high specificity and a wide linear range.
2. Experimental section 2.1. Reagents The purified thrombin (the activity of enzyme was 10 U mg 1, freeze-dry powder) and labeled DNA oligonucleotides were purchased from Shenggong Bioengineering Ltd. Company (Shanghai, China). These oligonucleotides employed had the following sequences: 36-Mer thiol molecular beacon (MB, 26-base loop and 5-bp stem) ssDNA1 (TBA): 50 NH2(CH2)6CTCTCAGTCCGTGGTAGGGCA GGTTGGGGTGACTGT(CH2)6SH30 22-Mer ssDNA2: 50 ACCCCAACCTGCCCTACCACGG30 50 -thiol modified noncomplementary ssDNA3 (dilution DNA): 50 SH(CH2)6CTTGAAT3' SsDNA1 is a modified TBA, and partially complementary with ssDNA2. Mouse IgG was obtained from Boster Biological Technology, Ltd. (Wuhan, China). Bovine serum albumin (BSA), hemoglobin (Hb), lysozyme (Lyso), HAuCl4, 6-mercapto-1-hexanol (MCH) (4 97.0%), 1-methylimidazol, 3-mercaptopropionic acid (MPA), tri (2-carboxyethyl) phosphine hydrochloride (TCEP), N-(3-dimethylaminopropyl)-N0 -ethyl-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) were purchased from SigmaAldrich (St. Louis, MO). Sodium sulfide (Na2S 9H2O), sodium borohydride (NaBH4), and other routine chemicals were purchased from Nanjing Chemical Co. Ltd. Cadmium nitrate tetrahydrate (Cd(NO3)2 4H2O) and europium (III) oxide (Eu2O3) was supplied by Sinopharm Chemical Reagent Co. Ltd. All reagents were of
59
analytical grade and used as received. 0.10 M phosphate buffer solution (PBS, KH2PO4–K2HPO4) containing 0.050 M K2S2O8 (pH 8.3) was used for ECL detection, 0.10 M Tris–HCl buffer (pH 7.4) containing 0.10 M NaCl was used for storing modified GCE, and 0.10 M PBS (pH 7.4) containing 0.10 M NaCl and 5.0 mM MgCl2 was for hybridization and preparation of DNA stock solutions. All aqueous solutions were prepared using ultra-pure water (Milli-Q, Millipore). 2.2. Apparatus The ECL emission measurements were conducted on a MPI-E multifunctional electrochemical and chemiluminescent analytical systems (Remax Electronic Instrument Limited Co., Xi'an, China, 350 nm–650 nm) by cyclic potential scan at room temperature, and the voltage of the PMT was set at 500 V in the process of detection. The experiments were carried out with a conventional three-electrode system. The working electrode was a 3 mm diameter glassy carbon electrode (GCE) modified with NCs composite film, while a Pt wire and saturated calomel electrode (SCE) served as the counter and reference electrodes, respectively. ECL spectra were obtained by a series of optical filters (from 440 nm to 640 nm, spaced 20 nm, Omega Optical Inc, USA). The UV–vis absorption spectra were obtained on a Shimadzu UV-3600 UV–vis-NIR photospectrometer (Shimadzu Co.). 2.3. Synthesis of CdS:Eu NCs and preparation of CdS:Eu NCs film The CdS:Eu NCs were prepared according to our previous work with some modification (Deng et al., 2012). Briefly, Cd(NO3)2 4H2O (0.1683 g) was dissolved in 30 mL ultra-pure water with 112.5 μL 0.080 M Eu(NO3)3 solution, and heated to 70 1C under stirring. Then a freshly prepared solution of Na2S 9H2O (0.7205 g) in 30 mL ultra-pure water was injected and instantly orange– yellow precipitates were obtained. The reaction was held at 70 1C for 3 h with continuous refluxing. The final reaction precipitates were centrifuged and washed thoroughly with absolute ethanol three times, followed by washing with ultra-pure water to get rid of any Eu3 þ and other ions remaining outside the clusters. Then the resulting precipitate was ultrasonically dispersed into water for centrifugation to collect the upper yellow solution of CdS:Eu NCs. The undoped CdS NCs were also synthesized by the same method except that Eu(NO3)3 was not added. 10 μL of CdS:Eu NCs (about 1.0 mg/mL) solution was drop-cast onto a GCE surface and evaporated in air at room temperature. The CdS:Eu NCs modified GCE was stored in 0.10 M NaCl þ0.10 M Tris–HCl buffer (pH 7.4). 2.4. Synthesis of uncapped AuNPs AuNPs were synthesized through reduction of HAuCl4 by NaBH4 according to the procedure of literature with some modification (Bae et al., 2004). 0.60 mL of ice cold 0.10 M NaBH4 was added to 20 mL aqueous solution containing 2.5 10 4 M HAuCl4 under stirring. The solution immediately turned to orange–red color, indicating the formation of gold nanoparticles. Keep on stirring in ice bath for 10 min. Then, the solution reacted at room temperature for another 3 h, during which time its color changed from orange–red to wine red. The prepared AuNPs were stored at 4 1C. 2.5. Preparation of MCH/TBA/AuNP composites 50 mL of 0.85 mM TBA in 0.10 M PBS (pH 7.4) was added into 500 mL Au colloidal solution containing 0.10 M NaCl and 0.50 mM MgCl2, followed by addition of 5.0 mL of 0.73 M MCH in 0.10 M PBS (pH 7.4). The resulting colloidal solution was kept in refrigerator at 4 1C for 2 h. Finally, the resulting MCH/TBA/AuNP were washed three times with 0.1 M PBS (pH 7.4), and resuspended in 0.10 M
60
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
PBS containing 0.50 M NaCl and 5.0 mM MgCl2 (pH 7.4) and stored at 4 1C.
2.6. Preparation of BSA/ssDNA3/TBA/AuNP composites TBA and ssDNA3 (bio bar code DNA, bbcDNA) modified with a thiol at their 50 -end were used to prepare ssDNA–AuNP conjugates. Briefly, 50 μL of 0.85 μM TBA and 4.0 μM bbcDNA (noncomplementary to ssDNA2) in 0.10 M PBS (pH 7.4) were activated with 1.5 μL 10 mM TCEP to reduce disulfide bonds, then added to 500 μL Au colloidal solution containing 0.10 M NaCl and 0.50 mM MgCl2. The resulting colloidal solution was kept in refrigerator at 4 1C for 16 h, followed by blocking the AuNPs with 2 wt% BSA solution for 1 h. Finally, the resulting composites were washed three times with 0.10 M PBS (pH 7.4) and resuspended in 0.10 M PBS containing 0.50 M NaCl and 5.0 mM MgCl2 (pH 7.4) at 4 1C for further use.
2.7. Fabrication of the ECL aptasensor The beforehand prepared CdS:Eu NCs film on GCE was immersed in 1.0 mL 0.10 M NaCl þ 0.10 M Tris–HCl buffer (pH 7.4) containing 3.0 mM MPA for 3 h at 4 1C. Then the terminal carboxylic acid groups of the MPA/CdS:Eu/GCE were activated by immersion in 1.0 mL of 0.10 M 1-methylimidazol aqueous solution (pH 7.4) containing 20 mg EDC and 10 mg NHS for 2 h at 4 1C. Next, the electrode was soaked in 100 mL of the stable colloidal solution of MCH/TBA/AuNP composites (or BSA/ssDNA3/TBA/AuNP composites) for 24 h at 4 1C. The as-prepared DNA biosensor was washed thoroughly at each step with 0.1 M PBS (pH 7.4) and stored in the 0.1 M NaCl þ0.1 M Tris–HCl buffer (pH 7.4) for 24 h to remove the unlinked MCH/TBA/AuNP composites before hybridization. Finally, the electrode was soaked in MCH or BSA solution at 4 1C for 1 h to block the non-specific binding sites of CdS:Eu NCs film and was washed thoroughly and stored in the 0.1 M NaCl þ0.1 M Tris–HCl buffer (pH 7.4) for further use. Then, the prepared GCE was immersed into 100 μL of 0.10 mM ssDNA2 solution (0.10 M PBS containing 0.50 M NaCl and 5.0 mM MgCl2, pH 7.4) to form dsDNA–AuNP conjugates on the surface. The hybridization reaction was carried out for 1 h at 40 1C with mechanical shaking. Subsequently, the electrode was washed thoroughly with Tris–HCl buffer (0.10 M, pH 7.4) to remove unhybridized ssDNA2.
2.8. Amplified ECL detection of thrombin Sample solutions containing various concentrations of thrombin were prepared in 0.10 M NaCl þ0.10 M Tris–HCl buffer (pH 7.4). In a typical test, the assembled aptasensor was incubated in 100 μL of sample solution for 1 h at 37 1C, followed by thoroughly washing with the same buffer to remove unbound thrombin and replaced ssDNA2. The aptasensor before and after the formation of thrombin–TBA complex was in contact with 0.10 M PBS (pH 8.3) containing 0.050 M K2S2O8 and scanned from 0 to –1.35 V. ECL signals related to the thrombin concentrations could be measured.
3. Result and discussion 3.1. Mechanism of the “off–on–off” ECL aptasensor The principle of TBA-based assay for thrombin using AuNPs as both ECL quencher and enhancer is shown in Scheme 1. CdS:Eu NCs used as ECL emitter were first coated on GCE surface. Our previous work has demonstrated that the CdS:Eu NCs at 1.5% doping level showed 4-folds stronger and more stable cathodic ECL signals compared to pure CdS NCs, for Eu3 þ ions could alter the surface of CdS NCs and create a new surface state-Eu3 þ complex to facilitate effective energy transfer from host to Eu3 þ ions (Deng et al., 2012). The ECL processes of the prepared CdS:Eu film are proposed as follows (Deng et al., 2012): CdS:Eu þne-n(CdS:Eu) d
(1)
S2O28 þe -SO24
(2)
þ SO4 d
(CdS:Eu) d þ SO4 d -(CdS:Eu)n þSO24
(3)
(CdS:Eu)n-CdS:Eu þhν
(4)
Upon potential scaning with an initial negative direction, the CdS:Eu NCs immobilized on the electrode were reduced to (CdS: Eu) d by charge injection, while the coreactant S2 O28 was reduced to the strong oxidant SO4 d , and then (CdS:Eu) d could be oxidized by SO4 d to (CdS:Eu)n to emit light. Known as a widely used anti-thrombin aptamer, TBA29 (50 AGTCCGTGGTAGGGCAGGTTGGGGTGAC30 ), which is able to bind selectively onto the exosite of thrombin (heparin-binding sites) with a high specificity versus other substances (Jain et al., 2007), possesses a changeable hairpin structure with 4-bp stem and G-rich DNA strand to form 3-D G4 structure binding to thrombin. One more stem was added to the TBA29 to get a more stable
Scheme 1. TBA-related ECL “off–on–off” platform based on energy transfer between CdS:Eu NCs film and AuNPs.
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
hairpin TBA in our system (ssDNA1 was short for TBA). Then, as illustrated in Scheme 1, a TBA dually labeled with an amino at its 50 end and thiol-linked AuNP at its 30 end was immobilized on CdS: Eu NCs film through EDC and NHS. In the absence of ssDNA2, the immobilized probe was in a “closed” state which caused a 55.1% ECL intensity decrease (Fig. 1, curve b) compared with that of the CdS:Eu NCs film before assembly (curve a). This hairpin structure on the GCE also reserved enough space for the following reactions, which avoided the surface density optimization procedure. After hybridization with ssDNA2, the hairpin structure was changed to form dsDNA strands and make AuNPs far from the emitter, which led an enhancement of 72.1% in ECL peak height (from curve a to curve c). Finally, the AuNP/G4–TBA–thrombin complexes were formed with 76.8% ECL signal decrease in the presence of 1 pM thrombin (curve d) compared to original CdS:Eu NCs film, resulting in a total 7.4-fold ECL intensity variation (from curve c to curve d). Thus, an “off–on–off” ECL aptasensor was constructed. To better clarify the ECL variation mechanism, control experiments without the involvement of AuNPs were carried out (inset of Fig. 1). The result displayed that the immobilization of TBA on GCE, the hybridization between TBA and its complementary ssDNA2, and the formation of TBA–thrombin conjugates did not bring obvious changes in ECL intensity. The results suggested that
Fig. 1. Cyclic ECL on potential curves in various cases. (a) GCE–CdS:Eu NCs, (b) GCE–CdS:Eu NCs/TBA/AuNP–MCH, (c) GCE–CdS:Eu NCs/TBA/AuNP–MCH/ ssDNA2 and (d) GCE–CdS:Eu NCs/TBA/AuNP–MCH/1 pM thrombin. Inset: Cyclic ECL on potential curves in corresponding cases without AuNPs. (a0 ) GCE–CdS:Eu NCs, (b0 ) GCE–CdS:Eu NCs/TBA, (c0 ) GCE–CdS:Eu NCs/TBA/ssDNA2, (d0 ) GCE–CdS:Eu NCs/TBA/1 pM thrombin. ECL detection buffer: 0.1 M PBS (pH 8.3) containing 0.05 M K2S2O8. Scan rate: 100 mV s 1.
61
in our ECL system, the intensity variations were attributed to the ECL–RET between AuNPs and the CdS:Eu NCs. Obviously, the key to promoting the detection sensitivity of the aptasensor is to improve the efficiency of ECL–RET between CdS: Eu NCs film and AuNPs. As we know, the factors that affect the efficiency involve the spectral overlap between the donor's emission and the acceptor's absorption, the distance between the donor and acceptor, the extinction coefficient of the acceptor, the lifetime of the donor and also external magnetic field (Biju et al., 2008; Sapsford et al., 2011; Sokolov et al., 1998). Here, the separation length between CdS:Eu NCs and AuNPs was controlled by the length of TBA. In this case, the separation distance was about 12 nm after hybridization, which was proven to be an appropriate distance for ECL-induced SPR enhancement (Wang et al., 2011), and the extinction coefficient of AuNPs after different modification (MCH or BSA) should not vary distinctly. Thus, the overlap of emission/absorption spectra, the lifetime of the excited CdS:Eu NCs and magnetic field caused by CdS:Eu film came to be the points to influence the efficiency. As we know, SPR of AuNPs is associated with the collective excitation of free conduction electrons on the nanoparticle surface which is related to particle size and suface structure, and thus could be tuned in a wide region from visible to infrared. The tunability of the AuNPs offers possibilities for improving the efficiency of ECL–RET in this system. The modification of the AuNP surface with a molecule that is bound chemically to its surface can alter the SPR due to the dielectric environment change close to the nanoparticle surface (Vangala et al., 2013). As shown in Fig. 2B, AuNPs with an average size of 5 nm possessed the absorption around 512 nm (curve a), while AuNPs blocked by BSA displayed an absorption maximum at ca. 523 nm (curve c), and MCH blocked by AuNPs showed a wider band with an absorption maximum at 600 nm (curve b), indicating more change of the AuNP surface electronic structure caused by MCH, while slight change by oligonucleotides and BSA. The influence of the extent of overlap between emission and absorption spectra on Förster-resonance energy transfer (FRET, be called quenching efficiency in this work) could be reflected by using CdS NCs as reference as shown in Fig. S1B. A 50.6% quenching by thrombin-induced proximal AuNPs were obtained by BSA-blocked AuNP conjugates, while a 32.4% quenching in MCH-blocked AuNP conjugates. The obvious difference was attributed to different degree of overlap between the ECL spectrum of CdS film (curve a of Fig. 2A) and the absorption spectra of two ligands modified AuNPs (curve b and curve c of Fig. 2B). More precisely, the absorption spectra of AuNP/BSA perfectly overlapped the CdS NCs ECL emission, while AuNP/MCH partly overlapped. However, the results of applying CdS:Eu NCs as emitter showed
Fig. 2. (A) ECL spectra of (a) pure CdS NCs film and (b) CdS:Eu NCs film. (B) UV–vis absorption spectra of (a) AuNPs, (b) TBA–AuNP composite blocked with MCH and (c) ssDNA3–TBA–AuNP composite blocked with BSA.
62
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
improved quenching efficiency. A 76.8% decrease by thrombininduced proximal AuNPs occurred by MCH-blocked AuNP conjugates, while a 63.6% decrease in BSA-blocked AuNP conjugates (Fig. S1A). The improvement could be due to characteristics of ECL spectrum of CdS:Eu NC film (curve b of Fig. 2A). There existed double peaks from 450 to 550 nm of recombination emission of host CdS surface states, a high peak of the characteristic transitions of Eu3 þ ions around 620 nm and also a shoulder peak around 580 nm. The multi-emission (could be seen as integration of bulk materials and quantum effect) allowed a kind of universality for different ligands blocked AuNPs. Thus more overlap could be obtained. Moreover, the broaden absorption from 500 nm to 600 nm of AuNPs blocked by MCH (curve b of Fig. 2B) had better spectral overlap with ECL emissions from CdS:Eu NCs, especially the most intense peak around 620 nm, resulting more efficient RET from CdS:Eu NC film to MCH blocked AuNPs than BSA blocked AuNPs. On the other side, the lifetime of the excited CdS:Eu NCs was proved to be improved compared with pure CdS NCs by reducing the non-radiative transition probability of the excited NCs, which means more efficient dipole–dipole interaction between CdS:Eu NCs and AuNPs (Deng et al., 2012). As a result, CdS:Eu NCs was more easily quenched by AuNPs than CdS NCs. As for enhancement, overlap of emission/absorption spectra also had similar effect on the efficiency. When CdS NCs were emitters, BSA blocked AuNPs got a 4.95-fold ECL enhancement, while MCH blocked AuNPs got 1.47-fold (Fig. S1B). However, the results of using CdS:Eu NCs as emitter were a similar 1.72-fold by
Fig. 3. The ECL decrease after hybridization (denoted as Ihy) and after incubating with different concentrations of target protein (denoted as I) (ΔI¼ Ihy I) in the cases of CdS:Eu NCs–AuNPs/MCH, CdS:Eu NCs–AuNPs/BSA, CdS NCs–AuNPs/BSA and CdS NCs–AuNPs/MCH, respectively.
MCH blocked AuNPs and BSA blocked AuNPs (Fig. S1A). The less enhancement could be attributed to the internal magnetism of doped Eu3 þ to form an extra magnetic and then negative influence on the ECL–SPR interaction (Wang et al., 2011). Furthermore, as we discussed before, the doped Eu3 þ ions has already dramatically reduced the non-radiative transition probability of excitions on CdS:Eu NCs surface (Deng et al., 2012). Thus, it was not surprising that the cooperation of AuNPs could not bring further enhancement. However, the 4-fold enhancement in ECL intensity and improved lifetime by Eu3 þ doping and the following dramatically quenching by MCH blocked AuNPs could make up for this deficiency, which is confirmed in Fig. 3. The strongly effective quenching could also reduce background signals to get a rather low detection limit. 3.2. ECL aptasensor detection of thrombin Owing to the high affinity of TBA binding with thrombin, and the stronger constant interaction compared to the hybridization between ssDNA2 and TBA, ssDNA2 could be easily displaced by thrombin. Thus, stable G4-structure TBA–thrombin complex was formed to diminish the ECL emission. As shown in Fig. 4A, the more the displacement that took place, the more the ECL intensity decreased. Fig. 4B displayed the relationship between the decrease in ECL peak height after hybridization (denoted as Ihy, which was stable enough for detection processes, as shown in the inset of Fig. 4A
Fig. 5. Selectivity of the ECL aptasensor to thrombin (10 fM) by comparing to the interfering proteins at 40 fM: bovine serum albumin (BSA), hemoglobin (Hb), lysozyme (Lyso), and the mixed sample containing 10 fM thrombin and BSA, Hb, and Lyso at the concentrations of 40 fM. The error bars show the standard deviation of three replicate determinations.
Fig. 4. (A) ECL signals of the aptasensor incubated with different concentrations of thrombin (from top to down, 0, 0.01, 1, 10 and 100 fM and 1 pM). Inset: the ECL emission under continuous cyclic potential scan with the concentrations of 0 and 1 pM thrombin for 5 cycles. (B) Relationship between ΔI and thrombin concentration (0.5 aM–5 pM), three measurements for each point. Inset: logarithmic calibration curve for thrombin.
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
and Fig. S2) and after incubating with target protein (denoted as I) (ΔI¼ Ihy I) and thrombin concentrations (0.5 aM–5 pM). ΔI was found to be logarithmically to the concentration of thrombin in a wide range from 50 aM to 1 pM (R¼0.994) (inset in Fig. 4B). The limit of detection (LOD) of this system was as low as 1 aM, which was much lower than many other previously reported ECL detection of thrombin (Fang et al., 2008; Wang et al., 2012). The selectivity of the aptasensor for thrombin was tested via comparing the ECL signal changes brought by four other proteins: bovine serum albumin (BSA), mouse IgG, hemoglobin (Hb), and lysozyme (Lyso). Fig. 5 compared the ECL responses of the aptasensor after incubation in BSA, mouse IgG, Hb, and Lyso solutions under the same experimental conditions and at the same concentration of 40 fM (The corresponding cyclic ECL on potential curves in the above cases were shown in Fig. S3). The results showed that the presence of BSA, mouse IgG, Hb, and Lyso did not induce any great changes of signal. While incubating of the aptasensor into 10 fM thrombin, the intensity greatly decreased. Similarly, a mixed sample (10 fM thrombin coexisted with 40 fM BSA, mouse IgG, Hb, and Lyso) did not display large signal change compared with that of thrombin alone. This comparison essentially suggested that the aptasensor was highly selective and had quite an affinity toward thrombin. 4. Conclusions This work demonstrated an ultrasensitive “off–on–off” aptasensor based on distance-controlled ECL–RET between CdS:Eu NCs and AuNPs. Thus, thrombin-induced configuration transformation of single TBA induced a total 7.4-fold variation of ECL signals. This signal variation may be further amplified by using other energy matching non-magnetic ECL emitters instead of the diluted magnetic semiconductor. Such great amplification together with the specificity of the TBA made a concentration detection limits as low as attomolar level for thrombin. This principle could be also applied to many other bioassays and would widen understanding of ECL exciton-SPR interactions. Acknowledgments This work was supported by the 973 Program (2012CB932600) and the National Natural Science Foundation of China (Grant no. 21135003, 21025522, 21105019), the National Natural Science Funds for Creative Research Groups (Grant no. 21121091) of China. Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.03.012.
63
References Babu, E., Mareeswaran, P.M., Rajagopa, S., 2013. J. Fluoresc. 23, 137–146. Bae, Y., Myung, N., Bard, A.J., 2004. Nano Lett. 4, 1153–1161. Biju, V., Itoh, T., Anas, A., Sujith, A., Ishikawa, M., 2008. Anal. Bioanal. Chem. 391, 2469–2495. Boeneman, K., Mei, B.C., Dennis, A.M., Bao, G., Deschamps, Je.R., Mattoussi, H., Medintz, I.L., 2009. J. Am. Chem. Soc. 131, 3828–3829. Centi, S., Tombelli, S., Minunni, M., Mascini, M., 2007. Anal. Chem. 79, 1466–1473. Deng, L., Shan, Y., Xu, J.J., Chen, H.Y., 2012. Nanoscale 4, 831–836. Dihanich, M., Kaser, M., Reinhard, E., Cunningham, D., Monard, D., 1991. Neuron 6, 575–581. Fang, L.Y., Lu, Z.Z., Wei, H., Wang, E., 2008. Anal. Chim. Acta 628, 80–86. Forrest, S.R., 1997. Chem. Rev. 97, 1793–1896. He, L.J., Wu, M.S., Xu, J.J., Chen, H.Y., 2013. Chem. Commun. 49, 1539–1541. Huang, Y., Chen, J., Zhao, S.L., Shi, M., Chen, Z.F., Liang, H., 2013. Anal. Chem. 85, 4423–4430. Hwang, K.K., Grossman, J.M., Visvanathan, S., Chukwuocha, R.U., Woods Jr, V.L., Le, D.T., Hahn, B.H., Chen, P.P., 2001. J. Immunol. 167, 7192–7198. Iliuk, A.B., Hu, L.H., Tao, W.A., 2011. Anal. Chem. 83, 4440–4452. Jain, P.K., Huang, X.H., El-Sayed, I.H., El-Sayad, M.A., 2007. Plasmonics 2, 107–118. Khlebtsov, N.G., 2008. Quantum Electron. 38, 504–529. Krauss, I.R., Merlino, A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F., 2012. Nucleic Acids Res. 40, 8119–8128. Li, M.Y, Li, J., Sun, L., Zhang, X.L., Jin, W.R., 2012a. Electrochim. Acta 80, 171–179. Li, Y.F., Liu, L.L., Fang, X.L., Bao, J.C., Han, M., Dai, Z.H., 2012b. Electrochim. Acta 65, 1–6. Liao, Y.H., Yua, R., Chai, Y.Q., Mao, L., Zhuo, Y., Yuan, Y.L., Bai, L.J., Yuan, S.R., 2011. Sens. Actuators B-Chem. 158, 393–399. Liu, J.W., Cao, Z.H., Lu, Y., 2009. Chem. Rev. 109, 1948–1998. Niu, S.Y., Qu, L.J., Zhang, Q., Lin, J.H., 2012. Anal. BioChem. 421, 362–367. Osborne, S.E., Ellington, A.D., 1997. Chem. Rev. 97, 349–370. Ramanaviciene, A., German, N., Kausaite-Minkstimiene, A., Voronovic, J., Kirlyte, J., Ramanavicius, Arunas, 2012. Biosens. Bioelectron. 36, 48–55. Richter, M.M., 2004. Chem. Rev. 104, 3003–3036. Sapsford, K.E., Granek, J., Deschamps, J.R., Boeneman, K., Blanco-Canosa, J.B., Dawson, P.E., Susumu, K., Stewart, M.H., Medintz, I.L., 2011. ACS Nano 5, 2687–2699. Sarkar, S., Maity, A.R., Karan, N.S., Pradhan, N., 2013. J. Phys. Chem. C 117, 21988–21994. Shan, Y., Xu, J.J., Chen, H.Y., 2009. Chem. Commun. 8, 905–907. Shan, Y., Xu, J.J., Chen, H.Y., 2011. Nanoscale 3, 2916–2923. Sokolov, K., Chumanov, G., Cotton, T.M., 1998. Anal. Chem. 70, 3898–3905. Sun, L.Y., Chu, H.H., Yan, J.L., Tu, Y.F., 2012. Electrochem. Commun. 17, 88–91. Tang, Q.J., Su, X.D., Loh, K.P., 2007. J. Colloid Interface Sci. 315, 99–106. Vangala, K., Siriwardana, K., Vasquez, E.S., Xin, Y., Pittman Jr, C.U., Walters, K.B., Zhang, D.M., 2013. J. Phys. Chem. C 117, 1366–1374. Wang, J., Shan, Y., Zhao, W.W., Xu, J.J., Chen, H.Y., 2011. Anal. Chem. 83, 4004–4011. Wang, J., Zhao, W.W., Zhou, H., Xu, J.J., Chen, H.Y., 2013. Biosens. Bioelectron. 41, 615–620. Wang, Y., Yuan, R., Chai, Y.Q., Yuan, F Y.L., Bai, L.J., 2012. Biosens. Bioelectron. 38, 50–54. Wu, M.S., Shi, H.W., He, L.J., Xu, J.J., Chen, H.Y., 2012. Anal. Chem. 84, 4207–4213. Wu, Y.M., Xu, W.J., Bai, L.J., Yuan, Y.L., Yi, H.Y., Chai, Y.Q., Yuan, R., 2013. Biosens. Bioelectron. 50, 50–56. Xiao, Y., Piorek, B.D., Plaxco, K.W., Heeger, A.J., 2005. J. Am. Chem. Soc. 127, 17990–17991. Xue, L.Y., Zhou, X.M., Da, X., 2012. Anal. Chem. 84, 3507–3513. Yang, L.Z., Zhu, J., Xu, Y., Yun, W., Zhang, R.Y., He, P.G., Fang, Y.Z., 2011. Electroanalysis 23, 1007–1012. Zhang, H.R., Xia, X.H., Xu, J.J., Chen, H.Y., 2012. Electrochem. Commun. 25, 112–115. Zhou, H., Zhang, Y.Y., Liu, J., Xu, J.J., Chen, H.Y., 2012. J. Phys. Chem. C 116, 17773–17780.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
An off–on–off electrochemiluminescence approach for ultrasensitive detection of thrombin Li Deng a, Ying Du b, Jing-Juan Xu a,n, Hong-Yuan Chen a a b
State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China Academy of Fundamental and Interdisciplinary Sciences, Harbin Institute of Technology, Harbin 150080, China
art ic l e i nf o
a b s t r a c t
Article history: Received 26 November 2013 Received in revised form 18 February 2014 Accepted 6 March 2014 Available online 15 March 2014
This work demonstrates an aptasensor for ultrasensitive electrochemiluminescence (ECL) detection of thrombin based on an “off–on–off” approach. The system is composed of an Eu3 þ -doped CdS nanocrystals (CdS:Eu NCs) film on glassy carbon electrode (GCE) as ECL emitter. Then gold nanoparticles (AuNPs) labeled hairpin-DNA probe (ssDNA1) containing thrombin-binding aptamer (TBA) sequence was linked on the NCs film, which led to ECL quenching (off) as a result of Förster-resonance energy transfer (FRET) between the CdS:Eu NC film and the proximal AuNPs. Upon the occurrence of hybridization with its complementary DNA (ssDNA2), an ECL enhancement (on) occurred owing to the interactions of the excited CdS:Eu NCs with ECL-induced surface plasmon resonance (SPR) in AuNPs at large separation. Thrombin could induce ssDNA1 forming a G-quadruplex and cause the AuNPs to be close to CdS:Eu NCs film again, which resulted in an enhanced ECL quenching (off). This “off–on–off” system showed a maximum 7.4-fold change of ECL intensity due to the configuration transformation of ssDNA1 and provides great sensitivity for detection of thrombin in a wide detection range from 50 aM to 1 pM. & 2014 Elsevier B.V. All rights reserved.
Keywords: Electrochemiluminescence Resonance energy transfer Thrombin binding aptamer Eu3 þ -doped CdS nanocrystals Gold nanoparticles
1. Introduction Thrombin is a physiological serine protease involved in coagulation-related reactions responsible for blood clotting (Dihanich et al., 1991; Yang et al., 2011). Changes in thrombin concentration levels in the blood are known to be associated with various coagulation abnormalities and it is considered as a biomarker for tumor diagnosis (Hwang et al., 2001; Liu et al., 2009). Thus, highly sensitive detection of thrombin is of immense importance for early diagnosis, clinical practice and following disease recurrence (Centi et al., 2007; Forrest, 1997). Thrombin binding aptamer (TBA), owing to lots of advantages as the ease of labeling, excellent stability and high affinity and selectivity towards thrombin (Iliuk et al., 2011; Osborne and Ellington, 1997), has been widely used as recognition element to construct thrombin biosensor combined with different analysis methods, such as colorimetry, fluorescence, surface plasmon resonance (SPR), electrochemistry, electrochemiluminescence (ECL), and so on (Huang et al., 2013; Li et al., 2012b; Shan et al., 2011; Tang et al., 2007; Wu et al., 2013; Xiao et al., 2005; Xue et al., 2012). Among them, ECL techniques, the generation of an optical signal triggered by electrochemical reactions, have appeared to be an excellent alternative to
n
Corresponding author. Tel.: þ 86 25 83597294; fax: þ 86 25 83597294. E-mail address: [email protected] (J.-J. Xu).
http://dx.doi.org/10.1016/j.bios.2014.03.012 0956-5663/& 2014 Elsevier B.V. All rights reserved.
other methods due to the combination of advantages of both electrochemical and chemiluminescent biosensors, such as high sensitivity and ease of control (Richter, 2004). TBA is known to form a stable G-quadruplex (G4) structure binding to thrombin, which adopts a specific three-dimensional (3-D) “chair structure” (Liao et al., 2011; Niu et al., 2012). The conformational changes induced by thrombin–TBA recognition events make distance-related resonance energy transfer (RET) techniques an ideal means for thrombin detection (Babu et al., 2013; Boeneman et al., 2009; Krauss et al., 2012). Recently, increasing interest has been attracted to the cooperation of RET with ECL techniques (named ECL–RET) which could fabricate sensitive ECL switches to obtain amplified signals transition, due to its high sensitivity, rapid biological response, as well as good controlment (Li et al., 2012a; Shan et al., 2009; Sun et al., 2012; Wang et al., 2013; Wu et al., 2012). To obtain optimal ECL–RET efficiency, perfect energy overlapped donor/acceptor pair is of great importance, therefore energy tunable materials are especially appealing as potential donor and acceptor (Wang et al., 2011; Zhou et al., 2012). As we know noble metals could not only be used as electrode materials but also as SPR substrates. Simultaneous application of SPR, electrochemical and ECL techniques on the same Au substrate was reported (Ramanaviciene et al., 2012). Recently, considerable efforts have been made to ECL–RET phenomena between semiconductor nanocrystals (NCs) and plasmons
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
in metallic nanoparticles (NPs) (He et al., 2013; Zhang et al., 2012). As one of the most popular ECL emitters, CdS NCs become a candidate donor for their quantum effect and surface-sensitive ECL intensity, while gold nanoparticles (AuNPs) emerge as the widely applied acceptors because of their high extinction coefficients and strong size-dependent SPR properties (Wang et al., 2011; Khlebtsov, 2008). Similar to photoluminescence (PL), the RET between CdS NCs and the ECL-excited SPR in AuNPs could result in distance-dependent ECL quenching or enhancing (He et al., 2013; Shan et al., 2009). In the classic RET case, the donor must have a wide range of emission tunability for the better controlment of the spectral overlap with the absorption spectra of a particular acceptor and higher excited-state lifetime than the acceptor (Sarkar et al., 2013). Eu3 þ -doped CdS nanocrystals (CdS:Eu NCs), the donor used in this ECL–RET system, possess improved ECL intensity and efficiency with two ECL emission bands at 450–550 nm from the host CdS and 600–650 nm due to the energy transfer from host CdS to Eu3 þ ions (Deng et al., 2012; Zhou et al., 2012). The doped Eu3 þ ions also affect the electric field of CdS:Eu NCs surface, which can further influence the SPR in AuNPs (the accepter). The conformational changes of TBA alter the distance between the donor and the acceptor thus modulating the signal to detect ultra-low concentration of thrombin. In this work we applied CdS:Eu NCs as the ECL emitters and AuNPs functioning as both ECL quencher and enhancer together with TBA to control the distance to form a novel “off–on–off” ECL biosensor. Since TBA can specifically bind with thrombin much stronger than its complementary DNA chain, ultrasensitive detection of thrombin was achieved. The presence of thrombin was perceived by the decrease of ECL intensity originating from the distance variation between AuNPs and CdS:Eu NCs by complementary DNA and thrombin. The difference between ECL intensity before and after incubating with target protein (ΔI), was correlated to the concentrations of thrombin. This ECL aptasensor showed a high specificity and a wide linear range.
2. Experimental section 2.1. Reagents The purified thrombin (the activity of enzyme was 10 U mg 1, freeze-dry powder) and labeled DNA oligonucleotides were purchased from Shenggong Bioengineering Ltd. Company (Shanghai, China). These oligonucleotides employed had the following sequences: 36-Mer thiol molecular beacon (MB, 26-base loop and 5-bp stem) ssDNA1 (TBA): 50 NH2(CH2)6CTCTCAGTCCGTGGTAGGGCA GGTTGGGGTGACTGT(CH2)6SH30 22-Mer ssDNA2: 50 ACCCCAACCTGCCCTACCACGG30 50 -thiol modified noncomplementary ssDNA3 (dilution DNA): 50 SH(CH2)6CTTGAAT3' SsDNA1 is a modified TBA, and partially complementary with ssDNA2. Mouse IgG was obtained from Boster Biological Technology, Ltd. (Wuhan, China). Bovine serum albumin (BSA), hemoglobin (Hb), lysozyme (Lyso), HAuCl4, 6-mercapto-1-hexanol (MCH) (4 97.0%), 1-methylimidazol, 3-mercaptopropionic acid (MPA), tri (2-carboxyethyl) phosphine hydrochloride (TCEP), N-(3-dimethylaminopropyl)-N0 -ethyl-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) were purchased from SigmaAldrich (St. Louis, MO). Sodium sulfide (Na2S 9H2O), sodium borohydride (NaBH4), and other routine chemicals were purchased from Nanjing Chemical Co. Ltd. Cadmium nitrate tetrahydrate (Cd(NO3)2 4H2O) and europium (III) oxide (Eu2O3) was supplied by Sinopharm Chemical Reagent Co. Ltd. All reagents were of
59
analytical grade and used as received. 0.10 M phosphate buffer solution (PBS, KH2PO4–K2HPO4) containing 0.050 M K2S2O8 (pH 8.3) was used for ECL detection, 0.10 M Tris–HCl buffer (pH 7.4) containing 0.10 M NaCl was used for storing modified GCE, and 0.10 M PBS (pH 7.4) containing 0.10 M NaCl and 5.0 mM MgCl2 was for hybridization and preparation of DNA stock solutions. All aqueous solutions were prepared using ultra-pure water (Milli-Q, Millipore). 2.2. Apparatus The ECL emission measurements were conducted on a MPI-E multifunctional electrochemical and chemiluminescent analytical systems (Remax Electronic Instrument Limited Co., Xi'an, China, 350 nm–650 nm) by cyclic potential scan at room temperature, and the voltage of the PMT was set at 500 V in the process of detection. The experiments were carried out with a conventional three-electrode system. The working electrode was a 3 mm diameter glassy carbon electrode (GCE) modified with NCs composite film, while a Pt wire and saturated calomel electrode (SCE) served as the counter and reference electrodes, respectively. ECL spectra were obtained by a series of optical filters (from 440 nm to 640 nm, spaced 20 nm, Omega Optical Inc, USA). The UV–vis absorption spectra were obtained on a Shimadzu UV-3600 UV–vis-NIR photospectrometer (Shimadzu Co.). 2.3. Synthesis of CdS:Eu NCs and preparation of CdS:Eu NCs film The CdS:Eu NCs were prepared according to our previous work with some modification (Deng et al., 2012). Briefly, Cd(NO3)2 4H2O (0.1683 g) was dissolved in 30 mL ultra-pure water with 112.5 μL 0.080 M Eu(NO3)3 solution, and heated to 70 1C under stirring. Then a freshly prepared solution of Na2S 9H2O (0.7205 g) in 30 mL ultra-pure water was injected and instantly orange– yellow precipitates were obtained. The reaction was held at 70 1C for 3 h with continuous refluxing. The final reaction precipitates were centrifuged and washed thoroughly with absolute ethanol three times, followed by washing with ultra-pure water to get rid of any Eu3 þ and other ions remaining outside the clusters. Then the resulting precipitate was ultrasonically dispersed into water for centrifugation to collect the upper yellow solution of CdS:Eu NCs. The undoped CdS NCs were also synthesized by the same method except that Eu(NO3)3 was not added. 10 μL of CdS:Eu NCs (about 1.0 mg/mL) solution was drop-cast onto a GCE surface and evaporated in air at room temperature. The CdS:Eu NCs modified GCE was stored in 0.10 M NaCl þ0.10 M Tris–HCl buffer (pH 7.4). 2.4. Synthesis of uncapped AuNPs AuNPs were synthesized through reduction of HAuCl4 by NaBH4 according to the procedure of literature with some modification (Bae et al., 2004). 0.60 mL of ice cold 0.10 M NaBH4 was added to 20 mL aqueous solution containing 2.5 10 4 M HAuCl4 under stirring. The solution immediately turned to orange–red color, indicating the formation of gold nanoparticles. Keep on stirring in ice bath for 10 min. Then, the solution reacted at room temperature for another 3 h, during which time its color changed from orange–red to wine red. The prepared AuNPs were stored at 4 1C. 2.5. Preparation of MCH/TBA/AuNP composites 50 mL of 0.85 mM TBA in 0.10 M PBS (pH 7.4) was added into 500 mL Au colloidal solution containing 0.10 M NaCl and 0.50 mM MgCl2, followed by addition of 5.0 mL of 0.73 M MCH in 0.10 M PBS (pH 7.4). The resulting colloidal solution was kept in refrigerator at 4 1C for 2 h. Finally, the resulting MCH/TBA/AuNP were washed three times with 0.1 M PBS (pH 7.4), and resuspended in 0.10 M
60
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
PBS containing 0.50 M NaCl and 5.0 mM MgCl2 (pH 7.4) and stored at 4 1C.
2.6. Preparation of BSA/ssDNA3/TBA/AuNP composites TBA and ssDNA3 (bio bar code DNA, bbcDNA) modified with a thiol at their 50 -end were used to prepare ssDNA–AuNP conjugates. Briefly, 50 μL of 0.85 μM TBA and 4.0 μM bbcDNA (noncomplementary to ssDNA2) in 0.10 M PBS (pH 7.4) were activated with 1.5 μL 10 mM TCEP to reduce disulfide bonds, then added to 500 μL Au colloidal solution containing 0.10 M NaCl and 0.50 mM MgCl2. The resulting colloidal solution was kept in refrigerator at 4 1C for 16 h, followed by blocking the AuNPs with 2 wt% BSA solution for 1 h. Finally, the resulting composites were washed three times with 0.10 M PBS (pH 7.4) and resuspended in 0.10 M PBS containing 0.50 M NaCl and 5.0 mM MgCl2 (pH 7.4) at 4 1C for further use.
2.7. Fabrication of the ECL aptasensor The beforehand prepared CdS:Eu NCs film on GCE was immersed in 1.0 mL 0.10 M NaCl þ 0.10 M Tris–HCl buffer (pH 7.4) containing 3.0 mM MPA for 3 h at 4 1C. Then the terminal carboxylic acid groups of the MPA/CdS:Eu/GCE were activated by immersion in 1.0 mL of 0.10 M 1-methylimidazol aqueous solution (pH 7.4) containing 20 mg EDC and 10 mg NHS for 2 h at 4 1C. Next, the electrode was soaked in 100 mL of the stable colloidal solution of MCH/TBA/AuNP composites (or BSA/ssDNA3/TBA/AuNP composites) for 24 h at 4 1C. The as-prepared DNA biosensor was washed thoroughly at each step with 0.1 M PBS (pH 7.4) and stored in the 0.1 M NaCl þ0.1 M Tris–HCl buffer (pH 7.4) for 24 h to remove the unlinked MCH/TBA/AuNP composites before hybridization. Finally, the electrode was soaked in MCH or BSA solution at 4 1C for 1 h to block the non-specific binding sites of CdS:Eu NCs film and was washed thoroughly and stored in the 0.1 M NaCl þ0.1 M Tris–HCl buffer (pH 7.4) for further use. Then, the prepared GCE was immersed into 100 μL of 0.10 mM ssDNA2 solution (0.10 M PBS containing 0.50 M NaCl and 5.0 mM MgCl2, pH 7.4) to form dsDNA–AuNP conjugates on the surface. The hybridization reaction was carried out for 1 h at 40 1C with mechanical shaking. Subsequently, the electrode was washed thoroughly with Tris–HCl buffer (0.10 M, pH 7.4) to remove unhybridized ssDNA2.
2.8. Amplified ECL detection of thrombin Sample solutions containing various concentrations of thrombin were prepared in 0.10 M NaCl þ0.10 M Tris–HCl buffer (pH 7.4). In a typical test, the assembled aptasensor was incubated in 100 μL of sample solution for 1 h at 37 1C, followed by thoroughly washing with the same buffer to remove unbound thrombin and replaced ssDNA2. The aptasensor before and after the formation of thrombin–TBA complex was in contact with 0.10 M PBS (pH 8.3) containing 0.050 M K2S2O8 and scanned from 0 to –1.35 V. ECL signals related to the thrombin concentrations could be measured.
3. Result and discussion 3.1. Mechanism of the “off–on–off” ECL aptasensor The principle of TBA-based assay for thrombin using AuNPs as both ECL quencher and enhancer is shown in Scheme 1. CdS:Eu NCs used as ECL emitter were first coated on GCE surface. Our previous work has demonstrated that the CdS:Eu NCs at 1.5% doping level showed 4-folds stronger and more stable cathodic ECL signals compared to pure CdS NCs, for Eu3 þ ions could alter the surface of CdS NCs and create a new surface state-Eu3 þ complex to facilitate effective energy transfer from host to Eu3 þ ions (Deng et al., 2012). The ECL processes of the prepared CdS:Eu film are proposed as follows (Deng et al., 2012): CdS:Eu þne-n(CdS:Eu) d
(1)
S2O28 þe -SO24
(2)
þ SO4 d
(CdS:Eu) d þ SO4 d -(CdS:Eu)n þSO24
(3)
(CdS:Eu)n-CdS:Eu þhν
(4)
Upon potential scaning with an initial negative direction, the CdS:Eu NCs immobilized on the electrode were reduced to (CdS: Eu) d by charge injection, while the coreactant S2 O28 was reduced to the strong oxidant SO4 d , and then (CdS:Eu) d could be oxidized by SO4 d to (CdS:Eu)n to emit light. Known as a widely used anti-thrombin aptamer, TBA29 (50 AGTCCGTGGTAGGGCAGGTTGGGGTGAC30 ), which is able to bind selectively onto the exosite of thrombin (heparin-binding sites) with a high specificity versus other substances (Jain et al., 2007), possesses a changeable hairpin structure with 4-bp stem and G-rich DNA strand to form 3-D G4 structure binding to thrombin. One more stem was added to the TBA29 to get a more stable
Scheme 1. TBA-related ECL “off–on–off” platform based on energy transfer between CdS:Eu NCs film and AuNPs.
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
hairpin TBA in our system (ssDNA1 was short for TBA). Then, as illustrated in Scheme 1, a TBA dually labeled with an amino at its 50 end and thiol-linked AuNP at its 30 end was immobilized on CdS: Eu NCs film through EDC and NHS. In the absence of ssDNA2, the immobilized probe was in a “closed” state which caused a 55.1% ECL intensity decrease (Fig. 1, curve b) compared with that of the CdS:Eu NCs film before assembly (curve a). This hairpin structure on the GCE also reserved enough space for the following reactions, which avoided the surface density optimization procedure. After hybridization with ssDNA2, the hairpin structure was changed to form dsDNA strands and make AuNPs far from the emitter, which led an enhancement of 72.1% in ECL peak height (from curve a to curve c). Finally, the AuNP/G4–TBA–thrombin complexes were formed with 76.8% ECL signal decrease in the presence of 1 pM thrombin (curve d) compared to original CdS:Eu NCs film, resulting in a total 7.4-fold ECL intensity variation (from curve c to curve d). Thus, an “off–on–off” ECL aptasensor was constructed. To better clarify the ECL variation mechanism, control experiments without the involvement of AuNPs were carried out (inset of Fig. 1). The result displayed that the immobilization of TBA on GCE, the hybridization between TBA and its complementary ssDNA2, and the formation of TBA–thrombin conjugates did not bring obvious changes in ECL intensity. The results suggested that
Fig. 1. Cyclic ECL on potential curves in various cases. (a) GCE–CdS:Eu NCs, (b) GCE–CdS:Eu NCs/TBA/AuNP–MCH, (c) GCE–CdS:Eu NCs/TBA/AuNP–MCH/ ssDNA2 and (d) GCE–CdS:Eu NCs/TBA/AuNP–MCH/1 pM thrombin. Inset: Cyclic ECL on potential curves in corresponding cases without AuNPs. (a0 ) GCE–CdS:Eu NCs, (b0 ) GCE–CdS:Eu NCs/TBA, (c0 ) GCE–CdS:Eu NCs/TBA/ssDNA2, (d0 ) GCE–CdS:Eu NCs/TBA/1 pM thrombin. ECL detection buffer: 0.1 M PBS (pH 8.3) containing 0.05 M K2S2O8. Scan rate: 100 mV s 1.
61
in our ECL system, the intensity variations were attributed to the ECL–RET between AuNPs and the CdS:Eu NCs. Obviously, the key to promoting the detection sensitivity of the aptasensor is to improve the efficiency of ECL–RET between CdS: Eu NCs film and AuNPs. As we know, the factors that affect the efficiency involve the spectral overlap between the donor's emission and the acceptor's absorption, the distance between the donor and acceptor, the extinction coefficient of the acceptor, the lifetime of the donor and also external magnetic field (Biju et al., 2008; Sapsford et al., 2011; Sokolov et al., 1998). Here, the separation length between CdS:Eu NCs and AuNPs was controlled by the length of TBA. In this case, the separation distance was about 12 nm after hybridization, which was proven to be an appropriate distance for ECL-induced SPR enhancement (Wang et al., 2011), and the extinction coefficient of AuNPs after different modification (MCH or BSA) should not vary distinctly. Thus, the overlap of emission/absorption spectra, the lifetime of the excited CdS:Eu NCs and magnetic field caused by CdS:Eu film came to be the points to influence the efficiency. As we know, SPR of AuNPs is associated with the collective excitation of free conduction electrons on the nanoparticle surface which is related to particle size and suface structure, and thus could be tuned in a wide region from visible to infrared. The tunability of the AuNPs offers possibilities for improving the efficiency of ECL–RET in this system. The modification of the AuNP surface with a molecule that is bound chemically to its surface can alter the SPR due to the dielectric environment change close to the nanoparticle surface (Vangala et al., 2013). As shown in Fig. 2B, AuNPs with an average size of 5 nm possessed the absorption around 512 nm (curve a), while AuNPs blocked by BSA displayed an absorption maximum at ca. 523 nm (curve c), and MCH blocked by AuNPs showed a wider band with an absorption maximum at 600 nm (curve b), indicating more change of the AuNP surface electronic structure caused by MCH, while slight change by oligonucleotides and BSA. The influence of the extent of overlap between emission and absorption spectra on Förster-resonance energy transfer (FRET, be called quenching efficiency in this work) could be reflected by using CdS NCs as reference as shown in Fig. S1B. A 50.6% quenching by thrombin-induced proximal AuNPs were obtained by BSA-blocked AuNP conjugates, while a 32.4% quenching in MCH-blocked AuNP conjugates. The obvious difference was attributed to different degree of overlap between the ECL spectrum of CdS film (curve a of Fig. 2A) and the absorption spectra of two ligands modified AuNPs (curve b and curve c of Fig. 2B). More precisely, the absorption spectra of AuNP/BSA perfectly overlapped the CdS NCs ECL emission, while AuNP/MCH partly overlapped. However, the results of applying CdS:Eu NCs as emitter showed
Fig. 2. (A) ECL spectra of (a) pure CdS NCs film and (b) CdS:Eu NCs film. (B) UV–vis absorption spectra of (a) AuNPs, (b) TBA–AuNP composite blocked with MCH and (c) ssDNA3–TBA–AuNP composite blocked with BSA.
62
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
improved quenching efficiency. A 76.8% decrease by thrombininduced proximal AuNPs occurred by MCH-blocked AuNP conjugates, while a 63.6% decrease in BSA-blocked AuNP conjugates (Fig. S1A). The improvement could be due to characteristics of ECL spectrum of CdS:Eu NC film (curve b of Fig. 2A). There existed double peaks from 450 to 550 nm of recombination emission of host CdS surface states, a high peak of the characteristic transitions of Eu3 þ ions around 620 nm and also a shoulder peak around 580 nm. The multi-emission (could be seen as integration of bulk materials and quantum effect) allowed a kind of universality for different ligands blocked AuNPs. Thus more overlap could be obtained. Moreover, the broaden absorption from 500 nm to 600 nm of AuNPs blocked by MCH (curve b of Fig. 2B) had better spectral overlap with ECL emissions from CdS:Eu NCs, especially the most intense peak around 620 nm, resulting more efficient RET from CdS:Eu NC film to MCH blocked AuNPs than BSA blocked AuNPs. On the other side, the lifetime of the excited CdS:Eu NCs was proved to be improved compared with pure CdS NCs by reducing the non-radiative transition probability of the excited NCs, which means more efficient dipole–dipole interaction between CdS:Eu NCs and AuNPs (Deng et al., 2012). As a result, CdS:Eu NCs was more easily quenched by AuNPs than CdS NCs. As for enhancement, overlap of emission/absorption spectra also had similar effect on the efficiency. When CdS NCs were emitters, BSA blocked AuNPs got a 4.95-fold ECL enhancement, while MCH blocked AuNPs got 1.47-fold (Fig. S1B). However, the results of using CdS:Eu NCs as emitter were a similar 1.72-fold by
Fig. 3. The ECL decrease after hybridization (denoted as Ihy) and after incubating with different concentrations of target protein (denoted as I) (ΔI¼ Ihy I) in the cases of CdS:Eu NCs–AuNPs/MCH, CdS:Eu NCs–AuNPs/BSA, CdS NCs–AuNPs/BSA and CdS NCs–AuNPs/MCH, respectively.
MCH blocked AuNPs and BSA blocked AuNPs (Fig. S1A). The less enhancement could be attributed to the internal magnetism of doped Eu3 þ to form an extra magnetic and then negative influence on the ECL–SPR interaction (Wang et al., 2011). Furthermore, as we discussed before, the doped Eu3 þ ions has already dramatically reduced the non-radiative transition probability of excitions on CdS:Eu NCs surface (Deng et al., 2012). Thus, it was not surprising that the cooperation of AuNPs could not bring further enhancement. However, the 4-fold enhancement in ECL intensity and improved lifetime by Eu3 þ doping and the following dramatically quenching by MCH blocked AuNPs could make up for this deficiency, which is confirmed in Fig. 3. The strongly effective quenching could also reduce background signals to get a rather low detection limit. 3.2. ECL aptasensor detection of thrombin Owing to the high affinity of TBA binding with thrombin, and the stronger constant interaction compared to the hybridization between ssDNA2 and TBA, ssDNA2 could be easily displaced by thrombin. Thus, stable G4-structure TBA–thrombin complex was formed to diminish the ECL emission. As shown in Fig. 4A, the more the displacement that took place, the more the ECL intensity decreased. Fig. 4B displayed the relationship between the decrease in ECL peak height after hybridization (denoted as Ihy, which was stable enough for detection processes, as shown in the inset of Fig. 4A
Fig. 5. Selectivity of the ECL aptasensor to thrombin (10 fM) by comparing to the interfering proteins at 40 fM: bovine serum albumin (BSA), hemoglobin (Hb), lysozyme (Lyso), and the mixed sample containing 10 fM thrombin and BSA, Hb, and Lyso at the concentrations of 40 fM. The error bars show the standard deviation of three replicate determinations.
Fig. 4. (A) ECL signals of the aptasensor incubated with different concentrations of thrombin (from top to down, 0, 0.01, 1, 10 and 100 fM and 1 pM). Inset: the ECL emission under continuous cyclic potential scan with the concentrations of 0 and 1 pM thrombin for 5 cycles. (B) Relationship between ΔI and thrombin concentration (0.5 aM–5 pM), three measurements for each point. Inset: logarithmic calibration curve for thrombin.
L. Deng et al. / Biosensors and Bioelectronics 59 (2014) 58–63
and Fig. S2) and after incubating with target protein (denoted as I) (ΔI¼ Ihy I) and thrombin concentrations (0.5 aM–5 pM). ΔI was found to be logarithmically to the concentration of thrombin in a wide range from 50 aM to 1 pM (R¼0.994) (inset in Fig. 4B). The limit of detection (LOD) of this system was as low as 1 aM, which was much lower than many other previously reported ECL detection of thrombin (Fang et al., 2008; Wang et al., 2012). The selectivity of the aptasensor for thrombin was tested via comparing the ECL signal changes brought by four other proteins: bovine serum albumin (BSA), mouse IgG, hemoglobin (Hb), and lysozyme (Lyso). Fig. 5 compared the ECL responses of the aptasensor after incubation in BSA, mouse IgG, Hb, and Lyso solutions under the same experimental conditions and at the same concentration of 40 fM (The corresponding cyclic ECL on potential curves in the above cases were shown in Fig. S3). The results showed that the presence of BSA, mouse IgG, Hb, and Lyso did not induce any great changes of signal. While incubating of the aptasensor into 10 fM thrombin, the intensity greatly decreased. Similarly, a mixed sample (10 fM thrombin coexisted with 40 fM BSA, mouse IgG, Hb, and Lyso) did not display large signal change compared with that of thrombin alone. This comparison essentially suggested that the aptasensor was highly selective and had quite an affinity toward thrombin. 4. Conclusions This work demonstrated an ultrasensitive “off–on–off” aptasensor based on distance-controlled ECL–RET between CdS:Eu NCs and AuNPs. Thus, thrombin-induced configuration transformation of single TBA induced a total 7.4-fold variation of ECL signals. This signal variation may be further amplified by using other energy matching non-magnetic ECL emitters instead of the diluted magnetic semiconductor. Such great amplification together with the specificity of the TBA made a concentration detection limits as low as attomolar level for thrombin. This principle could be also applied to many other bioassays and would widen understanding of ECL exciton-SPR interactions. Acknowledgments This work was supported by the 973 Program (2012CB932600) and the National Natural Science Foundation of China (Grant no. 21135003, 21025522, 21105019), the National Natural Science Funds for Creative Research Groups (Grant no. 21121091) of China. Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.03.012.
63
References Babu, E., Mareeswaran, P.M., Rajagopa, S., 2013. J. Fluoresc. 23, 137–146. Bae, Y., Myung, N., Bard, A.J., 2004. Nano Lett. 4, 1153–1161. Biju, V., Itoh, T., Anas, A., Sujith, A., Ishikawa, M., 2008. Anal. Bioanal. Chem. 391, 2469–2495. Boeneman, K., Mei, B.C., Dennis, A.M., Bao, G., Deschamps, Je.R., Mattoussi, H., Medintz, I.L., 2009. J. Am. Chem. Soc. 131, 3828–3829. Centi, S., Tombelli, S., Minunni, M., Mascini, M., 2007. Anal. Chem. 79, 1466–1473. Deng, L., Shan, Y., Xu, J.J., Chen, H.Y., 2012. Nanoscale 4, 831–836. Dihanich, M., Kaser, M., Reinhard, E., Cunningham, D., Monard, D., 1991. Neuron 6, 575–581. Fang, L.Y., Lu, Z.Z., Wei, H., Wang, E., 2008. Anal. Chim. Acta 628, 80–86. Forrest, S.R., 1997. Chem. Rev. 97, 1793–1896. He, L.J., Wu, M.S., Xu, J.J., Chen, H.Y., 2013. Chem. Commun. 49, 1539–1541. Huang, Y., Chen, J., Zhao, S.L., Shi, M., Chen, Z.F., Liang, H., 2013. Anal. Chem. 85, 4423–4430. Hwang, K.K., Grossman, J.M., Visvanathan, S., Chukwuocha, R.U., Woods Jr, V.L., Le, D.T., Hahn, B.H., Chen, P.P., 2001. J. Immunol. 167, 7192–7198. Iliuk, A.B., Hu, L.H., Tao, W.A., 2011. Anal. Chem. 83, 4440–4452. Jain, P.K., Huang, X.H., El-Sayed, I.H., El-Sayad, M.A., 2007. Plasmonics 2, 107–118. Khlebtsov, N.G., 2008. Quantum Electron. 38, 504–529. Krauss, I.R., Merlino, A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F., 2012. Nucleic Acids Res. 40, 8119–8128. Li, M.Y, Li, J., Sun, L., Zhang, X.L., Jin, W.R., 2012a. Electrochim. Acta 80, 171–179. Li, Y.F., Liu, L.L., Fang, X.L., Bao, J.C., Han, M., Dai, Z.H., 2012b. Electrochim. Acta 65, 1–6. Liao, Y.H., Yua, R., Chai, Y.Q., Mao, L., Zhuo, Y., Yuan, Y.L., Bai, L.J., Yuan, S.R., 2011. Sens. Actuators B-Chem. 158, 393–399. Liu, J.W., Cao, Z.H., Lu, Y., 2009. Chem. Rev. 109, 1948–1998. Niu, S.Y., Qu, L.J., Zhang, Q., Lin, J.H., 2012. Anal. BioChem. 421, 362–367. Osborne, S.E., Ellington, A.D., 1997. Chem. Rev. 97, 349–370. Ramanaviciene, A., German, N., Kausaite-Minkstimiene, A., Voronovic, J., Kirlyte, J., Ramanavicius, Arunas, 2012. Biosens. Bioelectron. 36, 48–55. Richter, M.M., 2004. Chem. Rev. 104, 3003–3036. Sapsford, K.E., Granek, J., Deschamps, J.R., Boeneman, K., Blanco-Canosa, J.B., Dawson, P.E., Susumu, K., Stewart, M.H., Medintz, I.L., 2011. ACS Nano 5, 2687–2699. Sarkar, S., Maity, A.R., Karan, N.S., Pradhan, N., 2013. J. Phys. Chem. C 117, 21988–21994. Shan, Y., Xu, J.J., Chen, H.Y., 2009. Chem. Commun. 8, 905–907. Shan, Y., Xu, J.J., Chen, H.Y., 2011. Nanoscale 3, 2916–2923. Sokolov, K., Chumanov, G., Cotton, T.M., 1998. Anal. Chem. 70, 3898–3905. Sun, L.Y., Chu, H.H., Yan, J.L., Tu, Y.F., 2012. Electrochem. Commun. 17, 88–91. Tang, Q.J., Su, X.D., Loh, K.P., 2007. J. Colloid Interface Sci. 315, 99–106. Vangala, K., Siriwardana, K., Vasquez, E.S., Xin, Y., Pittman Jr, C.U., Walters, K.B., Zhang, D.M., 2013. J. Phys. Chem. C 117, 1366–1374. Wang, J., Shan, Y., Zhao, W.W., Xu, J.J., Chen, H.Y., 2011. Anal. Chem. 83, 4004–4011. Wang, J., Zhao, W.W., Zhou, H., Xu, J.J., Chen, H.Y., 2013. Biosens. Bioelectron. 41, 615–620. Wang, Y., Yuan, R., Chai, Y.Q., Yuan, F Y.L., Bai, L.J., 2012. Biosens. Bioelectron. 38, 50–54. Wu, M.S., Shi, H.W., He, L.J., Xu, J.J., Chen, H.Y., 2012. Anal. Chem. 84, 4207–4213. Wu, Y.M., Xu, W.J., Bai, L.J., Yuan, Y.L., Yi, H.Y., Chai, Y.Q., Yuan, R., 2013. Biosens. Bioelectron. 50, 50–56. Xiao, Y., Piorek, B.D., Plaxco, K.W., Heeger, A.J., 2005. J. Am. Chem. Soc. 127, 17990–17991. Xue, L.Y., Zhou, X.M., Da, X., 2012. Anal. Chem. 84, 3507–3513. Yang, L.Z., Zhu, J., Xu, Y., Yun, W., Zhang, R.Y., He, P.G., Fang, Y.Z., 2011. Electroanalysis 23, 1007–1012. Zhang, H.R., Xia, X.H., Xu, J.J., Chen, H.Y., 2012. Electrochem. Commun. 25, 112–115. Zhou, H., Zhang, Y.Y., Liu, J., Xu, J.J., Chen, H.Y., 2012. J. Phys. Chem. C 116, 17773–17780.
